Entry information : AnKat04 (catalase R / catR / KatE)
Entry ID 5302
Creation 2007-04-24 (Christophe Dunand)
Last sequence changes 2012-04-23 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: AnKat04 (catalase R / catR / KatE)
Name (synonym) AnKat04 (catalase R / catR / KatE)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus
Organism Aspergillus niger    [TaxId: 5061 ]
Cellular localisation N/D
Tissue type Mycelium
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AnKat04
start..stop
S start..stop
PEchKat03 919 0 1..730 1..730
AnKat02 914 0 7..730 6..726
CtheKat2 845 0 14..730 20..723
CthedisKat2 835 0 16..730 22..723
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 561530..561823 294 N° 2 561242..561467 226 N° 3 560764..561179 416 N° 4 560545..560709 165
N° 5 559404..560495 1092  
complement(join(559404..560495,560545..560709,560764..561179,561242..561467,5615 30..561823))


exon

Literature and cross-references AnKat04 (catalase R / catR / KatE)
Literature Fowler,T., Rey,M.W., Vaha-Vahe,P., Power,S.D. and Berka,R.M. The catR gene encoding a catalase from Aspergillus niger: primary structure and elevated expression through increased gene copy number and use of a strong promoter. Mol. Microbiol. 9 (5), 989-998 (1993)
Protein ref. UniProtKB:   A2Q7T0
DNA ref. JGI genome:   chr_2_2 (561823..559404)
Protein sequence: AnKat04 (catalase R / catR / KatE)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   730 (714)
PWM (Da):   %s   80359.37 (78668.5)  
PI (pH):   %s   5.88 (5.67) Peptide Signal:   %s   cut: 17 range:17-730
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRHFWLLPAVAGIAGAQCPYLSGEMSFTQEQDNAGDTIEVTEQPIDNTLYVNDTGSYMTTDFGTPISDQTSLKAGPRGPTLLEDFIFRQKLQRFDHERVPERVVHARGAGAYGTFKSYADWSNVTAADFLSANDKETPMFCRFSTVVGFRGSVDTARDVHGHACRFYTDEGNYDIVGINFAPFFIQDAIQFPDLVHAIKPMPNNEIPQAATAHTSAWDFFSQQSTALHSALWLMSGNGIPRSFRHMNGYGVHSFRFVAANGTSKVVRYRWKSQQGVASLVWDEAQAAAGKNSDYHRQDLYNAIANGHYPKYLQAQIMDEADMLRFGFDLLDPTKLVPEEVVPYTPLGMMELNANPTNYFAEVEQAGFQPGHVVPGIDFTDDPLLQGRLFSYLDTQLTRHGGPNFEQIPVNRPRKPVHNNNRDGFGQQQIPTNNWAYTPNSMSNGYPMQANQTQGHGFFTAPYRYASGHLVRQTSPTFNDHWSQPAMFWNSLIPAEQQMVVNAIVFENSKVNSPHVRKNVVNQLNMVNNNLAVRVARGLGLDEPSPNPTYYTSNKTSNVGTFGKPLLSIEGLQVGFLASNSHPESIKQGQAMAAQFSAAGVDLNIVTEAYADGVNTTYALSDAIDFDALIIADGVQSLFASPALANQMNSTATSTLYPPARPFQILVDSFRYGKPVAAVGSGSVALKNAGIDSSRSGVYTGSSETTEKIAKEVLEGLYTFRFVDRFALDE*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns) and 5 ESTs (DR700586, DR705725, DR703043, DR702249, DR700747). Strain="CBS 513.88" and "N402".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTCATTTCTGGCTTTTGCCAGCTGTTGCTGGTATCGCTGGGGCTCAATGCCCCTACCTGTCGGGTGAAATGAGTTTCACCCAGGAGCAGGACAATGCTGGCGATACCATTGAGGTC
