Entry information : AnKat02 (catB)
Entry ID 5301
Creation 2007-04-24 (Christophe Dunand)
Last sequence changes 2012-04-23 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: AnKat02 (catB)
Name (synonym) AnKat02 (catB)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus
Organism Aspergillus niger    [TaxId: 5061 ]
Cellular localisation N/D
Tissue type Mycelium
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AnKat02
start..stop
S start..stop
PEchKat03 1160 0 1..726 1..730
CgKat02 959 0 9..726 14..705
CtheKat2 957 0 8..726 15..723
CthedisKat2 951 0 15..726 22..723
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 494908..495183 276 N° 2 494633..494858 226 N° 3 494167..494582 416 N° 4 493953..494117 165
N° 5 493692..493866 175 N° 6 492711..493636 926  
complement(join(492711..493636,493692..493866,493953..494117,494167..494582,4946 33..494858,494908..495183))


exon

Literature and cross-references AnKat02 (catB)
Literature Calera J.A., Paris S., Monod M., Hamilton A.J., Debeaupuis J.-P., Diaquin M., Lopez-Medrano R., Leal F., Latge J.-P. Cloning and disruption of the antigenic catalase gene of Aspergillus fumigatus. Infect. Immun. 65:4718-4724(1997).
Protein ref. UniProtKB:   A2Q7Q4
DNA ref. JGI genome:   chr_2_2 (495183..492711)
Protein sequence: AnKat02 (catB)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   727
PWM (Da):   %s   80124.99  
PI (pH):   %s   4.92
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRPIGLVGLIGLANAACPYMSRDLSARDSSDASESTEEFLSQYYLNDNNTYLTSDVGGPIEDQNSLSAGERGPTLLEDFIFRQKIQRFDHERVPERAVHARGVGAHGVFVSYGDFSNLTAASFLSEQGKETPMFVRFSTVAGSRGSTDLARDVHGFATRFYTDEGNFDLVGNNIPVFFIQDAIQFPDLIHAVKPRGDSEIPQAATAHDSAWDFFSQQPSALHTLFWAMAGHGIPRSFRHVDGFGVHTYRLVTDSGASKLVKFHWKSLQGKASMVWEEAQQVSGKNSDFMRQDLWTSIEYGRYPEWLGVQIMDEEDQLRFGFDLFDPTKIVPEEYVPITKLGKMTLNRNPLNYFAETEQVMFQPGHIVRGVDFTEDPLLQGRLFSYLDTQLNRHGGPNFEQLPINQPRVPIHNNNRDGAGQMYIPLNPNAYSPNTLNSASPKQANQTTGNGFFTSPGRTTSGHLLRSTSPTFQDVWSQPRLFYNSLVPTEQQFLIDAIRFETSNVKSTTVRQNVIIQLNRISNDLARRVARAIDVPAPDPDPTYYHDNKTADVGTFGTKLKKLSNLRVGFLASVQTPSSITAAQDLATELKDDEVDVVVVAERLTDGVDQTYSASDAIQFDAVVVAPGAEGLFASGSVTAPQLNSTASAVSTLYPAGRPLQVLVDAFRFGKTVGAVGSGEDALRNAGIDDEREGVVVGQTIGADFVDSVREGLRTFRFLDRFALDEE

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns) and 4 ESTs (DR702484, DR709671, DR703905, DR709571). Strain="CBS 513.88" and "N402".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTCCCATCGGTCTCGTTGGCCTCATTGGCCTTGCCAATGCCGCCTGCCCTTACATGAGTCGTGACCTCTCTGCTCGCGACTCCTCAGATGCCTCAGAATCCACTGAGGAATTCCTC
