Entry information : AniLDS02 (ppoB)
Entry ID 5295
Creation 2007-04-23 (Christophe Dunand)
Last sequence changes 2007-04-23 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: AniLDS02 (ppoB)
Name (synonym) AniLDS02 (ppoB)
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Emericella
Organism Aspergillus nidulans-Emericella nidulans    [TaxId: 162425 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AniLDS02
start..stop
S start..stop
AclLDS02 1023 0 64..1012 111..1053
CimLDS02 975 0 12..1014 2..1053
CposLDS02_silveira 967 0 16..1004 6..1044
AteLDS05 947 0 69..1014 119..1045
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 546722..546925 204 N° 2 547218..547326 109 N° 3 547383..547493 111 N° 4 547609..548211 603
N° 5 548289..548459 171 N° 6 548711..548746 36 N° 7 548812..549016 205 N° 8 549064..549633 570
N° 9 549698..550181 484 N° 10 550246..550370 125 N° 11 550425..550822 398 N° 12 550875..550918 44
join(546722..546925,547218..547326,547383..547493,547609..548211,548289..548459, 548711..548746,548812..549016,549064..549633,549698..550181,550246..550370,55042 5..550822,550875..550918)


exon

Literature and cross-references AniLDS02 (ppoB)
Literature Tsitsigiannis,D.I., Kowieski,T.M., Zarnowski,R. and Keller,N.P. Three putative oxylipin biosynthetic genes integrate sexual and asexual development in Aspergillus nidulans Microbiology (Reading, Engl.) 151 (PT 6), 1809-1821 (2005). 15941990
Protein ref. UniProtKB:   Q5AZG0
DNA ref. JGI genome:   ChrI_A_nidulans_FGSC_A4 (546722..550918)
Cluster/Prediction ref. GenBank:   XM_658832
Protein sequence: AniLDS02 (ppoB)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1019
PWM (Da):   %s   113588.26  
PI (pH):   %s   6.88
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPFMQNGSDADDLSSSKSKQSTLTSLLSSVHADLLSQAHRIPADIRTLRELSQAGLQGGLIDDKKYLNIMYPHLGASGSHYARTVTPKHPRPAVLPDPGLIFDSLLAREGPAKEHPAEISSNLFYFAIIIIHGDFQFRSYTEQTQVRTFTDGLLKPDTFAEKRLLSQPPGVCALLVAFNRFHNYVVTELARINEAGRFDLPTGGQEKSPDYVWALQKRDEDLFQTGRLYIIPSSSNTTTDIDKANACMGNRVTCGLYVSIILNDYLRTILNLNDNPTNSDWKLDPRKNLSVFDSEGLPRGVGNQVSAEFNMIYRWHATTSNEDEKWLNELSIRVFGSKVDPSTLSVQRYLNGLHEYLGKTAPGEPNTWTFGDLNRGKDGMFADKDLVKLLHDGCEKVAADVNSDPKVAEALEALYGHPDNIELYVGVQAEEAKKPFLPGAGLCPGFTISFAILSDAVALVRGDRFYTVDYSPVNLTNFGFNTAESDPDVANGGVMYKLLMRAFPGWYEPNNVYALYPFTIPAKNKEVFEKYGRADTLEFKRPEYTRPPVAITSWKGVVELLNNPKAFRVPCMLAYLALRYHIQPWFIYPLTGWYEGNRNTFRLTKHDYMLSGDSVANSEQRTFMAERLYRVPDALEQVRRFYESITADLIRRNSMRLGSSSCQIDIVRDVCNLAHAYFCSEFFNIPLKPKDGHNGNGSGNKHLETTDAYTPKELAEALFAQFAYVFLDIDPVQSRKNRVVAYRETQRMGDIMTQVVSATSESGYGLASASGYLFNRPSWISGGKNSSGLSMNGYGPQLVKRLREGGKSVEEVVWMIIPTAAAACATQATWAQMLDLYLSDRYFTHWPAIQELARSDKPEAFEKLKRYALEGFRLSTPANGVLRNCNTATTTLKDGSATKSISKGDTVFADFASAGMDPDTFPNPEEIRLDRPLQLYIHHGWGTHACLGRAIVTTAAAALLKIVGRLDGLRRANGMQGELFRKEVGGFRMFLDEKGESWRVFPNMKVVFDSLDGLKA

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 1, 11 introns). Strain="FGSC 4". Region 143-477 peroxidase domain; region 849-976 "CypX" cytochrome P450
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCTTTCATGCAGAATGGCTCCGATGCTGACGATCTCTCCTCCTCTAAGTCCAAACAGTCCACGCTTACCTCACTCCTTAGCTCCGTGCACGCAGATCTTCTAAGCCAAGCTCAC
CGTATCCCCGCTGACATTCGCACCCTGCGCGAGCTCTCCCAAGCTGGGCTGCAGGGCGGTCTGATCGATGACAAGAAGTACCTT
GTATGTCTTGAGCCTGGTGCTTAATGGGAGATCGAT
AAGTATTGTAGGACTGATCTTTGTATCTGCAAGACCGAGAACATCATCCAGCTCCTCGCAAGCCTGCCCAACACCTCCACACTGAGGACCAAAATCACAGATACGTTTGTCAAGACGCTC
TGGGATAACTTGCAGCATCCGCCCTTGTCTTATATAGGAGATGAATTCCGGTATAGGAGGGCTGACGGAAGTCTCAATGTGACCCGCTCTCTTGAAAAGAAAGAAGAGAAAAGAGACATA
CACTAACGGTCCGTAGAACATCATGTACCCTCATCTTGGGGCATCGGGAAGCCACTATGCGCGGACAGTGACTCCGAAGCATCCACGACCTGCGGTCTTGCCAGACCCGGGGCTCATATT
CGACT
GTATGTCATTGCACTCTTCTAGTCATCCCGTTCAGTTGCTGATACAGTGAATGCAGCGCTACTGGCCCGTGAAGGTCCCGCAAAGGAACATCCAGCCGAGATCTCGAGCAATTTG
TTCTATTTTGCCATCATCATCATACACGGTGACTTTCAGTTCCGCTCCTATA
GTGTGCAGTAAAACTCATGTGCGTATAGATCTCTTCCGCACCGACGAGGCGGACCCAACGCGCATCAA
AAACTCCTCCTACCTTGATCTCGGTCCGCTCTACGGGCACAACCAAGCGGAGCAGACCCAAGTTCGAACCTTCACTGACGGCCTCCTGAAGCCTGACACATTCGCCGAGAAGCGGCTTCT
CTCGCAGCCCCCCGGTGTATGTGCACTCTTGGTCGCGTTTAACCGGTTCCATAACTATGTTGTCACGGAACTTGCAAGGATAAACGAGGCCGGCAGATTTGATTTGCCCACTGGTGGGCA
GGAGAAAAGCCCGGATTATGTCTGGGCGTTGCAGAAGCGGGATGAGGATTTGTTTCAGACGGGGCGATTGTACATTATACCCTCATCATCAAATACGACCACAGATATAGACAAGGCTAA
