Entry information : MgrKat02 (MagKatE2)
Entry ID 5231
Creation 2007-05-28 (Christophe Dunand)
Last sequence changes 2007-05-28 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: MgrKat02 (MagKatE2)
Name (synonym) MgrKat02 (MagKatE2)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Magnaporthaceae Magnaporthe
Organism Magnaporthe grisea (Pyricularia grisea)    [TaxId: 148305 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MgrKat02
start..stop
S start..stop
CtheKat2 902 0 3..698 4..722
CthedisKat2 900 0 18..698 21..722
CgraKat02 888 0 4..698 3..715
CgKat02 888 0 3..698 4..704
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1827741..1828016 276 N° 2 1828102..1828258 157 N° 3 1828396..1828418 23 N° 4 1828517..1828628 112
N° 5 1828685..1828721 37 N° 6 1828791..1829220 430 N° 7 1829296..1829413 118 N° 8 1829486..1829575 90
N° 9 1829674..1830530 857  
join(1827741..1828016,1828102..1828258,1828396..1828418,1828517..1828628,1828685 ..1828721,1828791..1829220,1829296..1829413,1829486..1829575,1829674..1830530)


exon

Literature and cross-references MgrKat02 (MagKatE2)
Literature Dean RA, Talbot NJ, Ebbole DJ, Farman ML, Mitchell TK, Orbach MJ, Galagan JE and Birren BW. The genome sequence of the rice blast fungus Magnaporthe grisea. Nature 434:980-986 (2005)
Protein ref. UniProtKB:   A4R8L1
DNA ref. JGI genome:   Supercontig_6.13 (1827741..1830530)
Cluster/Prediction ref. UniGene:   Mgr.9988
Protein sequence: MgrKat02 (MagKatE2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   699 (680)
PWM (Da):   %s   76902.82 (74804.7)  
PI (pH):   %s   6.05 (5.96) Peptide Signal:   %s   cut: 20 range:20-699
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPRSSMLGLWASLVWIAQAGCPYADPAALRPREEHTDDYLAQFSVDDQDKFLTSDVGGPIGDQRSLKAGARGSTLLEDFVFRQKITHFDHERVPERAVHARGAGAHGTFTSYGDFSNITSASFLNSAGKRTPVFVRFSTVAGSRAIPTRAIDAIQFPDLVHAVKPSPDKEIPTAATGKRPDYKPNPDATHDSAWDFFSQQSSSLHALFWAMSGYGIPRSYRHMDGFGVHTFRMVADNGESRLVKFHFKTKQGKASLIWEEAQVLSGKNPDFHRQDLWDAIEAGHGPEWEFGVQVVNEEDALRFGFDMLDPTKILPEDLVPVHPLGLLKLDRNPINYFAETEQIFQPGHLVRGIDFTEDPLLQGRVFSYLDTQLNRHNGPNFEQLPINRPRVTVHNNNRDGSGQNFIHKNIHPYTPSALNEFPKQADDDQGRGFMTAPRRRTQDAALVRELSETFDDHWTQPRLFWNSITPAEQQILVNAIRFETSNIVNTHVRQKVLQQLNRISDELAGRVAQALGMEAPAPEPAFYHENTTIGLSIFGIKLPTIKTLRVGVLASTGNVASLSQAADLKARFMGDGVAVAVLGETQVEGVDVTYSQSDATVFDGIIIAAGAEGLVAKDAPASALFPIGRPQQLVVDSFRWGKPIGLAAASDDSANIFSSLGTTGPGVFSGDDLGVLVTDFKEGLSTYKFVERFPMDS