TCTCAGTACTACCTCAATGACAATAATACTTACCTCACTTCCGACGTGGGCGGTCCCATTGAGGACCAGAACAGTTTGAGCGCTGGTGAACGCGGCCCCACTCTGCTAGAGGACTTTATC
TTCCGCCAGAAGATCCAGCGCTTCGATCATGAACGA
GTAAGTCCTTTTGTTTATCTACTACGCAATTGCACCACTAAGAATGTAGGTTCCCGAACGCGCCGTACATGCCCGTGGCGTCGG
TGCCCACGGTGTCTTCGTCTCCTACGGCGACTTCTCCAACCTCACCGCGGCCTCATTCCTCTCTGAACAGGGCAAGGAAACTCCCATGTTCGTGCGCTTCTCCACTGTCGCTGGTAGTCG
TGGCAGTACCGATCTGGCGCGCGATGTGCACGGTTTTGCCACTCGCTTCTACACCGATGAGGGTAATTTCG
GTAAGCTATCCCCTGGTTACCGTACTCTTAGCCAAACACTAACTCGTCA
GATCTCGTGGGAAACAACATCCCCGTGTTCTTCATCCAGGATGCCATCCAGTTCCCCGACCTGATCCACGCCGTCAAGCCCAGAGGTGACAGTGAGATCCCGCAAGCCGCGACTGCTCAC
GACTCGGCCTGGGACTTCTTCAGCCAGCAGCCTAGCGCTCTGCATACTCTATTCTGGGCAATGGCTGGACACGGTATCCCGCGCTCCTTCCGGCATGTTGACGGCTTTGGCGTGCACACA
TACCGGCTGGTGACGGACAGCGGCGCGTCGAAGCTGGTCAAGTTCCATTGGAAGTCGCTGCAGGGCAAGGCCAGTATGGTCTGGGAAGAGGCGCAACAAGTCTCGGGCAAGAACTCGGAC
TTTATGCGCCAGGACCTGTGGACATCGATTGAGTATGGACGGTACCCGGAGTGGGAG
GTATGTGCGACACAGTACCTTACAGCGAGCTTACAACTAACATCCACAGCTTGGCGTGCAAAT
CATGGACGAAGAAGACCAGCTGCGCTTCGGGTTCGACTTGTTTGATCCCACTAAGATCGTGCCGGAAGAGTACGTGCCCATCACGAAGCTGGGTAAAATGACCCTCAACCGCAACCCGCT
CAACTACTTTGCGGAAACCGAGCAAGTCATG
GTATGTCCCTCCTTGCTTCCTTGTCTCTCCACCCGAATAACCTACATGGACCTTACCGACGCTACGAACCAATCTAACCGCACCAGTTC
CAACCCGGCCACATCGTCCGCGGAGTCGACTTTACCGAAGACCCTCTGCTGCAGGGCCGTCTCTTCTCGTACCTCGACACCCAGCTGAACCGCCACGGCGGCCCCAACTTCGAACAGCTG
CCCATTAACCAGCCTCGCGTCCCAATCCATAACAACAACCGTGATGGTGCAG
GTAAATCCCTCCCCCATCTCCCTCTTCCTACAACAACCGACTAACCCATAAATAGGCCAAATGTACAT
CCCTCTCAATCCGAACGCCTACTCCCCCAATACCCTCAACTCCGCCTCCCCCAAACAAGCCAACCAAACAACCGGCAACGGCTTCTTCACATCCCCCGGCCGCACCACTTCCGGGCACCT
CCTGCGCAGCACCTCCCCGACCTTCCAAGACGTCTGGTCCCAGCCGCGCCTCTTCTACAACTCGCTCGTGCCCACCGAACAACAATTCCTAATCGACGCGATCCGCTTCGAAACGAGCAA
CGTCAAATCCACCACCGTGCGCCAGAACGTCATCATCCAACTCAACCGCATCTCCAACGACCTTGCCCGTCGCGTCGCCCGCGCCATTGACGTCCCCGCCCCGGACCCCGACCCAACATA
CTACCACGACAACAAGACCGCCGACGTAGGCACCTTCGGCACGAAGTTGAAGAAGCTCTCGAACCTGAGAGTCGGATTTCTGGCCTCCGTGCAAACACCATCTTCTATCACCGCCGCGCA
GGACCTCGCGACGGAGCTGAAAGACGATGAAGTGGACGTGGTGGTTGTCGCAGAGAGATTGACCGATGGAGTCGATCAGACTTATTCAGCCTCAGACGCGATTCAGTTCGATGCGGTGGT
TGTGGCGCCTGGGGCGGAGGGGTTGTTTGCGTCCGGGTCGGTCACGGCGCCGCAGCTTAATTCTACAGCGAGTGCGGTGAGTACGCTGTATCCGGCGGGCAGGCCGTTGCAGGTGCTGGT
GGATGCGTTCCGGTTCGGCAAGACGGTGGGGGCGGTTGGGAGTGGGGAGGACGCGTTGCGGAATGCGGGGATTGATGATGAGAGAGAGGGTGTTGTGGTGGGGCAGACGATTGGGGCGGA
