Entry information : AnLDS03
Entry ID 5306
Creation 2007-05-01 (Christophe Dunand)
Last sequence changes 2012-04-23 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: AnLDS03
Name AnLDS03
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus
Organism Aspergillus niger    [TaxId: 5061 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AnLDS03
start..stop
S start..stop
AteLDS03 1777 0 1..1106 1..1108
AorLDS04 1707 0 1..1108 1..1110
AflLDS04 1707 0 1..1108 1..1110
AniLDS03 1677 0 1..1110 1..1117
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2016323..2016721 399 N° 2 2016161..2016258 98 N° 3 2015863..2016104 242 N° 4 2015605..2015809 205
N° 5 2015410..2015550 141 N° 6 2015264..2015354 91 N° 7 2014882..2015212 331 N° 8 2014489..2014832 344
N° 9 2013949..2014436 488 N° 10 2013481..2013895 415 N° 11 2013192..2013428 237 N° 12 2012864..2013143 280
N° 13 2012746..2012807 62  
complement(join(2012746..2012807,2012864..2013143,2013192..2013428,2013481..2013 895,2013949..2014436,2014489..2014832,2014882..2015212,2015264..2015354,2015410. .2015550,2015605..2015809,2015863..2016104,2016161..2016258,2016323..2016721))


exon

Literature and cross-references AnLDS03
Literature Hoernsten L., Su C., Osbourn A.E., Garosi P., Hellman U., Wernstedt C., Oliw E.H. Cloning of linoleate diol synthase reveals homology with prostaglandin H synthases. J. Biol. Chem. 274:28219-28224(1999).
Protein ref. UniProtKB:   A2QDQ5
DNA ref. JGI genome:   chr_4_2 (2016721..2012746)
EST ref. GenBank:   EY248257.1 [5' end]   EY227996.1 [3' end]
Protein sequence: AnLDS03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1110
PWM (Da):   %s   124905.9  
PI (pH):   %s   6.52
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLRRFSSTFKKSSKGDRDSKPNGTQVNGQKRQSKVPAPRKSSSDESHSDHGVESDDGVSVFEKYAQVLHASRRPLPNQNGDGTYLEQEHSGSLFKDLRALGFKDIGTLKDLIKTKAKGEYIDDKTMLMERIIQLVSSLPGNSKTRVDLTNAFLDELWGSLPHPPLSYMGEEYAYRSADGSNNNPTLPWLGAAGTPYARSIAPLTIQPGGLPDAGLVFDCLFAREKFTPHPNKVSSLFFDWASLVIDIFQTDYTNSHVNKTSAYLDLSILYGDDQEDQNLVRTFKDGKLKPDTFSEQRLQAFPPACSVLMVMLSRFHNWVVEELAAINENGRFNKPDPRLDEEKARKAWEKYDNDLFQTGRLVTCGLFINITLYDYLRTIVNLNRSNSTWCLDPRVQMEGTKSTPSGLGNQCSVEFNLAYRWHSAISANDEKWTEEIYEELMGKPASEVSMRELLVGLGKYEREIPKDPSKRTFAGLKRQEDGTFKDEDLVRILANAIEDVSSFGARNVPKVLRSVEILGIEQGRKWNVGSLNEFRKFFDLKPYETFEEINSDPDVADSLRHLYEHPDYVELYPGIVAEEAKEPMIPGVGIAPTYTISRAVLSDAVALVRGDRYYTIDYNPRNLTNWGYNEVRYDLNINQGCVFYKLAMRAFPNYFKPDSIYAHYPMTIPSENRNIMKNLGRESHYSYDRPRYTEPVPNLLSYANAKLVLNNQKDFTVPWGGLSSIHAGKGGADFWSKSFDNEQWRNSVKEFYEDATLKLLNEKSCKLAGNKQVDIADVGNLVPVHFVSKVFSLPLKTNSNPRGIFTEHEMFMIMAVVFTSTFFDVDPTKSFPLQHAARAVSQELGKVVEAHVKSINHPGFLHGIIDSFRDDHNALKDYGDQLIKRLLESGLGVSDVTWGQILPAAVEMVHTQSQMFTQIIHFYLTEGQKYLPEINRLANENTAEANDRLTRFCLEAVRLNGNLGIYREAQADINVSDETGQYSVKSGEKVFVGSSKANRDPQAFPSPDEVRLDRPLDSYLHYGLGPQSGLGKDATLAAVTAMVRVVARLDTLRPAPGAQGQLKKIPQEAGFSVYMREDYGSYSPFPTYKVHYNGDVPAPKRQVTTA

Retrieve as FASTA  
Remarks Complete sequence from genomic (12 introns) and 7 ESTs. Strain="CBS 513.88". Fusion of peroxidase domain with CypX (cytochrome P450).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGCGCCGATTCTCTTCGACATTCAAGAAATCGTCGAAAGGCGATCGCGATTCGAAACCGAATGGCACACAGGTGAACGGCCAGAAGCGCCAGTCGAAAGTGCCGGCGCCGCGCAAA
TCCTCCTCAGATGAGAGCCACAGCGATCACGGTGTGGAAAGCGATGACGGCGTGTCCGTCTTTGAGAAATATGCCCAGGTCTTGCATGCGTCCCGGCGCCCACTACCGAACCAGAACGGC
GATGGCACCTATCTCGAGCAAGAGCACTCGGGGAGCTTGTTCAAGGACCTGCGCGCCTTGGGCTTCAAGGACATCGGAACCCTGAAGGATCTAATCAAAACGAAGGCCAAGGGAGAATAC
ATTGATGACAAGACCATGCTCATGGAGCGGATCATTCAG
GTGAGTCGTAGCGCTTGGGATCTCTTTTTGACCGGCATGGATGCTAATTGACTCTTTCCGACAGCTTGTCAGCAGTCTCCC
AGGAAACTCGAAAACCCGCGTCGACCTCACCAACGCCTTCTTGGATGAACTGTGGGGTTCCTTGCCTCACCCTCCTCTGTC
GTAAGTTGAGGCTCGATATCGGTCCCGTGGTTTGCGCTG
GCGCTAATACTCTGCAGTTACATGGGAGAGGAATATGCCTACCGGTCAGCAGATGGTTCCAACAACAATCCTACACTTCCCTGGCTAGGCGCTGCGGGGACACCTTACGCTCGCTCAATC
GCTCCTCTGACTATTCAGCCCGGCGGTTTGCCCGATGCCGGTCTTGTCTTTGACTGTCTTTTCGCGCGCGAGAAGTTTACCCCTCACCCTAACAAGGTGTCGAGTCTTTTCTTCGACTGG
GCATCCCTCGTCATTCATG
GTTCGCTAAATCTTTCTAAAAACATCACAGCAGAACGCTGATTAAGAATCTAGACATTTTCCAGACTGATTACACAAATTCTCACGTCAACAAGACCTCAG
CCTATCTCGATCTTTCGATCCTGTACGGCGATGATCAGGAAGACCAGAACTTGGTTCGTACTTTCAAGGACGGCAAACTGAAGCCTGATACCTTTTCGGAACAGCGGCTCCAGGCTTTCC
CGCCGGCCTGCTCCGTGTTGATGGTCATGCTAAGCAG
GTTCGCAATACGTTTCCCAGTATACTAGAAAGTTCTAACCGGGTCACCAAATAGATTCCACAATTGGGTCGTGGAGGAGCTGG
