Entry information : AnLDS01
Entry ID 5298
Creation 2007-04-24 (Christophe Dunand)
Last sequence changes 2012-04-23 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: AnLDS01
Name AnLDS01
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus
Organism Aspergillus niger    [TaxId: 5061 ]
Cellular localisation N/D
Tissue type Mycelium
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AnLDS01
start..stop
S start..stop
AorLDS01 1807 0 1..1077 1..1077
AclLDS01 1807 0 1..1079 1..1079
NfLDS01 1803 0 1..1077 1..1077
AfumLDS01 1802 0 1..1077 1..1077
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1502484..1502750 267 N° 2 1502332..1502429 98 N° 3 1502232..1502280 49 N° 4 1501985..1502177 193
N° 5 1499747..1501925 2179 N° 6 1499540..1499666 127 N° 7 1499126..1499455 330  
complement(join(1499126..1499455,1499540..1499666,1499747..1501925,1501985..1502 177,1502232..1502280,1502332..1502429,1502484..1502750))


exon

Literature and cross-references AnLDS01
Literature Hoernsten L., Su C., Osbourn A.E., Garosi P., Hellman U., Wernstedt C., Oliw E.H. Cloning of linoleate diol synthase reveals homology with prostaglandin H synthases. J. Biol. Chem. 274:28219-28224(1999).
Protein ref. UniProtKB:   A2QJ58
DNA ref. JGI genome:   chr_6_2 (1502750..1499126)
EST ref. GenBank:   EY251059.1 [Fragment]
Protein sequence: AnLDS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1080
PWM (Da):   %s   120083.55  
PI (pH):   %s   5.94
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSGANNHSIVNGIGSTISQVEKAISASLRPLPTATGNGTYITEPDQTGIVKDLSHVDFTDIKALLEVVKDAVTGQPVDDRHYIMERVIQLAAGLPSTSKNGKDLTNAFLKQLWNDLEHPPISYLGRDSSYRKADGSGNFLWPHIGAAGSHYARSVRPTTVQSPSLPDPSTLFASLLERKEYKEHPNKISSVLFYLASVIIHDLFQTDRSDFTLNKTSSYLDLSPLYGNNQDEQDLVRTFKDGKLKPDCFSSKRVLGFPPGVGVLLLMFNRFHNYVVENLATINEGGRFTKPDESDVDASTKYDNDLFQTGRLVTCGLYINIILKDYVRTILNINRTDSLWSLDPRADIQDSLLGSAPAEATGNQVSAEFNLVYRWHACISQRDEKWTQDLYKDLFPGKDPNNVSLQEFIRGVAKWEASLPEQPPDRPFAGLQRNADGAFDDGDLANMFADGVEDCAGAFGAGNIPSVFRNIEALGILQARSWNLATLNEFRKFFDLAPYKTFEEINPDPYIAAQLKNLYDEPDLVEMYPGVIVEATKDAIVPGSGLCTNFTISRAILSDAVSLVRGDRFYTVDYTPKHLTNWAYNEIQPQDSVDQGQVFYKLVLRAFPSHFKGDSVYAHFPLVIPSENKKILEKLSVAQDYSWGRPSYTPSPQFVSSNAACISVLNDQEAFKVTWGSKIEFLMRHNNHPYGRDFMLSGDKPPNAASRRMMGSALYRDKWESEVKRFYEDITIKLLRQHSYQLGGVNQVDIVRDVANYAQVHFCANVFSLPLKTESNPRGIFAESELYEILALVFASIFYDADVGTSFQLNQTARDVTQQLGELTMANVDFVNKAGFIANLVSSLHRHDVLSEYGEHMIQRLLHSNVPPAEIVWTHLLPTAGGMVANQAQLFSQCLDYYLSDEGSIHLPDIKRLAKENTSEADALLLRYFMEGARLRSSVGLPRLVAKPTVVDDGGSKYTLKPGQSVLCNVSASMDPRSFPEPEKVKLDRDMSLYAHFGFGPHQCLGMGICKLALTTMLRVVGRLDNLRRAPGSQGQLKKIAGPGGISMYMTADQSSYWPFPSTMKIQWDGDLPSLATN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns) and 2 ESTs (DR705069). Strain="CBS 513.88" and "N402".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGGCGCAAACAATCATTCCATTGTGAACGGCATTGGGAGCACAATTTCCCAGGTCGAAAAAGCTATTTCGGCATCCTTGCGGCCTTTACCTACGGCGACTGGAAACGGGACCTAT
ATTACTGAGCCTGATCAAACGGGAATTGTCAAGGACCTTAGCCATGTCGACTTTACTGATATCAAGGCCCTGCTCGAGGTCGTCAAGGATGCTGTAACGGGTCAGCCAGTCGATGATAGA
CACTATATAATGGAGCGAGTGATTCAG
GTTAGTGCTTACTCTTGCCTATTGAACCTGTCGAGTCCGTCTGACCAAGCCCAGCTTGCTGCCGGACTCCCTTCGACTTCTAAGAATGGGAAA
GACTTGACGAACGCCTTCCTCAAGCAACTCTGGAATGACCTGGAGCATCCTCCAATTTC
GTAAGTTCATTGGGGCATGACGTTCAATGAGAGACTCATTGAGGAATGTAGATACCTAGGC
CGGGATTCTTCGTATCGCAAGGCCGATGGATCAGGAAAT
GTACAGTGTCTCCCGAACTCTTCTGGAAGGTCTTCATTAACTCTCCATTGACAGAACTTCCTGTGGCCTCATATTGGTGCA
GCCGGTAGCCACTATGCCAGGTCTGTACGCCCAACAACTGTTCAGTCGCCTTCGCTGCCGGACCCAAGCACGCTGTTCGCCTCTCTACTGGAAAGAAAAGAATACAAGGAGCACCCGAAC
AAGATTTCCAGTGTCTTGTTCTATCTCGCTTCCGTCATCATTCACG
GTAAGCATGGCATAATTCATGTTTCTTTTCACAAGTTCTGCCAGCTGACATGCTCAAAGATCTATTCCAAACGG
ACCGCAGTGACTTCACTCTGAACAAAACCTCCTCGTATCTGGATCTTTCGCCGCTCTATGGCAACAACCAAGACGAGCAGGATCTCGTCAGGACTTTCAAGGATGGGAAACTCAAGCCGG
ACTGCTTCTCTAGCAAACGTGTTCTTGGTTTCCCTCCCGGTGTCGGCGTACTTCTGCTGATGTTCAACCGCTTCCACAACTATGTTGTTGAAAATTTGGCGACTATCAATGAAGGAGGCC
GTTTCACCAAACCAGATGAGTCCGATGTCGACGCCAGCACGAAGTACGACAACGATCTCTTCCAGACTGGTCGGTTGGTCACGTGTGGCCTATACATTAACATTATTCTCAAGGATTATG