ACGGAGCAGCCCATTGACAACACCCTGTATGTCAATGACACCGGTAGCTACATGACTACCGACTTTGGCACTCCGATCTCCGACCAGACCAGTCTCAAGGCCGGGCCCCGTGGTCCTACC
CTGTTGGAGGACTTTATCTTCCGTCAGAAGCTTCAGCGGTTCGACCATGAGCGT
GTAAGTACAGTAACTGCTGCGGTGTGTAGTAACAATAAATTGACCCAGTGGTTTTCAATTAGGTCC
CCGAGCGCGTCGTCCACGCCCGTGGTGCCGGTGCATATGGTACTTTCAAATCCTACGCCGACTGGTCGAACGTCACGGCTGCCGATTTCTTGAGTGCCAACGATAAGGAGACCCCTATGT
TCTGTCGCTTCTCTACTGTGGTCGGTTTCCGTGGTAGTGTTGACACTGCGCGTGATGTTCACGGTCACGCTTGTCGGTTCTACACTGACGAGGGTAACTATG
GTATGCTTGATATGGTCA
CCCAACAATAATTCAATACATGCTAACAGATATGTCTCTACTAGACATCGTCGGTATCAATTTCGCCCCCTTCTTCATCCAGGACGCCATCCAGTTCCCCGATCTTGTCCACGCCATCAA
GCCCATGCCCAACAATGAGATCCCCCAGGCCGCTACTGCACACACTTCCGCTTGGGACTTCTTCAGCCAGCAGAGCACTGCCCTCCACAGTGCCTTGTGGCTGATGTCTGGTAACGGTAT
TCCTCGTTCTTTCCGCCACATGAACGGCTACGGAGTCCACAGCTTCCGCTTCGTCGCTGCCAATGGCACTTCCAAGGTGGTTCGCTACCGCTGGAAGTCCCAACAGGGTGTTGCCAGTCT
GGTGTGGGATGAAGCTCAGGCCGCTGCTGGTAAGAACAGTGACTACCACCGCCAGGATCTGTACAATGCGATCGCCAATGGCCACTACCCGAAATACGAG
GTCAGCCAATCCCTTGATGT
CTATCGATAGAGCCTTTTGCTGACAATCCCCTAGCTCCAAGCCCAGATCATGGATGAGGCTGACATGCTTCGTTTCGGCTTCGACCTTCTGGATCCCACCAAGTTGGTCCCCGAGGAGGT
TGTCCCTTACACTCCTCTCGGAATGATGGAGCTCAATGCCAACCCCACCAACTACTTTGCTGAAGTTGAACAGGCTGGT
GTATGTATTCCCCATTCATCAAATGCCAGACATAATCTAAC
TTCTGCAGTTCCAACCCGGTCACGTCGTTCCTGGCATTGACTTCACCGACGACCCCCTGCTGCAAGGCCGTCTCTTCTCCTACCTCGACACTCAGTTGACCCGTCACGGCGGTCCCAACT
TCGAGCAAATCCCCGTCAACCGTCCTCGCAAGCCCGTTCACAACAACAACCGTGACGGCTTCGGCCAGCAGCAGATCCCCACCAACAACTGGGCCTACACCCCCAACAGCATGAGCAACG
GTTACCCCATGCAAGCCAACCAGACCCAGGGTCATGGTTTCTTCACCGCGCCCTACCGCTACGCTTCCGGCCATCTCGTCCGCCAGACCAGCCCGACCTTCAATGACCACTGGTCCCAGC
CCGCCATGTTCTGGAACTCTCTGATCCCCGCTGAGCAGCAGATGGTTGTCAACGCCATTGTCTTTGAGAACTCCAAGGTTAACAGCCCCCACGTTCGGAAGAACGTTGTCAACCAGCTGA
ACATGGTCAACAACAACCTCGCCGTCCGTGTCGCTCGTGGTCTTGGTCTCGATGAGCCCTCCCCCAACCCGACTTACTACACCTCCAACAAGACCTCCAACGTCGGTACCTTCGGCAAGC
CCCTCCTCAGCATCGAGGGTCTGCAGGTCGGCTTCCTGGCCTCGAACTCCCACCCCGAATCCATCAAGCAGGGCCAGGCCATGGCCGCGCAGTTCTCTGCCGCTGGCGTCGACCTGAACA
TTGTCACCGAGGCCTACGCCGATGGTGTCAACACCACCTACGCCCTGTCTGATGCCATCGACTTTGACGCCCTCATCATCGCCGATGGTGTGCAGAGCCTCTTCGCCTCCCCCGCTCTCG
CTAACCAGATGAACTCTACCGCCACCTCTACTCTCTACCCTCCTGCCAGACCTTTCCAGATCCTGGTCGATTCTTTCAGGTACGGTAAGCCCGTGGCTGCTGTCGGCAGTGGCAGTGTTG
