Entry information : BdeCcP02
Entry ID 5239
Creation 2007-04-17 (Marcel Zamocky)
Last sequence changes 2007-04-17 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-05-07 (Catherine Mathe (Scipio))
Peroxidase information: BdeCcP02
Name BdeCcP02
Class Cytochrome C peroxidase    [Orthogroup: CcP002]
Taxonomy Eukaryota Fungi Chytridiomycota Chytridiomycetes Batrachochytrium
Organism Batrachochytrium dendrobatidis    [TaxId: 109871 ]
Cellular localisation Cytosolic
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdeCcP02
start..stop
S start..stop
SpuCcP02 416 9e-149 5..266 4..265
BemeCcP 407 3e-145 2..268 5..271
CangCcP01 401 6e-143 2..268 6..273
AmaCcP03 397 1e-141 2..268 6..272
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 127434..127654 221 N° 2 127148..127266 119 N° 3 126874..127071 198 N° 4 126535..126806 272
complement(join(126535..126806,126874..127071,127148..127266,127434..127654))


exon

Literature and cross-references BdeCcP02
Literature Birren,B. et al., The Broad Institute Genome Sequencing Platform. The Genome Sequence of Batrachochytrium dendrobatidis JEL423. Unpublished
DNA ref. JGI genome:   scaffold_10 (127654..126535)
mRNA ref. JGI transcript:   63696
Protein sequence: BdeCcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   269
PWM (Da):   %s   29962.06  
PI (pH):   %s   7.22
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTLHDYDAVADDIRSILKNEDWDDGSLGPVLVRLSWHASGTYDHKTKTGGSNGATMRFAPESTDDANAGLEHARRFLEPIKAKHPWITYADLWTLAGVVALHAMNGPKVAWRGRSDKNPKTVTVKDIPPNGRLPDAAQGAHHVRDIFYRMGFNDQEIVALSGAHALGRCHADRSGFSGPWTHTPTRFSNQYFVLLTTVKWTKKVWDGPEQFKDPDDELMMLPTDMALLHDPTFAKYVHLYAKDKEAFSKDFAAAYAKLLELGIPRTKI

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Strain="JEL423".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTCTACATGACTACGACGCTGTTGCTGATGATATTCGCAGTATTCTTAAAAACGAGGATTGGGATGACGGTTCTTTAGGTCCTGTACTTGTGCGTCTGTCATGGCATGCTTCTGGT
ACTTATGACCACAAGACAAAAACAGGTGGTTCTAATGGTGCAACCATGCGATTTGCACCCGAGTCCACTGACGATGCTAATGCTGGTCTTGAACATGCTCG
GTATGCATTCACTCATCAT
TGCTGTTTACACTCAATTCATTCGATAGACAAGTATTGATCCATACTGTCGCATTTCCATGTCTGGATGTCTTGTTCATGGTTTTCATTGTTGCGATATCAGATCTGGATGTGTGTATAC
ACTGACGGTCTATCCTTTGTTAAAACAGACGATTCCTTGAACCCATCAAGGCCAAACACCCTTGGATCACCTATGCTGATTTGTGGACCCTTGCTGGAGTGGTTGCTTTGCATGCCATGA
ATGGACCCAAGGTTGCATGGAGACCAG
GTAAACACAATAGTTTGCTCTGTATTCTGAATTCCAAATCTGCATGGATCTATCTATACCAACTCTATTCATCTAGGTCGATCTGACAAGAAT
CCAAAGACGGTTACTGTAAAAGATATTCCTCCAAATGGTCGTCTTCCTGATGCTGCCCAGGGTGCTCATCACGTTCGTGATATCTTTTATCGTATGGGTTTCAACGATCAGGAGATTGTT
GCTCTCAGTGGTGCTCATGCATTGGGTAGATGCCATGCTGACCGTAGTGGTTTTTCTGGAC
GTATGTTGAATTCAAATCTTTAACTTTCCGGTGTTGATGCGTAGTTAACCTGGTATTTA
TACTGTAGCGTGGACTCACACTCCAACCAGGTTTTCCAATCAATATTTTGTTTTATTAACAACTGTGAAATGGACCAAGAAAGTGTGGGATGGGCCAGAGCAATTCAAAGACCCTGATGA
TGAACTCATGATGCTGCCTACTGATATGGCTTTATTACACGATCCGACATTTGCAAAGTATGTCCATCTATATGCCAAAGACAAGGAAGCCTTTTCAAAGGATTTTGCTGCTGCCTATGC
CAAACTTCTTGAATTGGGCATTCCTCGTACCAAGATCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTCTACATGACTACGACGCTGTTGCTGATGATATTCGCAGTATTCTTAAAAACGAGGATTGGGATGACGGTTCTTTAGGTCCTGTACTTGTGCGTCTGTCATGGCATGCTTCTGGT
ACTTATGACCACAAGACAAAAACAGGTGGTTCTAATGGTGCAACCATGCGATTTGCACCCGAGTCCACTGACGATGCTAATGCTGGTCTTGAACATGCTCG
ACGATTCCTTGAACCCATC
AAGGCCAAACACCCTTGGATCACCTATGCTGATTTGTGGACCCTTGCTGGAGTGGTTGCTTTGCATGCCATGAATGGACCCAAGGTTGCATGGAGACCAG
GTCGATCTGACAAGAATCCA
AAGACGGTTACTGTAAAAGATATTCCTCCAAATGGTCGTCTTCCTGATGCTGCCCAGGGTGCTCATCACGTTCGTGATATCTTTTATCGTATGGGTTTCAACGATCAGGAGATTGTTGCT
CTCAGTGGTGCTCATGCATTGGGTAGATGCCATGCTGACCGTAGTGGTTTTTCTGGAC
CGTGGACTCACACTCCAACCAGGTTTTCCAATCAATATTTTGTTTTATTAACAACTGTGAAA
TGGACCAAGAAAGTGTGGGATGGGCCAGAGCAATTCAAAGACCCTGATGATGAACTCATGATGCTGCCTACTGATATGGCTTTATTACACGATCCGACATTTGCAAAGTATGTCCATCTA
TATGCCAAAGACAAGGAAGCCTTTTCAAAGGATTTTGCTGCTGCCTATGCCAAACTTCTTGAATTGGGCATTCCTCGTACCAAGATCTGA

Retrieve as FASTA