Entry information : GmPrx37 (Glyma02g17060.1)
Entry ID 528
Creation 2009-02-03 (Christophe Dunand)
Last sequence changes 2011-07-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx37 (Glyma02g17060.1)
Name (synonym) GmPrx37 (Glyma02g17060.1)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type Roots
Inducer Cyst nematode infection
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx37
start..stop
S start..stop
GmPrx66 597 0 1..322 1..309
PvPrx07 580 0 1..322 1..321
GmPrx138 541 0 1..322 3..324
VvPrx54 504 0 1..321 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 15390835..15391038 204 N° 2 15390489..15390680 192 N° 3 15390105..15390270 166 N° 4 15389398..15389804 407
complement(join(15389398..15389804,15390105..15390270,15390489..15390680,1539083 5..15391038))


exon

Literature and cross-references GmPrx37 (Glyma02g17060.1)
Literature Alkharouf,N.W., Khan,R. and Matthews,B.F. Analysis of expressed sequence tags from roots of resistant soybean infected by the soybean cyst nematode.
DNA ref. Phytozome 12:   Gm02 (15391038..15389398)
EST ref. GenBank:   FK014720.1 [5' end]
Protein sequence: GmPrx37 (Glyma02g17060.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (302)
PWM (Da):   %s   35228.49 (33027.3) Transmb domain:   %s   i5-23o
PI (pH):   %s   5.19 (5.03) Peptide Signal:   %s   cut: 21 range:21-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKINILLCVVLLGFLGVCQGGSLRKKFYKDSCSQAEDIIKSKTQQHVSANPDLPAKLLRMHFHDCFVRGCDASVLLNSTANNTAERDAIPNLSLAGFDVIDDIKSELEAKCPKTVSCADILALAARDAVSVQFNKSMWEVLTGRRDGTVSNSNEALANIPAPFFNFTQLKQNFASKGLTLHDLVVLSGAHTIGIGHCNLFSNRLYNFTGKGDQDPSLNSTYAEFLKTKCQSLSDTTTTVEMDPGSSTNFDSDYYPNLLQNKGLFQSDAALLTEEQSEDIAKELVDQDKFFTEFAQSMKRMGAIDVLTDSAGEIRNKCSVVNS*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 2 ESTs. Cultivar="Williams 82".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGATCAATATTTTGCTATGTGTGGTGCTTTTGGGTTTCCTTGGGGTTTGTCAAGGAGGCAGCCTAAGGAAAAAGTTCTACAAGGATTCCTGCTCTCAAGCTGAGGACATTATTAAG
AGCAAAACCCAGCAGCATGTGTCTGCTAATCCCGATTTGCCTGCCAAGTTGCTTAGAATGCATTTTCATGATTGTTTTGTCAGG
GTATATTATTAATTCCAAGATTGTTTTACGTATTTA
TGTTTTCTTTTTATCCGGTTTTGATATACCGTGGCATATATTTCAACATGCAAAAGTGTGCTAATTGTTTAGGAGAGTATACATAACATAATGGTTGCAATGCAAACATACATTTCAGGG
