Entry information : AnLDS02
Entry ID 5305
Creation 2007-05-01 (Christophe Dunand)
Last sequence changes 2012-04-23 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: AnLDS02
Name AnLDS02
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus
Organism Aspergillus niger    [TaxId: 5061 ]
Cellular localisation N/D
Tissue type Mycelium
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AnLDS02
start..stop
S start..stop
AteLDS02 1901 0 21..1180 21..1176
AflLDS02 1540 0 5..1150 52..1238
AorLDS02 1509 0 5..1150 52..1228
GmoLDS02 1117 0 91..1164 6..1135
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 858721..859152 432 N° 2 858481..858645 165 N° 3 858297..858405 109 N° 4 858154..858243 90
N° 5 857751..858093 343 N° 6 856894..857680 787 N° 7 856771..856832 62 N° 8 856235..856711 477
N° 9 855746..856166 421 N° 10 855446..855679 234 N° 11 855110..855386 277 N° 12 854693..854841 149
complement(join(854693..854841,855110..855386,855446..855679,855746..856166,8562 35..856711,856771..856832,856894..857680,857751..858093,858154..858243,858297..8 58405,858481..858645,858721..859152))


exon

Literature and cross-references AnLDS02
Literature Hoernsten L., Su C., Osbourn A.E., Garosi P., Hellman U., Wernstedt C., Oliw E.H.;
"Cloning of linoleate diol synthase reveals homology with prostaglandin H synthases.";
J. Biol. Chem. 274:28219-28224(1999).
Protein ref. UniProtKB:   A2QYI1
DNA ref. JGI genome:   chr_3_1 (859152..854693)
EST ref. GenBank:   DR709174
Protein sequence: AnLDS02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1181 (1159)
PWM (Da):   %s   133472.3 (130971.9)  
PI (pH):   %s   8.34 (8.28) Peptide Signal:   %s   cut: 23 range:23-1181
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSIFIALLLCLLSYLYLRVFADDLTRPLQILAKFFSSHQHPTWKLRPRFLPKATRAALSSIAGTGEGLWQRLYARTFHAQELAEVEDDLKYQAGEPYGDPDVLATGLVKDLSALGLKGKRSDLRTLIQLVKAKGKPIDDRQMLMEKVIAIVSMLPRTSKSRQRLTGILVDQLWQSLEHPPLSYFGNKYQYRTPDGSYNNPLEPDLGKAGSPYARSVPRLKALHGVQPDPGLLFDLLMARDDTTFRENPAGISSVLFYHASIIIHDVFCTNRRDPNISDTSSYLDLAPLYGSSYEDQLRVRTMQRGMLKPDTFHEKRLLGQPPGVNVILVMYNRFHNYVADVLLKINENGRFTLPPTTSEDAKRKALAKQDEDLFQVTRLIVNGLYVNISLHDYLRGLTNTHHSASDWTLDPRVAVSRAFDADGVPRGVGNQVSAEFNLLYRFHSVISRRDEQWTNEFLKSLFPDLKKPLEQLTPQEFMQGLINYERSIDKDPSKREFGGLKRNQDGRFNDAELVQILKDSMEDPAGLFGARMVPKALRMVEIAGILTARKWNLASLNEMRDFFKLKRHSSFEDINPDPKIADLLRKLYDHPDMVEMYPGIFLEDAKPAMDPGCGGCPPYTVGRAVFSDAVTLVRSDRFLTDYTASNLTNWGIREVQQDYDILGGSMFHKLIQRALPGWFPYNSLHATQPMFTRKMNEQIAKEIGTIDRYSQEDPKPPPRTVMLANHATIIEVLKDQDTFRVPWARYLNDMIPGKRFNDYMLGGDGPVNAAQKKLVKSILFSPDQFNQLLSQTTVRLGKELLELNTLQLSKDLNQVDIIRDVAIPLNARIMADLFCLDMKTPENESGSMNAATVYKHLMNVRTWGFNNTDPGLMLQRRKWASESAEALVKTTLKVVNEQAQPQKTHMLKKLTGYQRSEVSTLRWYGNNVVKQMMEMDMTAAETAEVCWLTAVGGVGAPVGVADVLQYYLRPENIDHWKRIQNLVSQPDNSGSIDKLLRQYVLEAQRLTSMECTVRVCRAHRTINDQEFKPGDVVITLLGPACRDPTSIPDAETFKLDRPSNAYIHFGYGAHECLGKEIGLTFAVSMLRVLAGLKYLRPAPGDMGMLKSIIVDGRRVYLNDSWSWMIQDPTNGGIGMSTQYSFGQHHHHQYHEITRTSSSSLPSMLGDDESYGRFSGTLN

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns) and 2 ESTs (DR709174 (5') and DR704511 (3')). Some mismatches have been observed between genomic and ESTs. Strain="N402". Fusion with CypX on the C-terminus.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCTCCATTTTCATTGCTCTTCTCCTTTGCCTTCTATCTTATCTCTACCTGCGGGTCTTTGCAGATGACCTGACACGACCTCTTCAAATACTTGCCAAGTTTTTCTCTTCCCATCAA
CACCCGACATGGAAGCTAAGGCCTCGTTTCCTTCCAAAGGCCACAAGAGCGGCTCTATCCAGCATTGCCGGAACGGGAGAGGGACTCTGGCAACGACTATATGCGAGGACGTTCCATGCA
CAAGAGTTAGCAGAAGTAGAAGATGACTTGAAATATCAGGCTGGAGAGCCATATGGAGATCCCGATGTTCTTGCCACAGGCCTTGTCAAAGATCTCTCGGCCCTGGGACTTAAGGGCAAA
AGAAGCGATCTTCGTACTTTGATCCAATTAGTGAAGGCTAAAGGAAAGCCGATCGATGATCGCCAAATGCTG
GTGAGTTTGGCTTCGGCACATAATTCAGTATTCCGTTGTAGAGATCCA
TTGCTAATGAAGGATTGATCGCTGCAGATGGAAAAAGTCATCGCCATCGTTTCGATGTTACCGCGAACCTCCAAATCCCGACAGAGGTTGACCGGCATCCTGGTCGACCAGCTCTGGCAG
AGCCTAGAGCACCCTCCGCTGTCGTACTTTGGGAATAAGTACCAGTATCGCACTCCAGATGGGAGCTACAAC
GTTAGTTCACAATCTCCCCATCTGCTGTCTAAAAGGACGTGGACATTA
CTAATGTATACGACTTTAATCTTATAGAACCCTTTAGAGCCTGACCTTGGCAAAGCAGGCAGTCCGTATGCGAGATCAGTGCCCCGGCTCAAGGCCCTGCACGGAGTGCAGCCTGATCCT
GGCCTTCTTTTTGACC
GTGAGTCTCGAGTCTCGAGCTTAAATAGTACATTTCTGACAATCAAAATTCAGTCCTCATGGCCCGTGACGACACGACTTTCCGGGAAAATCCTGCAGGCATCT
CGTCGGTTCTATTCTATCATGCAAGCATCATAATTCACG
GTGAGTCTACTATACATAGCCGACATTTATATCAAGCCACTTGGCGCTAAGACCATCTAGATGTCTTCTGCACGAACCGGC
GCGACCCCAATATTTCGGATACCTCGTCATATCTGGATCTCGCTCCTCTGTATGGTTCCAGCTATGAAGACCAGCTGAGGGTCCGCACTATGCAACGCGGGATGCTCAAGCCCGACACTT
TTCACGAGAAGAGGCTGTTGGGTCAGCCCCCTGGTGTCAACGTTATTCTTGTCATGTACAATCGTTTCCACAACTACGTGGCCGATGTCCTGCTGAAGATAAATGAGAATGGGCGCTTCA
