Entry information : AniLDS03 (ppoC)
Entry ID 5296
Creation 2007-04-23 (Christophe Dunand)
Last sequence changes 2007-04-23 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: AniLDS03 (ppoC)
Name (synonym) AniLDS03 (ppoC)
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Emericella
Organism Aspergillus nidulans-Emericella nidulans    [TaxId: 162425 ]
Cellular localisation N/D
Tissue type Vegetative mycelia
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AniLDS03
start..stop
S start..stop
AnLDS03 1692 0 1..1117 1..1110
AteLDS03 1688 0 1..1113 1..1108
AorLDS04 1636 0 1..1114 1..1109
AflLDS04 1636 0 1..1114 1..1109
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 241094..241516 423 N° 2 240927..241024 98 N° 3 240632..240873 242 N° 4 240376..240580 205
N° 5 240181..240321 141 N° 6 240042..240132 91 N° 7 239667..239994 328 N° 8 239270..239613 344
N° 9 238734..239221 488 N° 10 238034..238685 652 N° 11 237697..237976 280 N° 12 237584..237645 62
complement(join(237584..237645,237697..237976,238034..238685,238734..239221,2392 70..239613,239667..239994,240042..240132,240181..240321,240376..240580,240632..2 40873,240927..241024,241094..241516))


exon

Literature and cross-references AniLDS03 (ppoC)
Literature Tsitsigiannis,D.I., Kowieski,T.M., Zarnowski,R. and Keller,N.P. Three putative oxylipin biosynthetic genes integrate sexual and asexual development in Aspergillus nidulans Microbiology (Reading, Engl.) 151 (PT 6), 1809-1821 (2005). 15941990
Protein ref. UniProtKB:   Q6IYE5
DNA ref. JGI genome:   ChrIII_A_nidulans_FGSC_A4 (241516..237584)
Protein sequence: AniLDS03 (ppoC)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1117
PWM (Da):   %s   124659.28  
PI (pH):   %s   6.34
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLRRFSTFRKSKGDKTEKADRDSKANGSNANSAAAASNSSKRQSKVPPPRRPSSDSGSSAESEDVPAVFEKYAQVLHASSRPIPHQGGEAAYLEKEHPSGLFNDLKSLGFKDFASLKDVIKTKINGELTDDKTMIMERIIQIVSSLPSNSKMRVDLTNMFLDELWGSLPHPPLSYMGNDYQYRSADGSNNNPTLPWLGAANTAYARSIEPLTVQPGGLPDAGLVFDTLFARQKFTPHPNKVSSLFFDWASLIIDIFQTDYRDYNKNKTSAYLDLAILYGDVQEEQDLVRTHKDGKLKPDSFSEPRLQAFPAACCVLLVMLNRFHNYVVEELAAINENGRFTKPSPDLPEEQAKKAWAKYDEDLFQTGRLITCGLFINITLYDYLRTIVNLNRVNSTWCLDPRAQMEGSATPAGLGNQCSVEFNLAYRWHSAISANDEKWTEKVYEELIGKPGSEISTQELLMGLGKYGASLPKDPSQRTFAGLKRQEDGTFKDEELVNILTSAIEDVGSFGARNVPKVLKAVEVLGIEQGRKWNVGSLNEFRKFFGLKNYETFEEINSDPEVAESLRALYGHPDYVELYPGIVSEEAKEPMIPGVGIAPTYTISRAVLSDAVALVRGDRHYTVDYNPRNLTNWGYNEVRYDLNINQGCVFYKLATRAFPNWFKPDSIYAHYPMTIPSENKVIMKNLGREADYSWDRPQYQAPRASLTSYSNVKLILDQQKDFRVVWGDCTPLHSGKGGEDFWSKTLSDPQFKKSIKEFYEKTTLELFADKSVNLAGRKQIDIVDVGNIVPARFASKLLSLPLRSKENSKGVFTDHEIFMALAVIYNAIFFDVDTTKSFPLRKAADAVSKELGKHVESHVKSVSSPGFLSRVIDNFRDDHNALKDLGDQLIKRLAEGGLSVSDITYGQILPTAVELVHGQAQMFTRVVEYYLNEGKQHLPELSLLAKQDSAETDAKLTRYALEAIRLNAGSGAYRKAETNFYFKEGDADINLKPGDEIFISSTQANRDPTAFPDPDEVRLDRPDESYLNYGIGSQIGLGKDATLTAVTAMVRAAFSLEGLRPAPGVQGVLKKVVRPEGYTLYMREDHGAFSPFPTFRVHFDGEVVTPKKQIDSA

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 3, 11 introns) and 7 ESTs (AI209828, AI209416, AA966650, AA785515, AA784445, AA966649, AA785514). Strain="FGSC 4" and "FGSC A26". Region: 182-641 peroxidase domain; region 765-1080 "CypX" cytochrome P450
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGCGAAGATTTTCTACCTTCAGAAAGTCCAAGGGGGACAAGACCGAGAAGGCCGACCGCGATTCTAAGGCCAATGGCTCCAATGCCAATAGCGCCGCTGCGGCCAGCAACAGCAGC
AAGCGCCAGTCCAAGGTGCCTCCTCCGCGCAGGCCCTCTTCAGACAGCGGGAGCAGCGCTGAGAGTGAAGACGTCCCCGCTGTCTTTGAGAAATACGCGCAGGTGCTTCATGCCTCCTCT
CGCCCAATCCCCCACCAGGGCGGAGAGGCAGCATATCTCGAGAAGGAGCACCCTTCAGGCTTGTTCAATGATCTGAAATCTCTCGGTTTCAAGGACTTTGCCTCATTGAAGGACGTGATC
AAGACCAAGATCAATGGCGAGCTCACGGATGACAAGACCATGATCATGGAGCGCATCATTCAG
GTGAGCAGATACACACCTTGGACGATGGTTCCTGGGGGATTGCGTTCGGACGTCTGA
CCGGATTTGCAGATCGTTAGCAGCCTTCCCTCAAACTCGAAGATGCGCGTGGACCTCACGAACATGTTCCTCGACGAGCTCTGGGGTTCTTTGCCTCACCCCCCGCTCTCGTAAGTTCGC
CTCCACGCACACGAATTCGACCATGATCAATAACTTGGTTCAGATATATGGGCAACGACTACCAGTACCGCTCTGCTGATGGTTCTAACAACAACCCCACTCTTCCATGGCTTGGTGCCG
CTAACACAGCTTACGCACGCTCCATTGAGCCCTTGACCGTGCAACCCGGCGGTCTTCCGGACGCTGGTTTGGTCTTTGATACTTTGTTTGCGCGCCAGAAGTTTACGCCTCATCCCAATA
AGGTGTCTAGTCTTTTCTTCGACTGGGCGTCTCTGATCATTCACG
GTTAGTGAGGCAAAATCGGCGGTTGGGATGCAGGACTAAATTGCAGCACAGATATCTTCCAAACCGACTACAGAG
ATTATAATAAGAACAAGACCTCGGCTTACCTCGATCTTGCCATTCTCTACGGTGACGTACAGGAAGAACAGGACCTGGTCCGTACTCACAAGGACGGAAAGCTGAAGCCAGACTCCTTCT