TTGTGATGCCTCGGTTTTGTTGAACTCTACTGCCAATAACACTGCTGAGAGGGATGCAATTCCAAATTTATCTTTGGCTGGCTTTGATGTCATAGATGACATAAAAAGTGAATTGGAGGC
AAAATGTCCCAAAACTGTATCTTGTGCTGACATACTGGCATTGGCAGCTAGGGACGCTGTTTCCGTCCAA
GTAAGCTAACCCCCTGCATAAATGATTTTTTTTATCTATAAGAATTAAAA
ATAAATATAAGAAAATTTATAATACTCACACGTCCTTCTAATTATACAAGAAAATTCATGCTGTTGAGAATTTATTTTGTTATACACATGTCACATATATAATCTTAATAATAATAATTA
CGTTATTACTTCATGCATGTTTATCTGATGCATAAATGAACTTTGCAGTTTAATAAATCTATGTGGGAAGTGCTGACCGGTAGAAGAGATGGCACGGTATCGAACAGTAACGAAGCCTTG
GCCAATATCCCTGCACCTTTCTTCAACTTCACCCAACTCAAACAAAACTTTGCTAGCAAAGGTCTCACTTTGCACGATCTGGTTGTATTATCAG
GTAATTAACATTCATAATATTAATTA
ATTGCTAGTAGTATATAACTATATATATATAGATGCATGGAATTACAAAGCAAGACCATAATCAGTACACATTAATTAATAATTTAAGTTAAAGTTGGTTTGGTGATTGTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACATTAACTAATAATCTTAACAGTTTATCA
CAATTGTGCTTATATATAATTTTCATATATGCAGGGGCACACACAATTGGAATAGGGCATTGCAACTTGTTCAGTAACAGGCTTTACAATTTCACCGGGAAAGGTGATCAAGACCCTTCT
TTGAACTCCACTTATGCAGAATTCTTGAAGACAAAGTGCCAGAGCCTGAGCGATACAACCACAACGGTAGAAATGGATCCTGGAAGCTCTACCAATTTCGATAGTGACTATTATCCAAAC
CTTCTCCAGAATAAGGGTCTGTTCCAATCAGATGCAGCCCTTCTAACAGAAGAGCAATCTGAAGATATAGCTAAAGAATTGGTTGATCAAGACAAGTTCTTCACAGAATTTGCACAGTCA
ATGAAGAGAATGGGAGCCATTGATGTCCTCACTGACTCGGCAGGAGAAATACGGAACAAGTGTTCAGTTGTCAACTCATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGATCAATATTTTGCTATGTGTGGTGCTTTTGGGTTTCCTTGGGGTTTGTCAAGGAGGCAGCCTAAGGAAAAAGTTCTACAAGGATTCCTGCTCTCAAGCTGAGGACATTATTAAG
AGCAAAACCCAGCAGCATGTGTCTGCTAATCCCGATTTGCCTGCCAAGTTGCTTAGAATGCATTTTCATGATTGTTTTGTCAGG
GGTTGTGATGCCTCGGTTTTGTTGAACTCTACTGCC
AATAACACTGCTGAGAGGGATGCAATTCCAAATTTATCTTTGGCTGGCTTTGATGTCATAGATGACATAAAAAGTGAATTGGAGGCAAAATGTCCCAAAACTGTATCTTGTGCTGACATA
CTGGCATTGGCAGCTAGGGACGCTGTTTCCGTCCAA
TTTAATAAATCTATGTGGGAAGTGCTGACCGGTAGAAGAGATGGCACGGTATCGAACAGTAACGAAGCCTTGGCCAATATCCCT
GCACCTTTCTTCAACTTCACCCAACTCAAACAAAACTTTGCTAGCAAAGGTCTCACTTTGCACGATCTGGTTGTATTATCAG
GGGCACACACAATTGGAATAGGGCATTGCAACTTGTTC
AGTAACAGGCTTTACAATTTCACCGGGAAAGGTGATCAAGACCCTTCTTTGAACTCCACTTATGCAGAATTCTTGAAGACAAAGTGCCAGAGCCTGAGCGATACAACCACAACGGTAGAA
ATGGATCCTGGAAGCTCTACCAATTTCGATAGTGACTATTATCCAAACCTTCTCCAGAATAAGGGTCTGTTCCAATCAGATGCAGCCCTTCTAACAGAAGAGCAATCTGAAGATATAGCT
AAAGAATTGGTTGATCAAGACAAGTTCTTCACAGAATTTGCACAGTCAATGAAGAGAATGGGAGCCATTGATGTCCTCACTGACTCGGCAGGAGAAATACGGAACAAGTGTTCAGTTGTC
AACTCATAA

Retrieve as FASTA