Entry information : AnKat03
Entry ID 5303
Creation 2007-04-24 (Christophe Dunand)
Last sequence changes 2012-04-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-24 (Christophe Dunand)
Peroxidase information: AnKat03
Name AnKat03
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus
Organism Aspergillus niger    [TaxId: 5061 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AnKat03
start..stop
S start..stop
AorKat03 967 0 1..501 1..501
AniKat02 928 0 1..501 1..501
CimKat02 919 0 1..491 1..493
PEchKat02 905 0 1..501 1..501
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 720459..720482 24 N° 2 720334..720384 51 N° 3 718854..720284 1431  
complement(join(718854..720284,720334..720384,720459..720482))


exon

Literature and cross-references AnKat03
Literature Mutoh,N., Nakagawa,C.W. and Yamada,K. The role of catalase in hydrogen peroxide resistance in fission yeast Schizosaccharomyces pombe. Can. J. Microbiol. 45 (2), 125-129 (1999)
Protein ref. UniProtKB:   A2QC95
DNA ref. JGI genome:   chr_4_2 (720482..718854)
EST ref. GenBank:   DR701945.1 [Fragment]
Protein sequence: AnKat03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   501
PWM (Da):   %s   57355.25  
PI (pH):   %s   7.24
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKDDQPKTYRYNEKPIYTTSNGCPVMDPQAAQRVGRNGPLLLQDFHLIDLLAHFDRERIPERVVHAKGAGAFGEFEVTDDISDITVIDMLKGIGKKTKLFTRFSTVGGEKGSPDSARDPRGFAIKFYTEEGNWDWVFNNTPVFFLRDPAKFPIFIHTQKRNPQTNLKDATMFWDYLSTHQEAIHQVMHLFSDRGTPYSYRHMNGYSGHTYKWIKPDGTFNYVQIHLKTDQGNKTFNNEEATRLAAENPDWHTQDLFDAISRGENPSWTCYVQVLSPEQAEKFRWSVFDLTKVWPQSEVPLRRFGKLTLNKNPENYFAEVEQAAFSPSHMVPGVEPSADPVLQSRLFSYPDTQRHRLSGNYEQIPVNCPLRSFSPWHRDGYMNVHGNYGANPNYPSTFRPYNYQPLKASQEHEKWAGSVVVEQLPVTDEDYVQANGLWQVLGRQPGQQDNFVHNVSSHLCAAHERVRKATYGMFHRVNPDLGARIEKATEAKADHSKSARL

