Entry information : AniLDS01 (ppoA)
Entry ID 5297
Creation 2007-04-23 (Christophe Dunand)
Last sequence changes 2007-04-23 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: AniLDS01 (ppoA)
Name (synonym) AniLDS01 (ppoA)
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Emericella
Organism Aspergillus nidulans-Emericella nidulans    [TaxId: 162425 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AniLDS01
start..stop
S start..stop
AfumLDS01 1827 0 1..1079 1..1079
NfLDS01 1823 0 1..1079 1..1079
AclLDS01 1819 0 1..1080 1..1080
AorLDS01 1803 0 1..1078 1..1078
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2425597..2425863 267 N° 2 2425442..2425539 98 N° 3 2425342..2425390 49 N° 4 2425095..2425287 193
N° 5 2422862..2425040 2179 N° 6 2422682..2422808 127 N° 7 2422296..2422628 333  
complement(join(2422296..2422628,2422682..2422808,2422862..2425040,2425095..2425 287,2425342..2425390,2425442..2425539,2425597..2425863))


exon

Literature and cross-references AniLDS01 (ppoA)
Literature Tsitsigiannis,D.I., Zarnowski,R. and Keller,N.P. The lipid body protein, PpoA, coordinates sexual and asexual sporulation in Aspergillus nidulans. J. Biol. Chem. 279 (12), 11344-11353 (2004). 14699095
Protein ref. UniProtKB:   Q6RET3
DNA ref. JGI genome:   ChrVII_A_nidulans_FGSC_A4 (2425863..2422296)
Cluster/Prediction ref. GenBank:   XM_654479
Protein sequence: AniLDS01 (ppoA)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1081
PWM (Da):   %s   120560.81  
PI (pH):   %s   6.23
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGEDKETNILAGLGNTISQVENVVAASLRPLPTATGDGTYVAESTQTGLAKDLSHVDLKDVRTLAEVVKSAATGEPVDDKQYIMERVIQLAAGLPSTSRNAAELTKSFLNMLWNDLEHPPVSYLGADSMHRKADGSGNRFWPQLGAAGSAYARSVRPKTMQSPSLPDPETIFDCLLRRKEYREHPNKISSVLFYLASIIIHDLFQTDPKDNSVSKTSSYLDLSPLYGNNQDEQNLVRTFKDGKLKPDCFATKRVLGFPPGVGVLLIMFNRFHNYVVDQLAAINECGRFTKPDESNVDEYAKYDNNLFQTGRLVTCGLYANIILKDYVRTILNINRTDSTWSLDPRMEMKDGLLGEAAAMATGNQVSAEFNVVYRWHACISKRDEKWTEDFHREIMPGVDPSTLSMQDFVAGLGRWQAGLPQEPLERPFSGLQRKPDGAFNDDDLVNLFEKSVEDCAGAFGASHVPAIFKSVEALGIMQARRWNLGTLNEFRQYFNLAPHKTFEDINSDPYIADQLKRLYDHPDLVEIYPGVVVEEAKDSMVPGSGLCTNFTISRAILSDAVALVRGDRFYTVDYTPKHLTNWAYNEIQPNNAVDQGQVFYKLVLRAFPNHFDGNSIYAHFPLVVPSENEKILKSLGVAEKYSWEKPSRISHPIFISSHAACMSILENQETFKVTWGRKIEFLMQRDKHQYGKDFMLSGDRPPNAASRKMMGSALYRDEWEAEVKNFYEQTTLKLLHKNSYKLAGVNQVDIVRDVANLAQVHFCSSVFSLPLKTDSNPRGIFAESELYKIMAAVFTAIFYDADIGKSFELNQAARTVTQQLGQLTMANVEIIAKTGLIANLVNRLHRRDVLSEYGIHMIQRLLDSGLPATEIVWTHILPTAGGMVANQAQLFSQCLDYYLSEEGSGHLPEINRLAKENTPEADELLTRYFMEGARLRSSVALPRVAAQPTVVEDNGEKLTIKAGQVVMCNVSACMDPTAFPDPEKVKLDRDMNLYAHFGFGPHKCLGLDLCKTGLSTMLKVLGRLDNLRRAPGAQGQLKKLSGPGGIAKYMNEDQSGFTPFPSTMKIQWDGELPQLKEDF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 7, 6 introns). Strain="FGSC 4". Region: 128-588 peroxidase domain; region 654-1050 "CypX" cytochrome P450
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGAAGACAAAGAAACAAATATCCTCGCCGGCCTCGGAAACACCATTTCCCAAGTAGAAAACGTTGTTGCGGCATCGTTACGACCTTTGCCAACGGCAACGGGTGATGGAACCTAC
GTTGCCGAATCCACTCAGACGGGCTTAGCCAAAGATCTGAGCCATGTCGACCTCAAGGATGTCCGCACACTCGCCGAAGTCGTCAAGAGTGCGGCTACGGGAGAGCCGGTTGATGACAAG
CAGTATATCATGGAAAGAGTGATTCAG
GTCAGCTCAGATTCCAACAACAAGTATGCGCAGGCTCTGAGGCTAATCAACATCTAGTTAGCTGCTGGCTTACCATCGACATCTCGCAACGCT
GCAGAGCTAACCAAGTCATTTTTGAACATGCTGTGGAATGACTTGGAACATCCACCAGTTTC
GTAAGGAACCAGGAGTCTGTAGGCTACCTCGGCTGTCTGACAAATATATAGTTATCTA
GGAGCTGATTCTATGCACCGCAAAGCCGACGGCTCGGGTAAT
GTAGATTATCCCAGTTCCAGTCTTCTACCTACTGTGCTGACTTTTCGATGATAGAATCGTTTCTGGCCTCAACTTGGC
GCTGCTGGTAGCGCGTACGCAAGATCTGTTCGGCCCAAGACGATGCAGTCTCCATCCCTGCCCGATCCTGAGACTATTTTCGATTGCCTGCTCCGCCGGAAAGAGTACAGGGAGCATCCT
AATAAGATATCAAGCGTTCTATTCTACCTCGCTTCAATCATTATTCATG
GTTAGCCAGTCCAGTGATTGAAGGTAATGATGGGTTTGCTAATTATCTTCGAAGACCTATTCCAGACAGAC
CCTAAAGATAATTCCGTGTCCAAGACATCGTCATATTTGGACCTCTCACCTTTGTATGGCAATAATCAAGACGAGCAGAACCTTGTTCGTACGTTCAAGGATGGAAAGCTTAAGCCAGAT
TGTTTCGCTACCAAGCGAGTGTTGGGCTTTCCTCCCGGCGTCGGCGTTCTACTGATCATGTTCAACCGCTTCCACAACTATGTGGTTGATCAATTGGCGGCGATCAACGAATGCGGCCGA