CTCTACCGCCAACAACATCAGAGGACGCAAAGCGGAAAGCACTAGCCAAGCAAGATGAAGACTTATTCCAGGTGACTCGCCT
GTAAGTTGATCTCTTACATTTGTCCATGACTGTTGTAT
GGTTGGGAACAACTCAGCTGATACTGGGATAGTATTGTGAATGGGCTCTACGTAAACATCTCACTGCACGATTACCTTCGTGGACTGACCAACACTCATCACTCGGCGAGTGACTGGACA
CTGGACCCTCGTGTGGCCGTGAGTCGAGCTTTCGACGCTGATGGGGTTCCCCGAGGCGTGGGAAACCAGGTCTCTGCAGAGTTCAACCTCCTATATCGCTTCCACTCTGTTATTTCCCGG
CGGGATGAACAATGGACAAACGAGTTCCTGAAAAGTCTGTTTCCTGACCTCAAGAAACCACTGGAGCAACTTACACCACAAGAGTTCATGCAAGGTTTGATAAATTACGAACGAAGCATC
GATAAAGACCCCAGTAAGCGGGAATTTGGTGGGCTGAAACGCAACCAGGATGGGAGGTTCAATGATGCCGAATTAGTACAGATCCTGAAGGACAGCATGGAAGATCCAGCCGGACTGTTT
GGAGCTAGGATGGTTCCCAAGGCACTCCGCATGGTCGAGATTGCTGGCATCCTCACTGCTCGCAAGTGGAATCTCGCATCCTTGAATGAGATGCGCGACTTCTTCAAACTAAAACGGCAT
TCATCATTTGAGGACATTAACCCTGATCCTAAAATTGCCGATCTCCTGCGGAAGCTGTACGACCATCCGGACATGGTCGAGATGTATCCCGGGATCTTCTTGGAGGATGCCAAACCTGCC
ATGGATCCGGGTTGCGGTGGATGCCCTCCCTACACTGTTGGGCGAGCGGTCTTTAGCGATGCAGTTACTCTCGTTCGATCAGACCGATTTTTGACTCTG
GTCAGTTAAATCTCTTCTTCT
AATCTGCCGCTTTCGAGTGGACGAGCTAACAGGAAGCTAGGATTACACTGCGTCTAACCTCACTAATTGGGGCATTCGGGAAGTTCAACAAGACTACGATATGTGAGTATCCGCGGAAGC
AACTTGATCCATAACCATTGGCTTAGTCTGATACATCATAGCTTGGGAGGCTCAATGTTCCACAAATTGATCCAACGCGCACTGCCTGGATGGTTCCCTTACAACTCGCTCCACGCAACC
CAGCCAATGTTCACCCGTAAAATGAACGAACAAATTGCGAAAGAGATTGGAACAATAGATAGATACAGTCAAGAGGATCCAAAACCGCCACCCCGTACGGTCATGCTCGCCAATCATGCC
ACCATCATTGAGGTATTGAAAGACCAGGACACATTCCGCGTCCCATGGGCCCGATATCTCAATGATATGATACCGGGCAAGAGGTTCAATGACTATATGTTAGGAGGAGACGGTCCGGTT
AATGCAGCGCAAAAGAAGCTCGTCAAGTCCATTCTGTTTAGTCCGGATCAGTTCAACCAATTGCTTTCGCAGACGACTGTTAGGCTAGGCAAAGAGCTTCTAGAACTGAACACCCTGCAG
CTGTCCAAGGATCTGAATCAAGTCGATATCATTCGAGA
GTGAGTTGATCTATCTCCTGACACTCATAGGAACTCATCACAACTGGAGGCTTACTGACACAATCTAGCGTTGCTATCCCCC
TCAATGCAAGAATAATGGCGGACCTCTTCTGCCTGGACATGAAGACCCCGGAAAATGAATCCGGCAGCATGAACGCAGCAACGGTGTACAAACACCTCATGAATGTCCGCACTTGGGGCT
TTAACAACACCGACCCAGGATTGATGTTGCAACGCAGAAAATGGGCCTCTGAAAGCGCCGAGGCCCTTGTCAAGACTACTCTCAAGGTCGTCAACGAACAAGCCCAGCCGCAGAAAACCC
ACATGCTTAAAAAGTTGACTGGCTATCAGCGGTCGGAAGTCAGTACCCTGCGTTGGTATGGAAACAACGTAGTCAAGCAAATGATGGAGATGGACATGACTGCGGCTGAGACAGCGGAAG
TTTGCTGGCTTACAGCAGTTGGGGGTGTTGGAGCACCTGTTGGACTG
GTTCGTATTTCTTCTAATCCCCGACACAGCGACACATGCTCTTCTAACATAATCCCCATCAACTAGGTCGCCG
ACGTCCTACAATATTACCTCCGACCGGAAAACATCGACCACTGGAAAAGGATCCAGAATCTCGTTTCCCAACCGGACAACAGTGGCTCCATCGACAAGCTTCTCCGACAATACGTGCTCG