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo V, 9 exons) and 1 EST. Strain="70-15".Prediction: Signal peptide for secretion 19 AA long.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCGCTCGTCTATGTTAGGACTATGGGCAAGCCTAGTCTGGATTGCCCAGGCCGGCTGCCCCTATGCAGACCCAGCAGCCTTGCGTCCTCGAGAGGAGCACACGGATGATTATCTA
GCACAATTCTCGGTTGATGACCAGGACAAGTTTCTTACATCCGACGTTGGAGGTCCAATAGGGGATCAAAGAAGTCTGAAGGCTGGTGCGCGAGGCTCGACGCTTCTTGAGGACTTTGTC
TTTCGTCAGAAAATAACACATTTCGATCATGAGCGT
GTAAGTCAGCATTGAACATGATTCATATCACCAGAGGGCTACCTCAAGCTTCCACGGCTGAGAAACTCATATATCGACGTTATA
GGTTCCAGAACGCGCCGTCCATGCCAGGGGCGCAGGCGCTCACGGCACCTTCACAAGCTATGGTGACTTTAGCAACATCACCTCGGCATCGTTTCTGAACTCTGCTGGCAAGCGGACTCC
GGTGTTTGTGCGCTTCTCTACCGTGGCTGGCTCGAGAG
GTAGTGCGGATAGCGCCAGGGATGTGCACGGGTTTGCCACGAGATTGTATGATGCCCGCGCACAACGACCGCACCCTTGCAC
AGTTTTAGTCCGCAAGGGAGTGTCTGCTTACATGCTAACTCCCACAACTCAACAGCTATACCGACGAGGGCAATTTTGGTGAGTCCTGCGAGCCTTGGGAAAATATGAGAGGGAGTTGCT
GACAGTGCCCGCGGATAGATATTGTTGGAAACAATGTACCTGTTTTCTTCATACAGGACGCTATACAATTTCCTGATTTGGTTCATGCCGTCAAACCCAGCCCAGACAAGGAGATACCAA
CTGCAGCGACCGGTAAGCGCCCAGACTACAAGCCTAATCCTGATGCCA
GTAAGCATCAGCACTGAGACGATGGTGATGACTAAAGTTTATGACCGCGCACGTAGCTCATGATTCGGCTTG
GGACTTTTTCAGTCAACAATC
GTAAGCGATGGTTCCTTGAAGTATTCCAGAATGGGATGATCTTTCAATACTGAATTTTGATGACAATAGAAGTTCATTACATGCTCTTTTCTGGGCCAT
GTCAGGCTATGGAATTCCACGATCGTATCGTCACATGGATGGGTTCGGAGTCCATACGTTCCGCATGGTCGCCGACAATGGCGAGTCGAGATTGGTCAAGTTTCACTTCAAGACCAAGCA
GGGCAAAGCAAGCCTGATTTGGGAAGAGGCCCAAGTCCTGTCCGGCAAGAACCCCGACTTTCACCGGCAAGATCTTTGGGATGCTATCGAGGCTGGCCACGGTCCCGAATGGGAGTTTGG
AGTCCAGGTTGTCAACGAGGAGGATGCCCTGAGGTTTGGCTTCGATATGCTCGATCCGACAAAGATCCTCCCAGAGGATCTTGTGCCTGTTCATCCTCTAGGGCTTCTCAAGCTTGATCG
GAATCCCATCAACTATTTCGCCGAGACGGAGCAAATCATG
GTAAGTCATTTAGACCACTTGGGACCGCAGCAACATATGGTTATTTGTCAATATCGAAGCCTAACCTTGTGACAGTTTCA
ACCTGGACACCTCGTCAGGGGTATCGACTTCACCGAGGATCCTCTTCTTCAGGGCCGGGTGTTTTCATACCTTGATACTCAGCTCAACCGCCACAATGGACCCAACTTTGAGC
GTGAGAA
ATGAGCCCCAAAGGGTGTTGCTGCCCTAGCGACGATGACAGGTACTGACCTGCTTGAATCCGCAGAACTTCCCATCAACAGACCAAGGGTCACCGTCCACAACAATAATCGCGACGGTTC
AGGGCAGAATTTTATTCACAAGAACATCCATCCTT
GTAAGTCTCCCTGGGAGAAAACTCCCGCCTCGTTGCAGTGGCCATGTGTGCAGAGATAGTAATCGCAACTAATCCCTAACATGCA
TTTACCATGACAGATACACCCAGTGCCCTGAATGAGTTCCCGAAACAGGCCGATGACGACCAAGGCAGAGGCTTCATGACCGCTCCTCGGCGCAGGACCCAGGACGCAGCGCTTGTTCGT
GAGCTCTCCGAGACTTTTGATGACCACTGGACGCAGCCGCGTTTGTTTTGGAACAGCATCACGCCCGCCGAGCAGCAGATTTTGGTCAACGCGATACGATTTGAGACTAGCAACATCGTG
AACACGCACGTCAGGCAGAAAGTCCTTCAGCAGCTCAACCGCATTAGCGACGAACTGGCAGGGCGTGTTGCTCAAGCACTCGGCATGGAGGCGCCCGCTCCCGAGCCAGCTTTCTACCAC
GAAAATACCACTATAGGCTTGTCAATTTTCGGCATCAAGCTGCCCACGATCAAGACGCTCAGGGTGGGCGTCCTTGCCAGCACCGGAAACGTCGCGTCGCTCTCGCAGGCAGCTGACCTC