TTCGGACTATATTGAATATCAATCGAACAGACAGTCTGTGGAGCTTGGATCCTCGAGCTGATATCCAGGATAGCTTGCTAGGAAGCGCCCCAGCGGAAGCTACGGGCAACCAGGTGTCTG
CTGAATTCAATCTCGTCTACCGCTGGCATGCTTGCATATCACAGCGTGACGAGAAATGGACACAGGATCTGTACAAAGATCTGTTCCCAGGAAAGGACCCCAACAATGTTTCGTTACAGG
AATTCATTAGGGGCGTGGCCAAGTGGGAAGCAAGCTTACCAGAACAACCCCCGGACCGTCCATTTGCTGGATTACAGCGTAATGCAGATGGTGCCTTCGATGATGGCGACCTCGCAAACA
TGTTCGCGGATGGCGTTGAGGATTGTGCCGGTGCCTTTGGTGCAGGTAACATTCCATCAGTCTTCAGAAATATCGAGGCCCTCGGTATCTTGCAGGCGCGTTCTTGGAACTTGGCTACCC
TGAACGAATTCCGCAAGTTTTTCGACCTTGCGCCTTACAAGACCTTCGAGGAAATCAATCCTGATCCATACATTGCTGCCCAGCTCAAGAACCTGTATGATGAACCTGACCTGGTGGAGA
TGTATCCCGGCGTTATCGTGGAGGCTACGAAAGACGCGATAGTGCCTGGAAGCGGTCTGTGCACAAACTTCACAATATCAAGAGCTATCCTGTCCGATGCGGTGTCCCTTGTCCGTGGAG
ACCGTTTCTACACGGTTGATTACACACCAAAGCATCTCACAAACTGGGCTTACAACGAAATACAGCCTCAGGACTCCGTTGACCAGGGGCAGGTCTTTTACAAATTGGTGCTGCGTGCGT
TTCCTAGTCACTTCAAAGGCGATTCCGTTTACGCACACTTCCCTCTGGTCATCCCATCTGAGAACAAGAAGATTCTTGAGAAGCTTTCGGTTGCTCAAGATTACAGCTGGGGCCGGCCGA
GTTACACGCCTTCGCCGCAATTCGTCAGCTCTAATGCGGCTTGTATTTCCGTTCTCAACGACCAAGAGGCGTTCAAGGTCACTTGGGGAAGCAAGATCGAATTTCTGATGCGCCACAACA
ATCACCCTTATGGTCGGGATTTCATGCTATCGGGTGACAAGCCACCCAACGCTGCATCGCGCAGGATGATGGGCTCGGCCCTATACCGCGACAAGTGGGAGAGTGAGGTGAAGCGATTCT
ATGAGGATATCACCATAAAACTCCTGCGCCAACATTCTTACCAGCTGGGTGGCGTCAATCAAGTCGATATTGTCCGAGATGTTGCAAATTACGCCCAGGTCCATTTCTGCGCAAATGTAT
TCTCTTTGCCCCTGAAGACTGAGTCTAACCCAAGGGGCATTTTTGCTGAGTCTGAATTGTACGAAATACTGGCACTTGTCTTCGCCTCCATTTTCTACGATGCCGATGTTGGAACATCAT
TCCAGCTCAACCAGACTGCCCGGGATGTGACTCAACAGCTCGGGGAACTAACCATGGCCAATGTCGACTTTGTCAACAAGGCCGGCTTCATCGCAAACTTAGTTAGCAGTCTGCACCGGC
ACGATGTCCTCAGTGAATACGGCGAACACATGATTCAGCGTCTGCTTCACAGCAATGTTCCTCCAGCTGAGATTGTCTGGACTCATCTGTTACCAACAGCGGGTGGCATGGTGGCAAATC
AAGCCCAACTCTTCTCGCAGTGCCTTGATTACTACCTTTCAGATGAAGGATCCATTCATTTGCCAGACATTAAACGACTCGCCAAAGAAAACACATCCGAGGCTGATGCTCTTCTTCTAC
GATA
GTAAGCATTTCCTGAACCCCACAAATTCCACTTATCTTATTCAAAAAGTGGTTCGCGTACATGTACTGACAAATTTGCAGCTTCATGGAAGGAGCTCGGTTGCGGTCGTCCGTCGG