CCGAGCCGCGACTGCAGGCTTTCCCCGCAGCTTGCTGCGTTCTTCTCGTTATGCTAAACAG
GTTTGTTTAACCTTGAGAAGGCAATTTCCCAGATTCGATCGCTGATTTTCGCAGGTTCC
ACAACTATGTTGTAGAAGAGCTTGCTGCCATCAACGAGAACGGTCGCTTCACTAAACCCAGCCCTGATCTCCCCGAAGAGCAAGCAAAGAAGGCCTGGGCTAAGTACGATGAGGATCTTT
TCCAGACCGGACGACT
GTAGGTCTCGCTACTGCCTTACATCGAGATTGCACTGACTCTCCATAGCATTACCTGCGGCCTGTTCATTAACATCACCCTGTACGATTACCTTCGCACGATCG
TCAACCTGAACCGAGTGAACAGCACCTGGTGCTTG
GTAAGTAACGGTTCTGTCCTGCTATTATGCTCTCTAACGAAAAGCAGGACCCTCGAGCTCAGATGGAAGGCAGCGCTACACCTGC
CGGTCTCGGAAACCAATGTTCTGTCGAGTTTAACCTGGCCTACCGGTGGCACTCTGCTATCAGTGCCAACGACGAGAAATGGACCGAGAAGGTCTACGAGGAACTGATCGGCAAGCCTGG
TTCGGAGATCAGCACGCAGGAGCTGCTTATGGGTCTTGGCAAGTACGGTGCTAGCCTTCCCAAAGATCCATCTCAGCGCACCTTTGCGGGACTTAAGCGTCAAGAAGATGGTACCTTTAA
GGATGAGGAGCTAGTCAATATCCTGACTTCCGCCATTGAGGATGTTGCTG
GTAAGTTATCTTGTTGAAGTTGTCAGAAAGCAACCGCTAAGTATATTGACTAGGTTCGTTTGGTGCTCGA
AATGTGCCCAAGGTCCTCAAGGCCGTTGAGGTTCTCGGTATCGAGCAGGGCCGCAAGTGGAACGTTGGATCTCTTAACGAGTTCCGAAAGTTCTTCGGTTTGAAGAATTACGAGACCTTC
GAGGAGATCAACTCCGACCCTGAGGTCGCCGAGTCACTTCGAGCTTTGTACGGTCACCCTGACTACGTCGAGCTGTACCCAGGTATTGTCTCTGAGGAGGCCAAGGAACCCATGATCCCC
GGCGTCGGCATCGCCCCTACTTATACCATCTCCCGCGCGGTTCTGTCCGATGCGGTTGCGCTCGTGCGCGGTGACAGACACTACACT
GTAGGTTCCTAGCCTCTCTGCGGAGAATTGTGT
TTCTAAACTAGACAGGTCGACTACAACCCCCGCAACCTGACCAACTGGGGTTACAACGAGGTCCGCTACGATCTTAACATCAACCAAGGCTGTGTCTTTTACAAGCTCGCCACTCGCGCG
TTCCCCAACTGGTTCAAACCCGACTCTATCTACGCCCACTACCCTATGACCATTCCCAGCGAGAACAAGGTCATCATGAAGAATCTCGGCCGAGAGGCTGATTACTCCTGGGACCGGCCG
CAGTACCAGGCTCCTCGCGCTAGCTTGACCTCCTACTCTAATGTCAAGCTCATTCTTGACCAGCAGAAGGACTTCCGTGTGGTCTGGGGCGACTGCACTCCGCTCCACTCTGGCAAGGGC
GGCGAAGACTTCTGGAGCAAGACGTTAAGTGACCCTCAGTTCAAGAAGAGCATCAAGGAGTTCTACGAGAAAACGACTCTGGAGCTTTTCGCGGACAAGTCGGTCAACCTAGCCGGAAGG
AAGCAAATTGACATTGTCAAAGA
GTAAGTTGTGCCATTCACAAATCAGCGTGCCCGCTAATTATTCGATAGCGTTGGCAACATCGTGCCCGCTCGATTTGCGTCGAAGCTTCTCTCTCTT
CCTCTGAGGAGCAAGGAGAACTCCAAGGGCGTCTTCACCGACCACGAGATTTTCATGGCTTTGGCTGTGATTTATAATGCCATCTTTTTCGACGTTGACACCACAAAGTCATTCCCTCTT
CGCAAAGCTGCAGACGCTGTTTCCAAGGAACTCGGCAAGCACGTCGAGAGCCACGTCAAGTCCGTCAGCTCTCCAGGCTTCCTTTCCAGAGTCATTGACAACTTCCGTGATGACCACAAC