TTCACCAAACCTGACGAGTCCAACGTTGATGAGTATGCTAAATACGATAACAATCTCTTCCAAACCGGGCGACTGGTGACTTGTGGGTTGTACGCAAATATTATCCTAAAAGATTATGTC
CGAACGATTTTGAATATAAACCGGACAGATAGCACCTGGAGTTTGGACCCCAGAATGGAAATGAAGGATGGTTTATTAGGTGAAGCAGCAGCAATGGCAACCGGGAACCAGGTGTCAGCC
GAATTTAATGTCGTGTACCGGTGGCACGCTTGCATTTCCAAGCGCGATGAAAAATGGACAGAGGATTTTCACCGTGAAATCATGCCGGGAGTGGATCCAAGCACACTATCGATGCAAGAT
TTTGTCGCGGGTCTTGGACGGTGGCAGGCAGGACTCCCACAAGAGCCACTTGAGCGCCCATTCTCTGGCTTACAGCGTAAGCCGGACGGTGCATTCAACGACGATGACCTGGTTAATCTG
TTTGAGAAGAGTGTTGAAGACTGCGCAGGTGCATTTGGTGCGTCTCACGTTCCAGCCATCTTCAAGAGCGTTGAAGCTCTCGGTATAATGCAGGCTCGGAGATGGAACTTGGGAACGCTC
AATGAGTTCCGCCAATATTTCAATCTGGCTCCTCATAAGACCTTTGAGGATATCAACTCCGATCCGTACATTGCGGATCAGCTCAAGCGACTGTATGATCATCCAGATCTTGTGGAGATT
TACCCTGGTGTTGTTGTGGAAGAAGCCAAAGACTCCATGGTCCCTGGAAGCGGCCTTTGCACGAACTTCACTATATCCAGGGCAATCCTTTCGGATGCGGTGGCATTGGTTCGCGGTGAT
AGATTTTACACTGTCGACTACACTCCGAAGCACCTTACGAATTGGGCCTACAACGAGATTCAGCCTAACAACGCCGTCGATCAAGGTCAGGTATTCTACAAGCTGGTTCTTCGCGCATTC
CCAAACCATTTTGATGGAAATTCTATCTATGCTCATTTCCCCCTTGTCGTTCCCTCGGAAAATGAGAAAATATTGAAGAGCCTTGGGGTTGCCGAGAAGTATAGCTGGGAAAAGCCCAGT
CGTATCTCTCATCCGATTTTCATCAGCTCTCATGCCGCGTGCATGTCCATCCTCGAAAATCAAGAAACGTTCAAGGTGACTTGGGGTAGGAAGATTGAGTTCCTTATGCAACGCGATAAG
CACCAATACGGGAAGGACTTCATGCTGTCTGGAGACCGGCCACCCAACGCTGCATCGCGCAAGATGATGGGTTCCGCCTTGTATCGCGATGAATGGGAGGCTGAGGTCAAAAACTTCTAC
GAGCAAACAACTCTAAAACTCTTGCATAAGAACTCCTACAAACTTGCGGGCGTTAACCAAGTCGATATCGTTCGTGATGTGGCCAATCTCGCCCAAGTCCACTTCTGCTCTAGCGTCTTC
TCATTGCCACTGAAAACAGACTCTAATCCTAGGGGTATCTTCGCAGAGTCGGAACTGTACAAGATAATGGCTGCAGTTTTCACTGCCATCTTCTACGACGCAGATATTGGGAAATCGTTC
GAGCTAAACCAGGCCGCCCGTACTGTAACGCAGCAGCTGGGCCAGCTAACTATGGCCAACGTCGAGATCATAGCCAAAACCGGCTTGATCGCTAACCTCGTGAACCGCCTTCACCGGCGC
GACGTGCTTAGCGAATATGGCATCCATATGATCCAGCGTCTACTGGATAGTGGTCTCCCAGCGACAGAGATTGTATGGACTCATATCCTTCCTACGGCCGGTGGAATGGTGGCAAACCAA
GCACAACTGTTTTCGCAATGTCTGGACTATTATCTCTCGGAAGAGGGCTCTGGGCATCTTCCTGAGATCAACCGACTGGCCAAGGAAAATACCCCGGAAGCTGATGAGCTACTTACACGC
TA