CGCTCAAGAACGCTGGTATTGATTCCTCCCGCTCTGGTGTGTACACTGGCTCGAGCGAGACGACGGAGAAGATCGCCAAGGAGGTCTTGGAGGGACTCTACACTTTCCGTTTTGTGGACC
GGTTTGCGCTGGATGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTCATTTCTGGCTTTTGCCAGCTGTTGCTGGTATCGCTGGGGCTCAATGCCCCTACCTGTCGGGTGAAATGAGTTTCACCCAGGAGCAGGACAATGCTGGCGATACCATTGAGGTC
ACGGAGCAGCCCATTGACAACACCCTGTATGTCAATGACACCGGTAGCTACATGACTACCGACTTTGGCACTCCGATCTCCGACCAGACCAGTCTCAAGGCCGGGCCCCGTGGTCCTACC
CTGTTGGAGGACTTTATCTTCCGTCAGAAGCTTCAGCGGTTCGACCATGAGCGT
GTCCCCGAGCGCGTCGTCCACGCCCGTGGTGCCGGTGCATATGGTACTTTCAAATCCTACGCCGAC
TGGTCGAACGTCACGGCTGCCGATTTCTTGAGTGCCAACGATAAGGAGACCCCTATGTTCTGTCGCTTCTCTACTGTGGTCGGTTTCCGTGGTAGTGTTGACACTGCGCGTGATGTTCAC
GGTCACGCTTGTCGGTTCTACACTGACGAGGGTAACTATG
ACATCGTCGGTATCAATTTCGCCCCCTTCTTCATCCAGGACGCCATCCAGTTCCCCGATCTTGTCCACGCCATCAAGCCC
ATGCCCAACAATGAGATCCCCCAGGCCGCTACTGCACACACTTCCGCTTGGGACTTCTTCAGCCAGCAGAGCACTGCCCTCCACAGTGCCTTGTGGCTGATGTCTGGTAACGGTATTCCT
CGTTCTTTCCGCCACATGAACGGCTACGGAGTCCACAGCTTCCGCTTCGTCGCTGCCAATGGCACTTCCAAGGTGGTTCGCTACCGCTGGAAGTCCCAACAGGGTGTTGCCAGTCTGGTG
TGGGATGAAGCTCAGGCCGCTGCTGGTAAGAACAGTGACTACCACCGCCAGGATCTGTACAATGCGATCGCCAATGGCCACTACCCGAAATACGAG
CTCCAAGCCCAGATCATGGATGAG
GCTGACATGCTTCGTTTCGGCTTCGACCTTCTGGATCCCACCAAGTTGGTCCCCGAGGAGGTTGTCCCTTACACTCCTCTCGGAATGATGGAGCTCAATGCCAACCCCACCAACTACTTT
GCTGAAGTTGAACAGGCTGGT
TTCCAACCCGGTCACGTCGTTCCTGGCATTGACTTCACCGACGACCCCCTGCTGCAAGGCCGTCTCTTCTCCTACCTCGACACTCAGTTGACCCGTCAC
GGCGGTCCCAACTTCGAGCAAATCCCCGTCAACCGTCCTCGCAAGCCCGTTCACAACAACAACCGTGACGGCTTCGGCCAGCAGCAGATCCCCACCAACAACTGGGCCTACACCCCCAAC
AGCATGAGCAACGGTTACCCCATGCAAGCCAACCAGACCCAGGGTCATGGTTTCTTCACCGCGCCCTACCGCTACGCTTCCGGCCATCTCGTCCGCCAGACCAGCCCGACCTTCAATGAC
CACTGGTCCCAGCCCGCCATGTTCTGGAACTCTCTGATCCCCGCTGAGCAGCAGATGGTTGTCAACGCCATTGTCTTTGAGAACTCCAAGGTTAACAGCCCCCACGTTCGGAAGAACGTT
GTCAACCAGCTGAACATGGTCAACAACAACCTCGCCGTCCGTGTCGCTCGTGGTCTTGGTCTCGATGAGCCCTCCCCCAACCCGACTTACTACACCTCCAACAAGACCTCCAACGTCGGT
ACCTTCGGCAAGCCCCTCCTCAGCATCGAGGGTCTGCAGGTCGGCTTCCTGGCCTCGAACTCCCACCCCGAATCCATCAAGCAGGGCCAGGCCATGGCCGCGCAGTTCTCTGCCGCTGGC
GTCGACCTGAACATTGTCACCGAGGCCTACGCCGATGGTGTCAACACCACCTACGCCCTGTCTGATGCCATCGACTTTGACGCCCTCATCATCGCCGATGGTGTGCAGAGCCTCTTCGCC
TCCCCCGCTCTCGCTAACCAGATGAACTCTACCGCCACCTCTACTCTCTACCCTCCTGCCAGACCTTTCCAGATCCTGGTCGATTCTTTCAGGTACGGTAAGCCCGTGGCTGCTGTCGGC
AGTGGCAGTGTTGCGCTCAAGAACGCTGGTATTGATTCCTCCCGCTCTGGTGTGTACACTGGCTCGAGCGAGACGACGGAGAAGATCGCCAAGGAGGTCTTGGAGGGACTCTACACTTTC
CGTTTTGTGGACCGGTTTGCGCTGGATGAGTAA

Retrieve as FASTA