AAGCGCAACGTCTAACCAGCATGGAATGCACCGTTCGCGTCTGCAGAGCCCATCGCACCATCAATGATCAGGAATTCAAGCCAGGCGACGTAGTCATCACTCTCCTC
GTAAGTAGCCCAC
CTCACATCTCCTCCTCCACCTTGAATGTCTAACTAACCCCATCCAGGGCCCAGCCTGCCGCGACCCAACCAGCATCCCCGACGCGGAAACATTCAAGCTCGACCGACCCTCAAACGCATA
CATCCACTTCGGCTACGGCGCTCACGAGTGCCTAGGCAAGGAAATCGGATTGACATTCGCTGTCTCCATGCTGCGAGTCCTAGCAGGATTGAAATACCTGAGACCAGCACCAGGCGATAT
GGGAATGCTGAAAAGCATCATCGTCGACGGGAGACGGGTCTATTTGAATGATAGTTGGTCGTGGATGATTCAGGATCCGACTA
GTAAGTACACACCTACGAGCGCCAAAACCCAATACTC
TACTAACAACTCCCCTCATAGCATGGAAACTCCACTTCGCAGGATACGGCCAAGGCGCATACGAAGCCCCAGCACCACCCCCACCGGCACCAACCTTCCCTGTCATCGACCAGAGCCCTG
ATACCAGCGACGAGGACGGTGTCGACGATACAATCTACTCCACTGTACCTACTAAGCATCATCACCATGGAGATCCAGAATATACAAGACAGGAAAGCTACACCATGACAGACGGCGGAA
TTGGCATGTCGACTCAGTATTCGTTCGGACAGCACCATCACCATCAGTATCATGAGATAACTAGGACGTCTTCCTCGTCATTGCCATCTATGCTTGGGGATGATGAGAGTTATGGGAGGT
TTTCGGGGACTTTGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCTCCATTTTCATTGCTCTTCTCCTTTGCCTTCTATCTTATCTCTACCTGCGGGTCTTTGCAGATGACCTGACACGACCTCTTCAAATACTTGCCAAGTTTTTCTCTTCCCATCAA
CACCCGACATGGAAGCTAAGGCCTCGTTTCCTTCCAAAGGCCACAAGAGCGGCTCTATCCAGCATTGCCGGAACGGGAGAGGGACTCTGGCAACGACTATATGCGAGGACGTTCCATGCA
CAAGAGTTAGCAGAAGTAGAAGATGACTTGAAATATCAGGCTGGAGAGCCATATGGAGATCCCGATGTTCTTGCCACAGGCCTTGTCAAAGATCTCTCGGCCCTGGGACTTAAGGGCAAA
AGAAGCGATCTTCGTACTTTGATCCAATTAGTGAAGGCTAAAGGAAAGCCGATCGATGATCGCCAAATGCTG
ATGGAAAAAGTCATCGCCATCGTTTCGATGTTACCGCGAACCTCCAAA
TCCCGACAGAGGTTGACCGGCATCCTGGTCGACCAGCTCTGGCAGAGCCTAGAGCACCCTCCGCTGTCGTACTTTGGGAATAAGTACCAGTATCGCACTCCAGATGGGAGCTACAAC
AAC
CCTTTAGAGCCTGACCTTGGCAAAGCAGGCAGTCCGTATGCGAGATCAGTGCCCCGGCTCAAGGCCCTGCACGGAGTGCAGCCTGATCCTGGCCTTCTTTTTGACC
TCCTCATGGCCCGT
GACGACACGACTTTCCGGGAAAATCCTGCAGGCATCTCGTCGGTTCTATTCTATCATGCAAGCATCATAATTCACG
ATGTCTTCTGCACGAACCGGCGCGACCCCAATATTTCGGATACC
TCGTCATATCTGGATCTCGCTCCTCTGTATGGTTCCAGCTATGAAGACCAGCTGAGGGTCCGCACTATGCAACGCGGGATGCTCAAGCCCGACACTTTTCACGAGAAGAGGCTGTTGGGT
CAGCCCCCTGGTGTCAACGTTATTCTTGTCATGTACAATCGTTTCCACAACTACGTGGCCGATGTCCTGCTGAAGATAAATGAGAATGGGCGCTTCACTCTACCGCCAACAACATCAGAG
GACGCAAAGCGGAAAGCACTAGCCAAGCAAGATGAAGACTTATTCCAGGTGACTCGCCT
TATTGTGAATGGGCTCTACGTAAACATCTCACTGCACGATTACCTTCGTGGACTGACCAAC
ACTCATCACTCGGCGAGTGACTGGACACTGGACCCTCGTGTGGCCGTGAGTCGAGCTTTCGACGCTGATGGGGTTCCCCGAGGCGTGGGAAACCAGGTCTCTGCAGAGTTCAACCTCCTA