CAGCGATCAATGAAAACGGTCGCTTCAACAAGCCCGATCCTCGTCTCGACGAAGAGAAAGCTAGGAAGGCCTGGGAAAAGTATGACAACGATCTTTTCCAGACCGGACGACT
GTATGCCA
TCCTGCAATCTTCATCACTACAAGCATGCAAATCTGACGCTTCACAGGGTAACATGCGGTCTGTTCATCAACATCACGCTATACGATTATCTGCGCACCATTGTCAACCTGAACCGCAGC
AACAGCACATGGTGTCTG
GTAAGCAAAGATAGATGGAAAAGCAAAGCGTGCCAAGCTGACCAGCCACAGGATCCCAGAGTTCAGATGGAGGGCACCAAGAGTACCCCATCGGGTCTCGGT
AACCAGTGCTCCGTCGAATTCAACCTCGCGTATCGCTGGCATTCTGCTATTAGTGCCAATGATGAAAAGTGGACTGAAGAGATCTACGAAGAGCTGATGGGCAAGCCTGCCTCGGAGGTC
TCCATGCGTGAGCTTCTCGTTGGACTTGGCAAGTATGAGAGAGAGATCCCGAAAGACCCGTCAAAGCGCACATTTGCCGGTCTGAAGCGACAGGAAGATGGAACATTCAAGGACGAGGAT
CTCGTTAGAATCCTGGCCAATGCGATTGAGGATGTTGCCA
GTGAGTGTAGCTTCACCAAACAAAATAGCCACTTAACTTACCATTGCAGGCTCCTTCGGTGCACGGAATGTGCCCAAGGT
CTTGAGATCTGTGGAAATTCTTGGTATTGAGCAGGGTCGCAAGTGGAACGTCGGCTCTCTGAACGAATTCCGCAAGTTCTTCGATCTCAAGCCATACGAAACGTTCGAAGAGATCAACTC
TGACCCGGATGTCGCTGACTCCTTGCGTCACCTGTACGAGCACCCAGACTATGTGGAACTCTACCCTGGTATTGTCGCCGAGGAAGCGAAGGAGCCTATGATCCCTGGTGTTGGTATTGC
ACCTACCTACACCATCTCCCGCGCAGTTCTCTCCGATGCTGTGGCTCTCGTCCGTGGTGACAGATACTATACC
GTCAGTCTTGACCCAGCATGCCTGCAAGAATCGCTATTAACTATATG
TCCAGATCGACTACAACCCACGCAACCTTACGAACTGGGGATACAATGAGGTCCGCTACGATCTCAACATCAACCAGGGATGTGTGTTCTACAAGCTCGCCATGCGGGCCTTCCCCAACT
ACTTCAAGCCTGACTCCATCTACGCACACTACCCAATGACCATCCCCAGCGAGAACAGGAATATCATGAAGAACCTCGGTCGCGAGTCCCACTATTCGTACGACAGACCCCGTTACACGG
AGCCTGTTCCGAACCTGTTGTCCTACGCCAACGCCAAATTAGTCTTGAACAACCAGAAAGACTTCACTGTGCCTTGGGGTGGACTCAGCTCGATCCATGCCGGAAAGGGAGGCGCTGACT
TCTGGAGCAAGTCATTCGATAATGAGCAGTGGAGAAATAGCGTGAAGGAATTTTACGAGGATGCTACCTTGAAGCTACTCAACGAGAAGTCTTGCAAACTTGCTGGCAACAAGCAGGTTG
ACATTGCAAGGGA
GTAAGTCGTCTGGGCCGAAGTAATGTATTATACCCATGCTAACGAGATTACAGCGTCGGAAACCTCGTGCCTGTGCATTTCGTCTCCAAGGTCTTCTCGCTGCCCCT
GAAGACGAACAGCAATCCCCGCGGGATCTTTACCGAACATGAGATGTTCATGATCATGGCGGTGGTCTTCACTTCCACCTTCTTCGATGTTGACCCTACCAAGTCCTTCCCGCTCCAGCA
TGCAGCCCGCGCGGTTTCCCAGGAGCTGGGTAAGGTTGTGGAAGCCCATGTCAAGTCCATCAACCACCCTGGCTTCCTTCATGGTATCATCGATAGCTTCCGCGACGACCACAATGCCTT
GAAAGACTACGGAGATCAGCTGATCAAGCGCCTTTTGGAAAGTGGTCTGGGAGTCTCCGATGTGACCTGGGGCCAGATCTTGCCGGCAGCTGTCGAGATGGTTCACACTCAGTCGCAAAT
G
