Entry information : GmPrx35(Glyma.07G260300 / Glyma07g39020.1/ Prx2b)
Entry ID 525
Creation 2006-10-30 (Christophe Dunand)
Last sequence changes 2011-07-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2019-02-27 (Christophe Dunand)
Peroxidase information: GmPrx35(Glyma.07G260300 / Glyma07g39020.1/ Prx2b)
Name GmPrx35(Glyma.07G260300 / Glyma07g39020.1/ Prx2b)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Floral meristems
Hypocotyls
Leaves (fully expanded)
Roots
Seed coats
Somatic embryos
Inducers Pathogen interaction
Phytophthora infection
Salicylic acid treatment
Salt stress
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx35
start..stop
S start..stop
GmPrx02 650 0 1..334 1..330
PvPrx11 647 0 1..334 1..334
VuPrx01 644 0 1..334 1..333
PcoPrx03 632 0 16..336 15..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 43623261..43623494 234 N° 2 43622943..43623131 189 N° 3 43622539..43622704 166 N° 4 43621674..43622095 422
complement(join(43621674..43622095,43622539..43622704,43622943..43623131,4362326 1..43623494))


exon

Literature and cross-references GmPrx35(Glyma.07G260300 / Glyma07g39020.1/ Prx2b)
Literature Public Soybean EST Project. Harris,N. and Gijzen,M. Soybean peroxidase transcripts.
Protein ref. UniProtKB:   Q9XFI6
DNA ref. Phytozome 11:   Gm07 (43623494..43621674)
Cluster/Prediction ref. UniGene:   Gma.30052
Protein sequence: GmPrx35(Glyma.07G260300 / Glyma07g39020.1/ Prx2b)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336 (319)
PWM (Da):   %s   37446.32 (35634.3)  
PI (pH):   %s   8.48 (8.56) Peptide Signal:   %s   cut: 27 range:18-336
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPKGLTFLAVLICVSALSLSPSVAGEGQNNGLVMNFYKESCPQAEDIITEQVKLLYKRHKNTAFSWLRNIFHDCAVQSCDASLLLDSTRRSLSEKETDRSFGLRNFRYIETIKEALERECPGVVSCADILVLSARDGIVSLGGPHIPLKTGRRDGRRSRADVVEQFLPDHNESISAVLDKFGAMGIDTPGVVALLGAHSVGRTHCVKLVHRLYPEIDPALNPDHVPHILKKCPDAIPDPKAVQYVRNDRGTPMILDNNYYRNILDSKGLLIVDHQLANDKRTKPYVKKMAKSQDYFFKEFSRAITLLSENNPLTGTKGEVRKQCNVANKHHDQDP

Retrieve as FASTA  
Remarks Complete sequence from genomic and 160 ESTs.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATATTTTTAA TGGGAATCAA TTAATTCTTT TTATGGGTAC AATTTATACA TGCTATATTA AGGGGAAGAA AAAAATCTTG AGGGGCAGCT ACCCCAAACC TTTTAATCTA GATCCATTTC  TCAATGTATA ATTTTGATAT ATGTGATAAT ATTTTTCTTT TTTTTTGGGT GTGGTAAGCA TGGTGTTGTA TCACCTCTTT TTCTTGTTAT AAGAAATAAG TGATAGTATA AAATAAATTA  TAAATTATTT CTTATAATAA GAAACGAAAA TAATATTATA TAATAACTAT