TATCGCTTCCACTCTGTTATTTCCCGGCGGGATGAACAATGGACAAACGAGTTCCTGAAAAGTCTGTTTCCTGACCTCAAGAAACCACTGGAGCAACTTACACCACAAGAGTTCATGCAA
GGTTTGATAAATTACGAACGAAGCATCGATAAAGACCCCAGTAAGCGGGAATTTGGTGGGCTGAAACGCAACCAGGATGGGAGGTTCAATGATGCCGAATTAGTACAGATCCTGAAGGAC
AGCATGGAAGATCCAGCCGGACTGTTTGGAGCTAGGATGGTTCCCAAGGCACTCCGCATGGTCGAGATTGCTGGCATCCTCACTGCTCGCAAGTGGAATCTCGCATCCTTGAATGAGATG
CGCGACTTCTTCAAACTAAAACGGCATTCATCATTTGAGGACATTAACCCTGATCCTAAAATTGCCGATCTCCTGCGGAAGCTGTACGACCATCCGGACATGGTCGAGATGTATCCCGGG
ATCTTCTTGGAGGATGCCAAACCTGCCATGGATCCGGGTTGCGGTGGATGCCCTCCCTACACTGTTGGGCGAGCGGTCTTTAGCGATGCAGTTACTCTCGTTCGATCAGACCGATTTTTG
ACTCTG
GATTACACTGCGTCTAACCTCACTAATTGGGGCATTCGGGAAGTTCAACAAGACTACGATATCTTGGGAGGCTCAATGTTCCACAAATTGATCCAACGCGCACTGCCTGGATGG
TTCCCTTACAACTCGCTCCACGCAACCCAGCCAATGTTCACCCGTAAAATGAACGAACAAATTGCGAAAGAGATTGGAACAATAGATAGATACAGTCAAGAGGATCCAAAACCGCCACCC
CGTACGGTCATGCTCGCCAATCATGCCACCATCATTGAGGTATTGAAAGACCAGGACACATTCCGCGTCCCATGGGCCCGATATCTCAATGATATGATACCGGGCAAGAGGTTCAATGAC
TATATGTTAGGAGGAGACGGTCCGGTTAATGCAGCGCAAAAGAAGCTCGTCAAGTCCATTCTGTTTAGTCCGGATCAGTTCAACCAATTGCTTTCGCAGACGACTGTTAGGCTAGGCAAA
GAGCTTCTAGAACTGAACACCCTGCAGCTGTCCAAGGATCTGAATCAAGTCGATATCATTCGAGA
CGTTGCTATCCCCCTCAATGCAAGAATAATGGCGGACCTCTTCTGCCTGGACATG
AAGACCCCGGAAAATGAATCCGGCAGCATGAACGCAGCAACGGTGTACAAACACCTCATGAATGTCCGCACTTGGGGCTTTAACAACACCGACCCAGGATTGATGTTGCAACGCAGAAAA
TGGGCCTCTGAAAGCGCCGAGGCCCTTGTCAAGACTACTCTCAAGGTCGTCAACGAACAAGCCCAGCCGCAGAAAACCCACATGCTTAAAAAGTTGACTGGCTATCAGCGGTCGGAAGTC
AGTACCCTGCGTTGGTATGGAAACAACGTAGTCAAGCAAATGATGGAGATGGACATGACTGCGGCTGAGACAGCGGAAGTTTGCTGGCTTACAGCAGTTGGGGGTGTTGGAGCACCTGTT
GGACTG
GTCGCCGACGTCCTACAATATTACCTCCGACCGGAAAACATCGACCACTGGAAAAGGATCCAGAATCTCGTTTCCCAACCGGACAACAGTGGCTCCATCGACAAGCTTCTCCGA
CAATACGTGCTCGAAGCGCAACGTCTAACCAGCATGGAATGCACCGTTCGCGTCTGCAGAGCCCATCGCACCATCAATGATCAGGAATTCAAGCCAGGCGACGTAGTCATCACTCTCCTC
GGCCCAGCCTGCCGCGACCCAACCAGCATCCCCGACGCGGAAACATTCAAGCTCGACCGACCCTCAAACGCATACATCCACTTCGGCTACGGCGCTCACGAGTGCCTAGGCAAGGAAATC
GGATTGACATTCGCTGTCTCCATGCTGCGAGTCCTAGCAGGATTGAAATACCTGAGACCAGCACCAGGCGATATGGGAATGCTGAAAAGCATCATCGTCGACGGGAGACGGGTCTATTTG
AATGATAGTTGGTCGTGGATGATTCAGGATCCGACTA
ACGGCGGAATTGGCATGTCGACTCAGTATTCGTTCGGACAGCACCATCACCATCAGTATCATGAGATAACTAGGACGTCTTCC
TCGTCATTGCCATCTATGCTTGGGGATGATGAGAGTTATGGGAGGTTTTCGGGGACTTTGAATTGA

Retrieve as FASTA