AAGGCCCGATTCATGGGCGATGGTGTCGCGGTCGCGGTGCTAGGCGAAACACAGGTTGAAGGTGTCGACGTCACCTACTCACAATCCGATGCTACAGTCTTTGATGGCATCATCATTGCG
GCCGGTGCCGAGGGTCTTGTCGCCAAGGATGCACCGGCGTCGGCACTCTTTCCCATAGGCAGGCCACAGCAACTCGTCGTTGACAGCTTCAGATGGGGCAAGCCTATTGGACTGGCCGCA
GCTTCGGACGACTCGGCGAACATTTTCAGCAGCCTAGGAACGACTGGCCCTGGTGTCTTTAGTGGCGATGACCTCGGTGTGCTGGTCACCGATTTCAAGGAGGGGCTGTCGACATATAAG
TTTGTTGAGAGGTTCCCGATGGACTCGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCGCTCGTCTATGTTAGGACTATGGGCAAGCCTAGTCTGGATTGCCCAGGCCGGCTGCCCCTATGCAGACCCAGCAGCCTTGCGTCCTCGAGAGGAGCACACGGATGATTATCTA
GCACAATTCTCGGTTGATGACCAGGACAAGTTTCTTACATCCGACGTTGGAGGTCCAATAGGGGATCAAAGAAGTCTGAAGGCTGGTGCGCGAGGCTCGACGCTTCTTGAGGACTTTGTC
TTTCGTCAGAAAATAACACATTTCGATCATGAGCGT
GTTCCAGAACGCGCCGTCCATGCCAGGGGCGCAGGCGCTCACGGCACCTTCACAAGCTATGGTGACTTTAGCAACATCACCTCG
GCATCGTTTCTGAACTCTGCTGGCAAGCGGACTCCGGTGTTTGTGCGCTTCTCTACCGTGGCTGGCTCGAGAG
CTATACCGACGAGGGCAATTTTGGACGCTATACAATTTCCTGATTTG
GTTCATGCCGTCAAACCCAGCCCAGACAAGGAGATACCAACTGCAGCGACCGGTAAGCGCCCAGACTACAAGCCTAATCCTGATGCCA
CTCATGATTCGGCTTGGGACTTTTTCAGTCAA
CAATC
AAGTTCATTACATGCTCTTTTCTGGGCCATGTCAGGCTATGGAATTCCACGATCGTATCGTCACATGGATGGGTTCGGAGTCCATACGTTCCGCATGGTCGCCGACAATGGCGAG
TCGAGATTGGTCAAGTTTCACTTCAAGACCAAGCAGGGCAAAGCAAGCCTGATTTGGGAAGAGGCCCAAGTCCTGTCCGGCAAGAACCCCGACTTTCACCGGCAAGATCTTTGGGATGCT
ATCGAGGCTGGCCACGGTCCCGAATGGGAGTTTGGAGTCCAGGTTGTCAACGAGGAGGATGCCCTGAGGTTTGGCTTCGATATGCTCGATCCGACAAAGATCCTCCCAGAGGATCTTGTG
CCTGTTCATCCTCTAGGGCTTCTCAAGCTTGATCGGAATCCCATCAACTATTTCGCCGAGACGGAGCAAATCATG
TTTCAACCTGGACACCTCGTCAGGGGTATCGACTTCACCGAGGAT
CCTCTTCTTCAGGGCCGGGTGTTTTCATACCTTGATACTCAGCTCAACCGCCACAATGGACCCAACTTTGAGC
AACTTCCCATCAACAGACCAAGGGTCACCGTCCACAACAATAATCGC
GACGGTTCAGGGCAGAATTTTATTCACAAGAACATCCATCCTT
ATACACCCAGTGCCCTGAATGAGTTCCCGAAACAGGCCGATGACGACCAAGGCAGAGGCTTCATGACCGCTCCTCGG
CGCAGGACCCAGGACGCAGCGCTTGTTCGTGAGCTCTCCGAGACTTTTGATGACCACTGGACGCAGCCGCGTTTGTTTTGGAACAGCATCACGCCCGCCGAGCAGCAGATTTTGGTCAAC
GCGATACGATTTGAGACTAGCAACATCGTGAACACGCACGTCAGGCAGAAAGTCCTTCAGCAGCTCAACCGCATTAGCGACGAACTGGCAGGGCGTGTTGCTCAAGCACTCGGCATGGAG
GCGCCCGCTCCCGAGCCAGCTTTCTACCACGAAAATACCACTATAGGCTTGTCAATTTTCGGCATCAAGCTGCCCACGATCAAGACGCTCAGGGTGGGCGTCCTTGCCAGCACCGGAAAC
GTCGCGTCGCTCTCGCAGGCAGCTGACCTCAAGGCCCGATTCATGGGCGATGGTGTCGCGGTCGCGGTGCTAGGCGAAACACAGGTTGAAGGTGTCGACGTCACCTACTCACAATCCGAT
GCTACAGTCTTTGATGGCATCATCATTGCGGCCGGTGCCGAGGGTCTTGTCGCCAAGGATGCACCGGCGTCGGCACTCTTTCCCATAGGCAGGCCACAGCAACTCGTCGTTGACAGCTTC
AGATGGGGCAAGCCTATTGGACTGGCCGCAGCTTCGGACGACTCGGCGAACATTTTCAGCAGCCTAGGAACGACTGGCCCTGGTGTCTTTAGTGGCGATGACCTCGGTGTGCTGGTCACC
GATTTCAAGGAGGGGCTGTCGACATATAAGTTTGTTGAGAGGTTCCCGATGGACTCGTGA

Retrieve as FASTA