CTTGCCGCGACTAGTCGCGAAGCCCACCGTCGTTGATGACGGCGGGTCAAAGTATACTTTGAAGCCCGGCCAAAGTGTACTATGCAACCTA
GTAAGTAGCACCAAACCCTCTTCAATAGA
GACGTCCCTGGCTCTAGCAGACATTTACTCATCATCTTTTTTTCTTTTTTCGCAGGTATCTGCTTCCATGGATCCGCGCAGCTTTCCCGAGCCGGAGAAGGTCAAGCTTGACCGCGACAT
GAGCCTGTACGCCCACTTTGGATTCGGCCCTCATCAATGCTTAGGCATGGGCATCTGTAAGCTGGCTCTCACGACAATGCTGAGGGTGGTGGGACGGCTAGACAACCTCCGACGGGCTCC
TGGATCTCAAGGCCAACTGAAGAAGATTGCAGGACCTGGAGGGATTTCGATGTATATGACTGCAGACCAAAGCAGCTATTGGCCATTCCCATCGACCATGAAGATCCAATGGGATGGCGA
TCTGCCAAGTCTTGCTACGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGGCGCAAACAATCATTCCATTGTGAACGGCATTGGGAGCACAATTTCCCAGGTCGAAAAAGCTATTTCGGCATCCTTGCGGCCTTTACCTACGGCGACTGGAAACGGGACCTAT
ATTACTGAGCCTGATCAAACGGGAATTGTCAAGGACCTTAGCCATGTCGACTTTACTGATATCAAGGCCCTGCTCGAGGTCGTCAAGGATGCTGTAACGGGTCAGCCAGTCGATGATAGA
CACTATATAATGGAGCGAGTGATTCAG
CTTGCTGCCGGACTCCCTTCGACTTCTAAGAATGGGAAAGACTTGACGAACGCCTTCCTCAAGCAACTCTGGAATGACCTGGAGCATCCTCCA
ATTTC
ATACCTAGGCCGGGATTCTTCGTATCGCAAGGCCGATGGATCAGGAAATAACTTCCTGTGGCCTCATATTGGTGCAGCCGGTAGCCACTATGCCAGGTCTGTACGCCCAACAACT
GTTCAGTCGCCTTCGCTGCCGGACCCAAGCACGCTGTTCGCCTCTCTACTGGAAAGAAAAGAATACAAGGAGCACCCGAACAAGATTTCCAGTGTCTTGTTCTATCTCGCTTCCGTCATC
ATTCACG
ATCTATTCCAAACGGACCGCAGTGACTTCACTCTGAACAAAACCTCCTCGTATCTGGATCTTTCGCCGCTCTATGGCAACAACCAAGACGAGCAGGATCTCGTCAGGACTTTC
AAGGATGGGAAACTCAAGCCGGACTGCTTCTCTAGCAAACGTGTTCTTGGTTTCCCTCCCGGTGTCGGCGTACTTCTGCTGATGTTCAACCGCTTCCACAACTATGTTGTTGAAAATTTG
GCGACTATCAATGAAGGAGGCCGTTTCACCAAACCAGATGAGTCCGATGTCGACGCCAGCACGAAGTACGACAACGATCTCTTCCAGACTGGTCGGTTGGTCACGTGTGGCCTATACATT
AACATTATTCTCAAGGATTATGTTCGGACTATATTGAATATCAATCGAACAGACAGTCTGTGGAGCTTGGATCCTCGAGCTGATATCCAGGATAGCTTGCTAGGAAGCGCCCCAGCGGAA
GCTACGGGCAACCAGGTGTCTGCTGAATTCAATCTCGTCTACCGCTGGCATGCTTGCATATCACAGCGTGACGAGAAATGGACACAGGATCTGTACAAAGATCTGTTCCCAGGAAAGGAC
CCCAACAATGTTTCGTTACAGGAATTCATTAGGGGCGTGGCCAAGTGGGAAGCAAGCTTACCAGAACAACCCCCGGACCGTCCATTTGCTGGATTACAGCGTAATGCAGATGGTGCCTTC