CTTTGTGGACAGTGTTAGGGAGGGGTTGAGGACGTTTAGGTTCCTGGATCGGTTTGCACTGGATGAGGAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTCCCATCGGTCTCGTTGGCCTCATTGGCCTTGCCAATGCCGCCTGCCCTTACATGAGTCGTGACCTCTCTGCTCGCGACTCCTCAGATGCCTCAGAATCCACTGAGGAATTCCTC
TCTCAGTACTACCTCAATGACAATAATACTTACCTCACTTCCGACGTGGGCGGTCCCATTGAGGACCAGAACAGTTTGAGCGCTGGTGAACGCGGCCCCACTCTGCTAGAGGACTTTATC
TTCCGCCAGAAGATCCAGCGCTTCGATCATGAACGA
GTTCCCGAACGCGCCGTACATGCCCGTGGCGTCGGTGCCCACGGTGTCTTCGTCTCCTACGGCGACTTCTCCAACCTCACCGCG
GCCTCATTCCTCTCTGAACAGGGCAAGGAAACTCCCATGTTCGTGCGCTTCTCCACTGTCGCTGGTAGTCGTGGCAGTACCGATCTGGCGCGCGATGTGCACGGTTTTGCCACTCGCTTC
TACACCGATGAGGGTAATTTCG
ATCTCGTGGGAAACAACATCCCCGTGTTCTTCATCCAGGATGCCATCCAGTTCCCCGACCTGATCCACGCCGTCAAGCCCAGAGGTGACAGTGAGATC
CCGCAAGCCGCGACTGCTCACGACTCGGCCTGGGACTTCTTCAGCCAGCAGCCTAGCGCTCTGCATACTCTATTCTGGGCAATGGCTGGACACGGTATCCCGCGCTCCTTCCGGCATGTT
GACGGCTTTGGCGTGCACACATACCGGCTGGTGACGGACAGCGGCGCGTCGAAGCTGGTCAAGTTCCATTGGAAGTCGCTGCAGGGCAAGGCCAGTATGGTCTGGGAAGAGGCGCAACAA
GTCTCGGGCAAGAACTCGGACTTTATGCGCCAGGACCTGTGGACATCGATTGAGTATGGACGGTACCCGGAGTGGGAG
CTTGGCGTGCAAATCATGGACGAAGAAGACCAGCTGCGCTTC
GGGTTCGACTTGTTTGATCCCACTAAGATCGTGCCGGAAGAGTACGTGCCCATCACGAAGCTGGGTAAAATGACCCTCAACCGCAACCCGCTCAACTACTTTGCGGAAACCGAGCAAGTC
ATG
TTCCAACCCGGCCACATCGTCCGCGGAGTCGACTTTACCGAAGACCCTCTGCTGCAGGGCCGTCTCTTCTCGTACCTCGACACCCAGCTGAACCGCCACGGCGGCCCCAACTTCGAA
CAGCTGCCCATTAACCAGCCTCGCGTCCCAATCCATAACAACAACCGTGATGGTGCAG
GCCAAATGTACATCCCTCTCAATCCGAACGCCTACTCCCCCAATACCCTCAACTCCGCCTCC
CCCAAACAAGCCAACCAAACAACCGGCAACGGCTTCTTCACATCCCCCGGCCGCACCACTTCCGGGCACCTCCTGCGCAGCACCTCCCCGACCTTCCAAGACGTCTGGTCCCAGCCGCGC
CTCTTCTACAACTCGCTCGTGCCCACCGAACAACAATTCCTAATCGACGCGATCCGCTTCGAAACGAGCAACGTCAAATCCACCACCGTGCGCCAGAACGTCATCATCCAACTCAACCGC
ATCTCCAACGACCTTGCCCGTCGCGTCGCCCGCGCCATTGACGTCCCCGCCCCGGACCCCGACCCAACATACTACCACGACAACAAGACCGCCGACGTAGGCACCTTCGGCACGAAGTTG
AAGAAGCTCTCGAACCTGAGAGTCGGATTTCTGGCCTCCGTGCAAACACCATCTTCTATCACCGCCGCGCAGGACCTCGCGACGGAGCTGAAAGACGATGAAGTGGACGTGGTGGTTGTC
GCAGAGAGATTGACCGATGGAGTCGATCAGACTTATTCAGCCTCAGACGCGATTCAGTTCGATGCGGTGGTTGTGGCGCCTGGGGCGGAGGGGTTGTTTGCGTCCGGGTCGGTCACGGCG
CCGCAGCTTAATTCTACAGCGAGTGCGGTGAGTACGCTGTATCCGGCGGGCAGGCCGTTGCAGGTGCTGGTGGATGCGTTCCGGTTCGGCAAGACGGTGGGGGCGGTTGGGAGTGGGGAG
GACGCGTTGCGGAATGCGGGGATTGATGATGAGAGAGAGGGTGTTGTGGTGGGGCAGACGATTGGGGCGGACTTTGTGGACAGTGTTAGGGAGGGGTTGAGGACGTTTAGGTTCCTGGAT
CGGTTTGCACTGGATGAGGAGTGA

Retrieve as FASTA