TAGAAAAAAT ATTTTTTTTA CAGTGAAATA AATGTCATCA CATGTATTAT AATTACACAC ATATATGTTA  ATATTAATTT TTTTAATATT TCAAAAGGCA TAAACGTATA ATCCATCTCA AATTATACAA GTAATCATTC ACTATTAAAA ATCATACTAC ATAGTTTCCG AAGCGTTGAA CATTAGTCAA  TGTGAAAATT AAATTAATGA ATATTTAATA TTTTAGAGAT TATTTATATA ATTTTATTAT TTTAAAGGTT ATTTGAGAGA GTAATATTCT TAAATTAATA AATTTAGATT GATTATCTTT  TGTGAGATAT TTTCTTTATT ATTTTTTTTA TCCATAAAAT TTGAATTCAA AATCTTATTT AAAAATCCTA AGTCTAAAAT CATTCCGATT AATGATTTGT TGGTTCAAAT TGATGATTTT  GTAGAAGCTG GATTATTTTT AGAAACTCAA ATTTAAGTTT ACGCATATTA GTCAAATTTG GTGGAATCTG GGAATGAGGA AATGAAGGAA GGTTGAAAAT GACTTCACAA GCCGCACTGT  GCCAAGCCAC TTGAAATGCC TGACTTTCTT TCTCAGCTGT GTTGCTCGTT GCTTTTTCCA AGTGCAAACA ACTTTTGCCA TATCTCCAAA AAATAAAAAA CCATCTAATC TATCCGAAAT  CCTGAAATCT TTGTGCAAGT TCCGTAGCAT GTTATGATAG TACTTTAGTT GTTAGTAATC GTTTTTTTTT CTCTTAACAT TATATTACTT CATCATATTT ATATTTTTTA AAATATGTCC  AATAATATGA AGTATTTGTG CATCTTTATC CTATTATGTT TATGTTATTT TATAAATAAA ACTTTACTAT TAAATTCTTT TAAAAAATTA ATAAAGTATA ATTATTTTAA AATAAATTAA  CTGGTTGACG CATGAAATTA GTTGGGCGAC GTCACAATTC ACAAACACTT ATATTTTCCG TTGCTTCTAC GCACCAGAGT CCAAAATTTG AAGTTTTGTA ACCAAAAATA GGAAAAGAAA  AGTTGCGCCG AGTCCCCCCT TAGCTAGCCT AGGCACATCA CGTGGTCATT CATTAGTTTA GTAAATGCTT CTCTCTCTCT CTTTACTATT GTCTACTGTA GTCAGATTAT TTTATACAAA  CTAAAAAAAT TAATAAATAA ATATAGGATA ATTATAATTT TATAAAATTA AATTTATTAT CATTAATTTT TTTATTTTTA TAATTTATAT TATAAATATT ATAAGAAATA TCAGTAAAAA  AATGGACACC CTAATTGGTA GGCAACATCT AAAAAGAAAG TATTGAGACA TAAAGCCTAT CTCTTAGTGA GTTGTTTGTG GTGTTGGATC ATGATGAAAG CATCAACATC ACGCACGCTT  TAACCTATAG TTCAAAGAAA AAAGTTTAAT GGACACCTTA ATTCCTAAAC AACATTTAAA ATGAAAAATA AAAAATATAA ATATGATAAA ACTTATCATA TGACAAAAAG AGAAGCATAA  AAAAAATGAA AAATATTAAA AGATGTTTAA AAATAATGAA ATATTTATAT ATAGTATATT ACTCTAGCTT AAAACTCAAT TTTACCCTAC CAAAGCTCTC TCATATCTCA TACAGACTAC 
AGTAATATTT TATTTGCACT ACTACTACTA CTTTATTTAA GCAGAAGCAG GCGAGTGAGG AAGAGCGAAG AGTGAAGAGA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCCAAGGGTTTAACCTTTCTGGCTGTGTTAATATGCGTTTCAGCACTGTCACTGAGTCCTTCTGTTGCGGGGGAAGGGCAAAATAATGGCCTTGTTATGAACTTCTACAAGGAA
TCATGCCCTCAGGCTGAAGACATCATCACAGAACAAGTCAAGCTTCTCTACAAGCGCCACAAGAACACTGCTTTCTCCTGGCTCAGGAACATCTTCCATGACTGTGCTGTTCAG
GTAATT
AAGCTTGGTTTTTGTTCTGTGTTTGCAAGGTGCATGTTGGTCATTTTTTTTTGTCAGTTAATTTTTTATATATGAAAGTATTTGTTTTTTACTTTTTATTTTTGTGTGTGTGTGTGAGGG
TAGAGTTGTGATGCTTCACTGTTGCTGGACTCCACAAGAAGGAGCTTGTCTGAGAAGGAAACAGATAGAAGCTTTGGGTTGAGAAATTTCAGGTACATTGAGACCATCAAAGAAGCTTTG