GTACGTAACCTCTTTGTTGTCTTTCCCGAACGCGCACATACTTACCGGAGCAGTTTCATGGAAGGTGCTCGGCTACGGTCATCCGTTGCCCTGCCTCGAGTAGCTGCGCAGCCCACGG
TCGTAGAAGACAATGGCGAAAAACTCACCATCAAAGCTGGCCAGGTCGTTATGTGTAACCTG
GTAAGTCATGGCTGGATGTCAAGACTGTTTAGTCCTTCGCTAACGGATTCCAGGTCTC
TGCGTGCATGGATCCTACTGCCTTTCCAGATCCAGAGAAGGTCAAACTTGACCGTGACATGAACTTATACGCCCACTTTGGCTTTGGGCCCCACAAGTGTTTGGGCTTAGACCTATGCAA
GACAGGGCTGAGCACGATGCTAAAAGTACTTGGACGCTTGGACAATCTCCGTCGTGCTCCTGGAGCGCAGGGACAGTTGAAGAAGCTTTCTGGACCTGGCGGGATCGCTAAGTATATGAA
TGAGGATCAAAGCGGCTTCACTCCCTTCCCGTCAACTATGAAGATCCAATGGGACGGCGAATTGCCCCAACTGAAGGAAGATTTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGAAGACAAAGAAACAAATATCCTCGCCGGCCTCGGAAACACCATTTCCCAAGTAGAAAACGTTGTTGCGGCATCGTTACGACCTTTGCCAACGGCAACGGGTGATGGAACCTAC
GTTGCCGAATCCACTCAGACGGGCTTAGCCAAAGATCTGAGCCATGTCGACCTCAAGGATGTCCGCACACTCGCCGAAGTCGTCAAGAGTGCGGCTACGGGAGAGCCGGTTGATGACAAG
CAGTATATCATGGAAAGAGTGATTCAG
TTAGCTGCTGGCTTACCATCGACATCTCGCAACGCTGCAGAGCTAACCAAGTCATTTTTGAACATGCTGTGGAATGACTTGGAACATCCACCA
GTTTC
TTATCTAGGAGCTGATTCTATGCACCGCAAAGCCGACGGCTCGGGTAATAATCGTTTCTGGCCTCAACTTGGCGCTGCTGGTAGCGCGTACGCAAGATCTGTTCGGCCCAAGACG
ATGCAGTCTCCATCCCTGCCCGATCCTGAGACTATTTTCGATTGCCTGCTCCGCCGGAAAGAGTACAGGGAGCATCCTAATAAGATATCAAGCGTTCTATTCTACCTCGCTTCAATCATT
ATTCATG
ACCTATTCCAGACAGACCCTAAAGATAATTCCGTGTCCAAGACATCGTCATATTTGGACCTCTCACCTTTGTATGGCAATAATCAAGACGAGCAGAACCTTGTTCGTACGTTC
AAGGATGGAAAGCTTAAGCCAGATTGTTTCGCTACCAAGCGAGTGTTGGGCTTTCCTCCCGGCGTCGGCGTTCTACTGATCATGTTCAACCGCTTCCACAACTATGTGGTTGATCAATTG
GCGGCGATCAACGAATGCGGCCGATTCACCAAACCTGACGAGTCCAACGTTGATGAGTATGCTAAATACGATAACAATCTCTTCCAAACCGGGCGACTGGTGACTTGTGGGTTGTACGCA
AATATTATCCTAAAAGATTATGTCCGAACGATTTTGAATATAAACCGGACAGATAGCACCTGGAGTTTGGACCCCAGAATGGAAATGAAGGATGGTTTATTAGGTGAAGCAGCAGCAATG
GCAACCGGGAACCAGGTGTCAGCCGAATTTAATGTCGTGTACCGGTGGCACGCTTGCATTTCCAAGCGCGATGAAAAATGGACAGAGGATTTTCACCGTGAAATCATGCCGGGAGTGGAT
CCAAGCACACTATCGATGCAAGATTTTGTCGCGGGTCTTGGACGGTGGCAGGCAGGACTCCCACAAGAGCCACTTGAGCGCCCATTCTCTGGCTTACAGCGTAAGCCGGACGGTGCATTC