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns) and EST (DR701945). Strain="CBS 513.88".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCAAGGACGATCAACCCAGTATGTCTATACTTCTTTGGCTTTCCGTTCGTTCTGAAGCGTGAAATGAAGACTAACTTGGATTTGTCTTATAGAGACCTACCGCTACAATGAGAAGC
CCATCTACACTACCTCCAATGGCTGCCCA
GTATGCTACGCCGATATCAAATTTACGGATACAAGGCTGACACATTCAGGTTATGGACCCCCAGGCTGCTCAGCGCGTTGGCCGCAACGGA
CCCCTTCTGCTCCAGGACTTCCACCTGATCGACCTTCTCGCACACTTCGACAGAGAGAGAATCCCAGAGCGTGTTGTTCACGCCAAGGGTGCTGGCGCCTTTGGTGAGTTCGAGGTTACC
GATGACATTAGCGACATCACCGTCATCGACATGCTCAAGGGCATTGGCAAGAAGACCAAGCTGTTCACTCGCTTCTCCACCGTCGGTGGTGAGAAGGGCTCTCCGGACAGCGCGCGTGAT
CCTCGTGGCTTCGCTATCAAGTTCTACACTGAAGAGGGTAACTGGGACTGGGTCTTCAACAACACCCCCGTCTTCTTCCTCCGTGACCCCGCCAAGTTCCCCATCTTCATCCACACCCAG
AAGCGCAACCCCCAGACCAACCTCAAGGATGCCACCATGTTCTGGGACTACCTTTCCACCCACCAGGAGGCCATCCACCAGGTCATGCACCTCTTCAGTGACCGTGGCACGCCTTACTCT
TACCGCCACATGAACGGCTACTCCGGCCACACTTACAAGTGGATCAAGCCCGACGGCACCTTCAACTACGTCCAGATCCACCTCAAGACCGACCAGGGCAACAAGACCTTCAACAACGAG
GAGGCCACTCGCCTGGCGGCTGAGAACCCCGACTGGCACACCCAGGACTTGTTTGACGCTATTTCGCGTGGCGAGAACCCCTCATGGACCTGCTATGTCCAGGTTCTGAGCCCTGAGCAG
GCCGAGAAGTTCCGCTGGAGCGTCTTTGACCTGACCAAGGTCTGGCCTCAGAGTGAGGTCCCTCTGCGCCGCTTCGGCAAGCTCACTCTCAACAAGAACCCCGAGAACTACTTCGCCGAG
GTTGAGCAGGCCGCCTTCTCTCCGTCGCACATGGTTCCGGGCGTCGAGCCCTCTGCCGACCCAGTCCTGCAGTCCCGCCTCTTCTCCTACCCCGACACCCAGCGCCACCGTCTGAGCGGC
AACTACGAGCAGATCCCCGTCAACTGCCCGCTCCGCTCGTTCAGCCCCTGGCACCGTGATGGCTACATGAACGTGCACGGTAACTACGGAGCCAACCCCAACTACCCCTCCACCTTCCGT
CCTTACAACTACCAGCCCTTGAAGGCTAGCCAGGAGCACGAGAAGTGGGCCGGCTCCGTCGTTGTTGAGCAGCTGCCCGTCACCGATGAGGATTACGTCCAGGCCAACGGTCTTTGGCAG
GTCTTGGGTCGCCAGCCCGGCCAGCAGGACAACTTCGTCCACAATGTTTCCTCTCACTTGTGCGCCGCCCACGAGCGTGTTCGCAAGGCCACCTACGGCATGTTCCATCGTGTGAACCCC
GATCTGGGTGCCCGCATCGAGAAGGCTACCGAGGCCAAGGCTGACCACTCCAAGTCTGCTCGTCTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCAAGGACGATCAACCCAGTACCTACCGCTACAATGAGAAGCCCATCTACACTACCTCCAATGGCTGCCCAGTTATGGACCCCCAGGCTGCTCAGCGCGTTGGCCGCAACGGACCC
CTTCTGCTCCAGGACTTCCACCTGATCGACCTTCTCGCACACTTCGACAGAGAGAGAATCCCAGAGCGTGTTGTTCACGCCAAGGGTGCTGGCGCCTTTGGTGAGTTCGAGGTTACCGAT
GACATTAGCGACATCACCGTCATCGACATGCTCAAGGGCATTGGCAAGAAGACCAAGCTGTTCACTCGCTTCTCCACCGTCGGTGGTGAGAAGGGCTCTCCGGACAGCGCGCGTGATCCT
CGTGGCTTCGCTATCAAGTTCTACACTGAAGAGGGTAACTGGGACTGGGTCTTCAACAACACCCCCGTCTTCTTCCTCCGTGACCCCGCCAAGTTCCCCATCTTCATCCACACCCAGAAG
CGCAACCCCCAGACCAACCTCAAGGATGCCACCATGTTCTGGGACTACCTTTCCACCCACCAGGAGGCCATCCACCAGGTCATGCACCTCTTCAGTGACCGTGGCACGCCTTACTCTTAC
CGCCACATGAACGGCTACTCCGGCCACACTTACAAGTGGATCAAGCCCGACGGCACCTTCAACTACGTCCAGATCCACCTCAAGACCGACCAGGGCAACAAGACCTTCAACAACGAGGAG
GCCACTCGCCTGGCGGCTGAGAACCCCGACTGGCACACCCAGGACTTGTTTGACGCTATTTCGCGTGGCGAGAACCCCTCATGGACCTGCTATGTCCAGGTTCTGAGCCCTGAGCAGGCC
GAGAAGTTCCGCTGGAGCGTCTTTGACCTGACCAAGGTCTGGCCTCAGAGTGAGGTCCCTCTGCGCCGCTTCGGCAAGCTCACTCTCAACAAGAACCCCGAGAACTACTTCGCCGAGGTT
GAGCAGGCCGCCTTCTCTCCGTCGCACATGGTTCCGGGCGTCGAGCCCTCTGCCGACCCAGTCCTGCAGTCCCGCCTCTTCTCCTACCCCGACACCCAGCGCCACCGTCTGAGCGGCAAC
TACGAGCAGATCCCCGTCAACTGCCCGCTCCGCTCGTTCAGCCCCTGGCACCGTGATGGCTACATGAACGTGCACGGTAACTACGGAGCCAACCCCAACTACCCCTCCACCTTCCGTCCT
TACAACTACCAGCCCTTGAAGGCTAGCCAGGAGCACGAGAAGTGGGCCGGCTCCGTCGTTGTTGAGCAGCTGCCCGTCACCGATGAGGATTACGTCCAGGCCAACGGTCTTTGGCAGGTC
TTGGGTCGCCAGCCCGGCCAGCAGGACAACTTCGTCCACAATGTTTCCTCTCACTTGTGCGCCGCCCACGAGCGTGTTCGCAAGGCCACCTACGGCATGTTCCATCGTGTGAACCCCGAT
CTGGGTGCCCGCATCGAGAAGGCTACCGAGGCCAAGGCTGACCACTCCAAGTCTGCTCGTCTGTAA

Retrieve as FASTA