GATGATGGCGACCTCGCAAACATGTTCGCGGATGGCGTTGAGGATTGTGCCGGTGCCTTTGGTGCAGGTAACATTCCATCAGTCTTCAGAAATATCGAGGCCCTCGGTATCTTGCAGGCG
CGTTCTTGGAACTTGGCTACCCTGAACGAATTCCGCAAGTTTTTCGACCTTGCGCCTTACAAGACCTTCGAGGAAATCAATCCTGATCCATACATTGCTGCCCAGCTCAAGAACCTGTAT
GATGAACCTGACCTGGTGGAGATGTATCCCGGCGTTATCGTGGAGGCTACGAAAGACGCGATAGTGCCTGGAAGCGGTCTGTGCACAAACTTCACAATATCAAGAGCTATCCTGTCCGAT
GCGGTGTCCCTTGTCCGTGGAGACCGTTTCTACACGGTTGATTACACACCAAAGCATCTCACAAACTGGGCTTACAACGAAATACAGCCTCAGGACTCCGTTGACCAGGGGCAGGTCTTT
TACAAATTGGTGCTGCGTGCGTTTCCTAGTCACTTCAAAGGCGATTCCGTTTACGCACACTTCCCTCTGGTCATCCCATCTGAGAACAAGAAGATTCTTGAGAAGCTTTCGGTTGCTCAA
GATTACAGCTGGGGCCGGCCGAGTTACACGCCTTCGCCGCAATTCGTCAGCTCTAATGCGGCTTGTATTTCCGTTCTCAACGACCAAGAGGCGTTCAAGGTCACTTGGGGAAGCAAGATC
GAATTTCTGATGCGCCACAACAATCACCCTTATGGTCGGGATTTCATGCTATCGGGTGACAAGCCACCCAACGCTGCATCGCGCAGGATGATGGGCTCGGCCCTATACCGCGACAAGTGG
GAGAGTGAGGTGAAGCGATTCTATGAGGATATCACCATAAAACTCCTGCGCCAACATTCTTACCAGCTGGGTGGCGTCAATCAAGTCGATATTGTCCGAGATGTTGCAAATTACGCCCAG
GTCCATTTCTGCGCAAATGTATTCTCTTTGCCCCTGAAGACTGAGTCTAACCCAAGGGGCATTTTTGCTGAGTCTGAATTGTACGAAATACTGGCACTTGTCTTCGCCTCCATTTTCTAC
GATGCCGATGTTGGAACATCATTCCAGCTCAACCAGACTGCCCGGGATGTGACTCAACAGCTCGGGGAACTAACCATGGCCAATGTCGACTTTGTCAACAAGGCCGGCTTCATCGCAAAC
TTAGTTAGCAGTCTGCACCGGCACGATGTCCTCAGTGAATACGGCGAACACATGATTCAGCGTCTGCTTCACAGCAATGTTCCTCCAGCTGAGATTGTCTGGACTCATCTGTTACCAACA
GCGGGTGGCATGGTGGCAAATCAAGCCCAACTCTTCTCGCAGTGCCTTGATTACTACCTTTCAGATGAAGGATCCATTCATTTGCCAGACATTAAACGACTCGCCAAAGAAAACACATCC
GAGGCTGATGCTCTTCTTCTACGATA
CTTCATGGAAGGAGCTCGGTTGCGGTCGTCCGTCGGCTTGCCGCGACTAGTCGCGAAGCCCACCGTCGTTGATGACGGCGGGTCAAAGTATACT
TTGAAGCCCGGCCAAAGTGTACTATGCAACCTA
GTATCTGCTTCCATGGATCCGCGCAGCTTTCCCGAGCCGGAGAAGGTCAAGCTTGACCGCGACATGAGCCTGTACGCCCACTTTGGA
TTCGGCCCTCATCAATGCTTAGGCATGGGCATCTGTAAGCTGGCTCTCACGACAATGCTGAGGGTGGTGGGACGGCTAGACAACCTCCGACGGGCTCCTGGATCTCAAGGCCAACTGAAG
AAGATTGCAGGACCTGGAGGGATTTCGATGTATATGACTGCAGACCAAAGCAGCTATTGGCCATTCCCATCGACCATGAAGATCCAATGGGATGGCGATCTGCCAAGTCTTGCTACGAAC
TAA

Retrieve as FASTA