CGCGTGTATGGGGAACAGGGTAACCTGCGGCCTCTACGTCTCCATAATACTGAATGACTACCTCCGGACGATCCTTAATCTCAACGACAATCCAACAAACTCCGACTGGAAGCTCGATCC
ACGCAAGAATCTCAGTGTTTTTGACTCGGAGGGCTTACCACGAGGGGTGGGGAACCAGGTCTCGGCCGAGTTTAATATGATATACCGCTGGCATGCGACGACCAGTAACGAAGACGAAAA
ATGGCTAAACGAGCTTTCGATTAGGGTTTTCGGTAGCAAGGTTGATCCTA
GTATGAGCCCAGCATCTTGGAATTATCCTGTTCTCGAGTCTCTATTGGTACTTGACTGACTATTGAATGT
GATGCAGGTACATTGTCTGTGCAAAGATACCTAAATGGACTGCATGAGTATCTTGGGAAGACTGCACCGGGCGAGCCAAACACATGGACGTTTGGGGACTTGAATCGAGGAAAAGATGGG
ATGTTCGCGGATAAGGACCTTGTGAAATTGCTCCATGATGGATGCGAGAAAGTCGCCG
GTGCGTTCTTATCCTCAGGTCGTCAATAGACACGAGCCGACTGAAGTACTGGAACAGGAGCG
TTCGGCGCCCGCAACGTACCCAAGGCCATGAAAGCCATCGAAATGCGCGGGATCGAGAAAGGCAGGGAGTGGGGTTTGGCAACTTTGAATGAGCTGAGGGCGTTCTTCAAGCTGAAGCCA
CATTCAACGTTCAGTTGGTCTTCCCCTTTGTTTTACCTCTCAGACTACAGCGACTAACAAATGCTAAAGCGGACGTGAACTCAGACCCGAAAGTCGCTGAAGCATGTACGTTCTTACCGA
TATCCCTTCCCTGACCTGATAGAGCCAGACGATACGCTAACAACCACCAGTGGAAGCACTCTATGGCCATCCCGACAATATCGAGCTCTACGTCGGCGTGCAAGCCGAGGAAGCGAAGAA
GCCCTTCCTCCCCGGCGCAGGTCTTTGTCCTGGCTTCACAATTTCGTTTGCCATTCTCTCAGACGCTGTCGCCCTTGTGCGGGGCGACCGGTTCTATACCGTTGACTATAGTCCGGTGAA
TCTGACGAATTTCGG
GTGAGCTGTCCACAGTAAACAACTCTAAACTCGCTAATAACACACAGGTTCAACACAGCCGAGTCGGACCCCGACGTCGCAAATGGCGGCGTCATGTACAAGCTC
CTCATGCGTGCTTTTCCTGGTTGGTACGAACCTAATAACGTCTACGCCTTATATCCTTTTACCATACCTGCAAAGAATAAAGAAGTGTTTGAGAAATATGGACGGGCAGACACGCTGGAG
TTCAAGAGGCCCGAGTATACCAGGCCTCCTGTGGCTATTACGAGTTGGAAGGGCGTTGTTGAGTTGTTGAACAACCCCAAGGCGTTCCGTGTCCCATGTATGCTTGCTTACCTTGCCTTG
CGTTATCATATTCAGCCCTGGTTCATATATCCGCTAACTGGTTGGTATGAAGGGAACAGAAACACCTTTCGCCTTACCAAACACGACTATATGCTTAGCGGTGACTCTGTGGCAAACTCG
GAGCAGCGCACTTTCATGGCGGAACGGCTGTATAGGGTTCCTGATGCCCTAGAGCAAGTTCGGAGGTTCTATGAATCCATCACTGCGGATCTTATCCGGAGGAACAGTATGCGGCTGGGG
AGTTCGTCCTGTCAGATTGATATTGTACGGGA
GTACGTTACGCTTCATTTCTTCCGCTCTAGAGCGCATGCAGAAAGCCCTAACTGTAACGCACAGTGTCTGCAACCTCGCCCACGCCTA
CTTCTGCTCGGAATTCTTCAATATCCCACTGAAGCCCAAGGACGGCCACAATGGTAACGGTAGTGGCAATAAGCACTTAGAAACGACAGACGCATACACACCTAAGGAACTAGCCGAGGC
CCTTTTCGCACAATTCGCCTATGTCTTCCTGGACATTGACCCAGTGCAATCACGTAAGAATCGCGTTGTCGCATATAGAGAGACCCAGCGAATGGGCGATATCATGACTCAGGTTGTCTC