GCTCTCAAGGATCTTGGTGACCAGCTCATTAAGCGCTTGGCAGAGGGTGGTCTCAGCGTCTCGGACATCACCTACGGCCAGATCCTGCCGACAGCTGTGGAACTGGTCCACGGCCAGGCT
CAGATGTTCACCCGAGTTGTTGAGTACTATCTCAACGAGGGCAAGCAGCACCTACCTGAGCTTAGCCTCCTTGCCAAGCAGGACTCTGCCGAGACGGATGCGAAGCTGACCCGCTACGCT
CTGGAGGCTATTCGCCTGAATGCCGGCTCGGGAGCTTACCGCAAGGCCGAGACCAACTTCTATTTCAAGGAGGGGGACGCAGATATCAACCTCAAACCTGGGGACGAGATCTTCATCAGC
TCG
GTGAGTTTCCTACACGCCACTACGACCACTAATGAAGCTAGAGCTAATACCTGCCAGACCCAAGCAAACCGTGACCCAACGGCCTTCCCTGACCCTGATGAAGTGCGCCTTGACCGA
CCCGATGAGTCCTACCTCAACTACGGCATCGGTTCTCAAATCGGCCTCGGCAAGGACGCCACACTGACCGCAGTCACTGCCATGGTACGCGCCGCCTTCAGCTTGGAGGGTCTCCGTCCG
GCTCCTGGTGTACAGGGAGTCCTGAAGAAGGTTGTCCGCCCTGAAGGCTACACCCTCTACATGCGGGAGGACCACGGTGCTTTTTCGCCTTTCCCGACGA
GTAAGTTGTCTGGCACTAGG
ACTCGAAGGAATACTGCTAACCAGGTCACAGCTTTCCGTGTGCACTTCGACGGAGAAGTTGTCACTCCTAAGAAGCAGATTGATTCTGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGCGAAGATTTTCTACCTTCAGAAAGTCCAAGGGGGACAAGACCGAGAAGGCCGACCGCGATTCTAAGGCCAATGGCTCCAATGCCAATAGCGCCGCTGCGGCCAGCAACAGCAGC
AAGCGCCAGTCCAAGGTGCCTCCTCCGCGCAGGCCCTCTTCAGACAGCGGGAGCAGCGCTGAGAGTGAAGACGTCCCCGCTGTCTTTGAGAAATACGCGCAGGTGCTTCATGCCTCCTCT
CGCCCAATCCCCCACCAGGGCGGAGAGGCAGCATATCTCGAGAAGGAGCACCCTTCAGGCTTGTTCAATGATCTGAAATCTCTCGGTTTCAAGGACTTTGCCTCATTGAAGGACGTGATC
AAGACCAAGATCAATGGCGAGCTCACGGATGACAAGACCATGATCATGGAGCGCATCATTCAG
ATCGTTAGCAGCCTTCCCTCAAACTCGAAGATGCGCGTGGACCTCACGAACATGTTC
CTCGACGAGCTCTGGGGTTCTTTGCCTCACCCCCCGCTCTC
ATATATGGGCAACGACTACCAGTACCGCTCTGCTGATGGTTCTAACAACAACCCCACTCTTCCATGGCTTGGTGCCGCT
AACACAGCTTACGCACGCTCCATTGAGCCCTTGACCGTGCAACCCGGCGGTCTTCCGGACGCTGGTTTGGTCTTTGATACTTTGTTTGCGCGCCAGAAGTTTACGCCTCATCCCAATAAG
GTGTCTAGTCTTTTCTTCGACTGGGCGTCTCTGATCATTCACG
ATATCTTCCAAACCGACTACAGAGATTATAATAAGAACAAGACCTCGGCTTACCTCGATCTTGCCATTCTCTACGGT
GACGTACAGGAAGAACAGGACCTGGTCCGTACTCACAAGGACGGAAAGCTGAAGCCAGACTCCTTCTCCGAGCCGCGACTGCAGGCTTTCCCCGCAGCTTGCTGCGTTCTTCTCGTTATG
CTAAACAG
GTTCCACAACTATGTTGTAGAAGAGCTTGCTGCCATCAACGAGAACGGTCGCTTCACTAAACCCAGCCCTGATCTCCCCGAAGAGCAAGCAAAGAAGGCCTGGGCTAAGTAC
GATGAGGATCTTTTCCAGACCGGACGACT
CATTACCTGCGGCCTGTTCATTAACATCACCCTGTACGATTACCTTCGCACGATCGTCAACCTGAACCGAGTGAACAGCACCTGGTGCTTG
GACCCTCGAGCTCAGATGGAAGGCAGCGCTACACCTGCCGGTCTCGGAAACCAATGTTCTGTCGAGTTTAACCTGGCCTACCGGTGGCACTCTGCTATCAGTGCCAACGACGAGAAATGG