AACGACGATGACCTGGTTAATCTGTTTGAGAAGAGTGTTGAAGACTGCGCAGGTGCATTTGGTGCGTCTCACGTTCCAGCCATCTTCAAGAGCGTTGAAGCTCTCGGTATAATGCAGGCT
CGGAGATGGAACTTGGGAACGCTCAATGAGTTCCGCCAATATTTCAATCTGGCTCCTCATAAGACCTTTGAGGATATCAACTCCGATCCGTACATTGCGGATCAGCTCAAGCGACTGTAT
GATCATCCAGATCTTGTGGAGATTTACCCTGGTGTTGTTGTGGAAGAAGCCAAAGACTCCATGGTCCCTGGAAGCGGCCTTTGCACGAACTTCACTATATCCAGGGCAATCCTTTCGGAT
GCGGTGGCATTGGTTCGCGGTGATAGATTTTACACTGTCGACTACACTCCGAAGCACCTTACGAATTGGGCCTACAACGAGATTCAGCCTAACAACGCCGTCGATCAAGGTCAGGTATTC
TACAAGCTGGTTCTTCGCGCATTCCCAAACCATTTTGATGGAAATTCTATCTATGCTCATTTCCCCCTTGTCGTTCCCTCGGAAAATGAGAAAATATTGAAGAGCCTTGGGGTTGCCGAG
AAGTATAGCTGGGAAAAGCCCAGTCGTATCTCTCATCCGATTTTCATCAGCTCTCATGCCGCGTGCATGTCCATCCTCGAAAATCAAGAAACGTTCAAGGTGACTTGGGGTAGGAAGATT
GAGTTCCTTATGCAACGCGATAAGCACCAATACGGGAAGGACTTCATGCTGTCTGGAGACCGGCCACCCAACGCTGCATCGCGCAAGATGATGGGTTCCGCCTTGTATCGCGATGAATGG
GAGGCTGAGGTCAAAAACTTCTACGAGCAAACAACTCTAAAACTCTTGCATAAGAACTCCTACAAACTTGCGGGCGTTAACCAAGTCGATATCGTTCGTGATGTGGCCAATCTCGCCCAA
GTCCACTTCTGCTCTAGCGTCTTCTCATTGCCACTGAAAACAGACTCTAATCCTAGGGGTATCTTCGCAGAGTCGGAACTGTACAAGATAATGGCTGCAGTTTTCACTGCCATCTTCTAC
GACGCAGATATTGGGAAATCGTTCGAGCTAAACCAGGCCGCCCGTACTGTAACGCAGCAGCTGGGCCAGCTAACTATGGCCAACGTCGAGATCATAGCCAAAACCGGCTTGATCGCTAAC
CTCGTGAACCGCCTTCACCGGCGCGACGTGCTTAGCGAATATGGCATCCATATGATCCAGCGTCTACTGGATAGTGGTCTCCCAGCGACAGAGATTGTATGGACTCATATCCTTCCTACG
GCCGGTGGAATGGTGGCAAACCAAGCACAACTGTTTTCGCAATGTCTGGACTATTATCTCTCGGAAGAGGGCTCTGGGCATCTTCCTGAGATCAACCGACTGGCCAAGGAAAATACCCCG
GAAGCTGATGAGCTACTTACACGCTA
TTTCATGGAAGGTGCTCGGCTACGGTCATCCGTTGCCCTGCCTCGAGTAGCTGCGCAGCCCACGGTCGTAGAAGACAATGGCGAAAAACTCACC
ATCAAAGCTGGCCAGGTCGTTATGTGTAACCTG
GTCTCTGCGTGCATGGATCCTACTGCCTTTCCAGATCCAGAGAAGGTCAAACTTGACCGTGACATGAACTTATACGCCCACTTTGGC
TTTGGGCCCCACAAGTGTTTGGGCTTAGACCTATGCAAGACAGGGCTGAGCACGATGCTAAAAGTACTTGGACGCTTGGACAATCTCCGTCGTGCTCCTGGAGCGCAGGGACAGTTGAAG
AAGCTTTCTGGACCTGGCGGGATCGCTAAGTATATGAATGAGGATCAAAGCGGCTTCACTCCCTTCCCGTCAACTATGAAGATCCAATGGGACGGCGAATTGCCCCAACTGAAGGAAGAT
TTTTAA

Retrieve as FASTA