TGCCACTTCTGAGTCTGGATACGGGCTTGCTTCTGCATCTGGATACCTCTTTAACAGGCCGTCTTGGATTTCCGGGGGAAAGAACTCGAGCGGCTTAAGCATGAACGGGTACGGACCGCA
ACTAGTGAAGAGGTTGAGAGAGGGCGGGAAAAGTGTGGAAGAGGTGGTTTGGATGATCATTCCTACGGCCGCGGCGGCCTGCGCAACGCAAGCAACTGGG
GTAAGCATCACGTCGAACTT
ATCATCCAGTTTGTGACGTTTATAATGCTGATAACGTACCATAGTGGGCCCAAATGCTCGATCTCTACCTCTCAGACCGGTACTTCACGCACTGGCCTGCAATCCAGGAACTGGCACGCT
CCGACAAGCCTGAGGCTTTTGAGAAGCTGAAGAGATATGCCTTGGAAGG
GTATCACTCTATCTTTCTTAACCTCATCATTTCTTGTCACTAACATGTATCCAGATTTCGCCTCTCAACTC
CCGCCAATGGCGTCCTTCGCAATTGCAACACTGCAACTACAACGCTCAAAGACGGGTCGGCCACCAAATCTATCTCCAAAGGCGATACTGTCTTTGCAGACTTTGCTTCCGCCGGAATGG
ACCCAGACACGTTTCCGAATCCTGAGGAAATCAGACTTGATCGGCCCTTGCAGCTCTATATTCATCATGGATGGGGCACACATGCTTGTCTTGGACGGGCAATTGTTACAACGGCGGCGG
CAGCCTTGCTGAAGATTGTGGGAAGGTTGGATGGTTTGAGAAGGGCGAATGGTATGCAGGGGGAGTTGTTCAGGAAGGAGGTTGGTGGGTTTAGGATGTTTTTGGACGAGAAGGGTGAAA
GTTGGAGAGTTTTTCCGCAGA
GTGAGTTCTAATATTTCTTTTGAATGTGAGAAAGGGACTGACCGAATTTTAGACATGAAAGTGGTGTTTGACAGCCTGGATGGGCTGAAAGCGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCTTTCATGCAGAATGGCTCCGATGCTGACGATCTCTCCTCCTCTAAGTCCAAACAGTCCACGCTTACCTCACTCCTTAGCTCCGTGCACGCAGATCTTCTAAGCCAAGCTCAC
CGTATCCCCGCTGACATTCGCACCCTGCGCGAGCTCTCCCAAGCTGGGCTGCAGGGCGGTCTGATCGATGACAAGAAGTACCTT
AACATCATGTACCCTCATCTTGGGGCATCGGGAAGC
CACTATGCGCGGACAGTGACTCCGAAGCATCCACGACCTGCGGTCTTGCCAGACCCGGGGCTCATATTCGACT
CGCTACTGGCCCGTGAAGGTCCCGCAAAGGAACATCCAGCCGAGATC
TCGAGCAATTTGTTCTATTTTGCCATCATCATCATACACGGTGACTTTCAGTTCCGCTCCTATA
CGGAGCAGACCCAAGTTCGAACCTTCACTGACGGCCTCCTGAAGCCTGACACATTC
GCCGAGAAGCGGCTTCTCTCGCAGCCCCCCGGTGTATGTGCACTCTTGGTCGCGTTTAACCGGTTCCATAACTATGTTGTCACGGAACTTGCAAGGATAAACGAGGCCGGCAGATTTGAT
TTGCCCACTGGTGGGCAGGAGAAAAGCCCGGATTATGTCTGGGCGTTGCAGAAGCGGGATGAGGATTTGTTTCAGACGGGGCGATTGTACATTATACCCTCATCATCAAATACGACCACA
GATATAGACAAGGCTAACGCGTGTATGGGGAACAGGGTAACCTGCGGCCTCTACGTCTCCATAATACTGAATGACTACCTCCGGACGATCCTTAATCTCAACGACAATCCAACAAACTCC
GACTGGAAGCTCGATCCACGCAAGAATCTCAGTGTTTTTGACTCGGAGGGCTTACCACGAGGGGTGGGGAACCAGGTCTCGGCCGAGTTTAATATGATATACCGCTGGCATGCGACGACC
AGTAACGAAGACGAAAAATGGCTAAACGAGCTTTCGATTAGGGTTTTCGGTAGCAAGGTTGATCCTA