ACCGAGAAGGTCTACGAGGAACTGATCGGCAAGCCTGGTTCGGAGATCAGCACGCAGGAGCTGCTTATGGGTCTTGGCAAGTACGGTGCTAGCCTTCCCAAAGATCCATCTCAGCGCACC
TTTGCGGGACTTAAGCGTCAAGAAGATGGTACCTTTAAGGATGAGGAGCTAGTCAATATCCTGACTTCCGCCATTGAGGATGTTGCTG
GTTCGTTTGGTGCTCGAAATGTGCCCAAGGTC
CTCAAGGCCGTTGAGGTTCTCGGTATCGAGCAGGGCCGCAAGTGGAACGTTGGATCTCTTAACGAGTTCCGAAAGTTCTTCGGTTTGAAGAATTACGAGACCTTCGAGGAGATCAACTCC
GACCCTGAGGTCGCCGAGTCACTTCGAGCTTTGTACGGTCACCCTGACTACGTCGAGCTGTACCCAGGTATTGTCTCTGAGGAGGCCAAGGAACCCATGATCCCCGGCGTCGGCATCGCC
CCTACTTATACCATCTCCCGCGCGGTTCTGTCCGATGCGGTTGCGCTCGTGCGCGGTGACAGACACTACACT
GTCGACTACAACCCCCGCAACCTGACCAACTGGGGTTACAACGAGGTC
CGCTACGATCTTAACATCAACCAAGGCTGTGTCTTTTACAAGCTCGCCACTCGCGCGTTCCCCAACTGGTTCAAACCCGACTCTATCTACGCCCACTACCCTATGACCATTCCCAGCGAG
AACAAGGTCATCATGAAGAATCTCGGCCGAGAGGCTGATTACTCCTGGGACCGGCCGCAGTACCAGGCTCCTCGCGCTAGCTTGACCTCCTACTCTAATGTCAAGCTCATTCTTGACCAG
CAGAAGGACTTCCGTGTGGTCTGGGGCGACTGCACTCCGCTCCACTCTGGCAAGGGCGGCGAAGACTTCTGGAGCAAGACGTTAAGTGACCCTCAGTTCAAGAAGAGCATCAAGGAGTTC
TACGAGAAAACGACTCTGGAGCTTTTCGCGGACAAGTCGGTCAACCTAGCCGGAAGGAAGCAAATTGACATTGTCAAAGA
CGTTGGCAACATCGTGCCCGCTCGATTTGCGTCGAAGCTT
CTCTCTCTTCCTCTGAGGAGCAAGGAGAACTCCAAGGGCGTCTTCACCGACCACGAGATTTTCATGGCTTTGGCTGTGATTTATAATGCCATCTTTTTCGACGTTGACACCACAAAGTCA
TTCCCTCTTCGCAAAGCTGCAGACGCTGTTTCCAAGGAACTCGGCAAGCACGTCGAGAGCCACGTCAAGTCCGTCAGCTCTCCAGGCTTCCTTTCCAGAGTCATTGACAACTTCCGTGAT
GACCACAACGCTCTCAAGGATCTTGGTGACCAGCTCATTAAGCGCTTGGCAGAGGGTGGTCTCAGCGTCTCGGACATCACCTACGGCCAGATCCTGCCGACAGCTGTGGAACTGGTCCAC
GGCCAGGCTCAGATGTTCACCCGAGTTGTTGAGTACTATCTCAACGAGGGCAAGCAGCACCTACCTGAGCTTAGCCTCCTTGCCAAGCAGGACTCTGCCGAGACGGATGCGAAGCTGACC
CGCTACGCTCTGGAGGCTATTCGCCTGAATGCCGGCTCGGGAGCTTACCGCAAGGCCGAGACCAACTTCTATTTCAAGGAGGGGGACGCAGATATCAACCTCAAACCTGGGGACGAGATC
TTCATCAGCTCG
ACCCAAGCAAACCGTGACCCAACGGCCTTCCCTGACCCTGATGAAGTGCGCCTTGACCGACCCGATGAGTCCTACCTCAACTACGGCATCGGTTCTCAAATCGGCCTC
GGCAAGGACGCCACACTGACCGCAGTCACTGCCATGGTACGCGCCGCCTTCAGCTTGGAGGGTCTCCGTCCGGCTCCTGGTGTACAGGGAGTCCTGAAGAAGGTTGTCCGCCCTGAAGGC
TACACCCTCTACATGCGGGAGGACCACGGTGCTTTTTCGCCTTTCCCGACGA
CTTTCCGTGTGCACTTCGACGGAGAAGTTGTCACTCCTAAGAAGCAGATTGATTCTGCTTGA

Retrieve as FASTA