GAAAGAGAATGCCCTGGAGTTGTTTCATGTGCTGATATCCTCGTTCTCTCTGCCAGAGATGGCATTGTTTCG
GTAATTTACTCTTCCCAGCTTGTCCCTTTCTTTTTTGTTCTGTTCTGT
TTCCCACTAGATCTGTTTTGTTTCCTCTTTTAACAAAGTTCCCTTTTGAAAGGTAATTAAAGTCCATGTACATATACCCTGTCCATAATTCTAGCAAGATCGGTCTATTTTTAGTGTGAG
GATGAGTAGTTGGAGACTTATTTGGTCCAGATTTGTTTTAGTAATTAACTGCTTTAATTGTTGCATGCAGCTAGGAGGTCCCCATATCCCTCTTAAGACTGGAAGAAGGGATGGTAGAAG
GAGCAGAGCTGATGTGGTTGAGCAGTTCCTCCCAGACCACAATGAGTCCATTTCTGCAGTTCTTGACAAGTTTGGTGCCATGGGAATTGACACCCCTGGCGTCGTTGCACTGCTTG
GTAC
TATACACTCTCCCCTCACCCATCCATGTACATACATTTATGAAATGACAACAGGCATAAAGCATATCTACATAAAGCTTCGTATATTTCTTTTAATAAATATATGTGGGATCCTCATGTT
TAATCAGAGATAAAGCTAGATGCAAACACACATTTGCCCATAATAAAAGAAAAAAAGGATTATTCAATTAAAAATTTTACACAAGAATCATAACTCATAAATTTTGTTGACTTTTAAAAT
ATTTAACTTAAAAGTAATTCAAACCATAAATTTTCATTTAACATTGAACAATGAAAAAAAATGCAAGCATACAACATACATGAAAGATGCAACACTCACATATACTTACATGGGTACATG
ATATGCTAAAAGAAAGTACACGTGGCATTGTTGGCTGTGATTAATGAATGATTGAGATGAGATATTTTGTGGAACACAGGAGCACACAGTGTTGGTCGAACCCATTGTGTGAAGTTGGTG
CACCGTTTGTACCCAGAGATTGATCCAGCTCTGAACCCTGACCACGTCCCTCACATTCTGAAGAAGTGCCCTGATGCCATTCCAGACCCTAAGGCGGTGCAGTACGTGAGAAACGACCGT
GGCACTCCCATGATTCTAGACAACAACTACTACAGAAACATATTAGACAGCAAGGGTCTCTTGATAGTGGATCACCAACTAGCCAATGACAAGAGGACCAAGCCTTATGTGAAGAAAATG
GCCAAGAGCCAAGACTATTTCTTCAAGGAGTTCTCTAGAGCCATTACCTTGCTCTCAGAGAACAACCCTCTCACTGGCACAAAGGGTGAGGTCAGAAAGCAGTGCAATGTTGCCAACAAG
CACCATGATCAGGACCCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCCAAGGGTTTAACCTTTCTGGCTGTGTTAATATGCGTTTCAGCACTGTCACTGAGTCCTTCTGTTGCGGGGGAAGGGCAAAATAATGGCCTTGTTATGAACTTCTACAAGGAA
TCATGCCCTCAGGCTGAAGACATCATCACAGAACAAGTCAAGCTTCTCTACAAGCGCCACAAGAACACTGCTTTCTCCTGGCTCAGGAACATCTTCCATGACTGTGCTGTTCAG
AGTTGT
GATGCTTCACTGTTGCTGGACTCCACAAGAAGGAGCTTGTCTGAGAAGGAAACAGATAGAAGCTTTGGGTTGAGAAATTTCAGGTACATTGAGACCATCAAAGAAGCTTTGGAAAGAGAA
TGCCCTGGAGTTGTTTCATGTGCTGATATCCTCGTTCTCTCTGCCAGAGATGGCATTGTTTCG
CTAGGAGGTCCCCATATCCCTCTTAAGACTGGAAGAAGGGATGGTAGAAGGAGCAGA
GCTGATGTGGTTGAGCAGTTCCTCCCAGACCACAATGAGTCCATTTCTGCAGTTCTTGACAAGTTTGGTGCCATGGGAATTGACACCCCTGGCGTCGTTGCACTGCTTG
GAGCACACAGT
GTTGGTCGAACCCATTGTGTGAAGTTGGTGCACCGTTTGTACCCAGAGATTGATCCAGCTCTGAACCCTGACCACGTCCCTCACATTCTGAAGAAGTGCCCTGATGCCATTCCAGACCCT
AAGGCGGTGCAGTACGTGAGAAACGACCGTGGCACTCCCATGATTCTAGACAACAACTACTACAGAAACATATTAGACAGCAAGGGTCTCTTGATAGTGGATCACCAACTAGCCAATGAC
AAGAGGACCAAGCCTTATGTGAAGAAAATGGCCAAGAGCCAAGACTATTTCTTCAAGGAGTTCTCTAGAGCCATTACCTTGCTCTCAGAGAACAACCCTCTCACTGGCACAAAGGGTGAG
GTCAGAAAGCAGTGCAATGTTGCCAACAAGCACCATGATCAGGACCCTTGA

Retrieve as FASTA