GTACATTGTCTGTGCAAAGATACCTAAATGGACTGCATGAGTATCTTGGGAAG
ACTGCACCGGGCGAGCCAAACACATGGACGTTTGGGGACTTGAATCGAGGAAAAGATGGGATGTTCGCGGATAAGGACCTTGTGAAATTGCTCCATGATGGATGCGAGAAAGTCGCCG
CG
GACGTGAACTCAGACCCGAAAGTCGCTGAAGCAT
TGGAAGCACTCTATGGCCATCCCGACAATATCGAGCTCTACGTCGGCGTGCAAGCCGAGGAAGCGAAGAAGCCCTTCCTCCCCGGC
GCAGGTCTTTGTCCTGGCTTCACAATTTCGTTTGCCATTCTCTCAGACGCTGTCGCCCTTGTGCGGGGCGACCGGTTCTATACCGTTGACTATAGTCCGGTGAATCTGACGAATTTCGG
G
TTCAACACAGCCGAGTCGGACCCCGACGTCGCAAATGGCGGCGTCATGTACAAGCTCCTCATGCGTGCTTTTCCTGGTTGGTACGAACCTAATAACGTCTACGCCTTATATCCTTTTACC
ATACCTGCAAAGAATAAAGAAGTGTTTGAGAAATATGGACGGGCAGACACGCTGGAGTTCAAGAGGCCCGAGTATACCAGGCCTCCTGTGGCTATTACGAGTTGGAAGGGCGTTGTTGAG
TTGTTGAACAACCCCAAGGCGTTCCGTGTCCCATGTATGCTTGCTTACCTTGCCTTGCGTTATCATATTCAGCCCTGGTTCATATATCCGCTAACTGGTTGGTATGAAGGGAACAGAAAC
ACCTTTCGCCTTACCAAACACGACTATATGCTTAGCGGTGACTCTGTGGCAAACTCGGAGCAGCGCACTTTCATGGCGGAACGGCTGTATAGGGTTCCTGATGCCCTAGAGCAAGTTCGG
AGGTTCTATGAATCCATCACTGCGGATCTTATCCGGAGGAACAGTATGCGGCTGGGGAGTTCGTCCTGTCAGATTGATATTGTACGGGA
TGTCTGCAACCTCGCCCACGCCTACTTCTGC
TCGGAATTCTTCAATATCCCACTGAAGCCCAAGGACGGCCACAATGGTAACGGTAGTGGCAATAAGCACTTAGAAACGACAGACGCATACACACCTAAGGAACTAGCCGAGGCCCTTTTC
GCACAATTCGCCTATGTCTTCCTGGACATTGACCCAGTGCAATCACGTAAGAATCGCGTTGTCGCATATAGAGAGACCCAGCGAATGGGCGATATCATGACTCAGGTTGTCTCTGCCACT
TCTGAGTCTGGATACGGGCTTGCTTCTGCATCTGGATACCTCTTTAACAGGCCGTCTTGGATTTCCGGGGGAAAGAACTCGAGCGGCTTAAGCATGAACGGGTACGGACCGCAACTAGTG
AAGAGGTTGAGAGAGGGCGGGAAAAGTGTGGAAGAGGTGGTTTGGATGATCATTCCTACGGCCGCGGCGGCCTGCGCAACGCAAGCAACTGGG
TGGGCCCAAATGCTCGATCTCTACCTC
TCAGACCGGTACTTCACGCACTGGCCTGCAATCCAGGAACTGGCACGCTCCGACAAGCCTGAGGCTTTTGAGAAGCTGAAGAGATATGCCTTGGAAGG
ATTTCGCCTCTCAACTCCCGCC
AATGGCGTCCTTCGCAATTGCAACACTGCAACTACAACGCTCAAAGACGGGTCGGCCACCAAATCTATCTCCAAAGGCGATACTGTCTTTGCAGACTTTGCTTCCGCCGGAATGGACCCA
GACACGTTTCCGAATCCTGAGGAAATCAGACTTGATCGGCCCTTGCAGCTCTATATTCATCATGGATGGGGCACACATGCTTGTCTTGGACGGGCAATTGTTACAACGGCGGCGGCAGCC
TTGCTGAAGATTGTGGGAAGGTTGGATGGTTTGAGAAGGGCGAATGGTATGCAGGGGGAGTTGTTCAGGAAGGAGGTTGGTGGGTTTAGGATGTTTTTGGACGAGAAGGGTGAAAGTTGG
AGAGTTTTTCCGCAGA
ACATGAAAGTGGTGTTTGACAGCCTGGATGGGCTGAAAGCGTGA

Retrieve as FASTA