GTAGGTTTCCTCATGCTGCATGTCGTTGCATATGATGCTGACATTCCAATAGTTCACCCAGATCATCCACTTCTACCTTACCGAAGGTCAGAAGTATCTCCCGGAAATCAACCGCCTGG
CCAACGAGAACACTGCGGAGGCTAATGACAGGCTCACCCGCTTTTGCCTGGAGGCTGTCCGCCTGAACGGCAATCTGGGCATCTACCGCGAGGCCCAGGCCGATATCAACGTGTCTGATG
AGACCGGCCAATACAGCGTCAAATCGGGAGAGAAGGTGTTTGTCGGCTCG
GTACGTATCACCCGGTTGTAAACCACTGCTATTACTAATACCATATAGTCGAAGGCAAACCGTGACCCTC
AGGCCTTCCCATCGCCTGATGAGGTTCGCCTTGACCGCCCTCTCGACTCCTACCTACACTATGGTCTTGGCCCCCAGAGTGGCCTGGGTAAGGATGCCACCCTCGCCGCGGTGACCGCCA
TGGTGCGGGTTGTCGCCCGCCTGGACACTCTCCGCCCTGCTCCTGGCGCTCAAGGGCAGTTGAAGAAGATTCCCCAGGAAGCTGGGTTCTCCGTATACATGCGGGAGGACTACGGCAGCT
ACTCCCCGTTCCCGACTA
GTGAGTATTCCTTTAACTTCTCTGCGTGAAATCTTGCTAACCTGGATTTGCTTCAGCCTACAAAGTCCACTACAACGGCGATGTGCCGGCGCCTAAGCGACA
GGTCACGACTGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGCGCCGATTCTCTTCGACATTCAAGAAATCGTCGAAAGGCGATCGCGATTCGAAACCGAATGGCACACAGGTGAACGGCCAGAAGCGCCAGTCGAAAGTGCCGGCGCCGCGCAAA
TCCTCCTCAGATGAGAGCCACAGCGATCACGGTGTGGAAAGCGATGACGGCGTGTCCGTCTTTGAGAAATATGCCCAGGTCTTGCATGCGTCCCGGCGCCCACTACCGAACCAGAACGGC
GATGGCACCTATCTCGAGCAAGAGCACTCGGGGAGCTTGTTCAAGGACCTGCGCGCCTTGGGCTTCAAGGACATCGGAACCCTGAAGGATCTAATCAAAACGAAGGCCAAGGGAGAATAC
ATTGATGACAAGACCATGCTCATGGAGCGGATCATTCAG
CTTGTCAGCAGTCTCCCAGGAAACTCGAAAACCCGCGTCGACCTCACCAACGCCTTCTTGGATGAACTGTGGGGTTCCTTG
CCTCACCCTCCTCTGTC
TTACATGGGAGAGGAATATGCCTACCGGTCAGCAGATGGTTCCAACAACAATCCTACACTTCCCTGGCTAGGCGCTGCGGGGACACCTTACGCTCGCTCAATC
GCTCCTCTGACTATTCAGCCCGGCGGTTTGCCCGATGCCGGTCTTGTCTTTGACTGTCTTTTCGCGCGCGAGAAGTTTACCCCTCACCCTAACAAGGTGTCGAGTCTTTTCTTCGACTGG
GCATCCCTCGTCATTCATG
ACATTTTCCAGACTGATTACACAAATTCTCACGTCAACAAGACCTCAGCCTATCTCGATCTTTCGATCCTGTACGGCGATGATCAGGAAGACCAGAACTTG
GTTCGTACTTTCAAGGACGGCAAACTGAAGCCTGATACCTTTTCGGAACAGCGGCTCCAGGCTTTCCCGCCGGCCTGCTCCGTGTTGATGGTCATGCTAAGCAG
ATTCCACAATTGGGTC
GTGGAGGAGCTGGCAGCGATCAATGAAAACGGTCGCTTCAACAAGCCCGATCCTCGTCTCGACGAAGAGAAAGCTAGGAAGGCCTGGGAAAAGTATGACAACGATCTTTTCCAGACCGGA
CGACT
GGTAACATGCGGTCTGTTCATCAACATCACGCTATACGATTATCTGCGCACCATTGTCAACCTGAACCGCAGCAACAGCACATGGTGTCTGGATCCCAGAGTTCAGATGGAGGGC
ACCAAGAGTACCCCATCGGGTCTCGGTAACCAGTGCTCCGTCGAATTCAACCTCGCGTATCGCTGGCATTCTGCTATTAGTGCCAATGATGAAAAGTGGACTGAAGAGATCTACGAAGAG
CTGATGGGCAAGCCTGCCTCGGAGGTCTCCATGCGTGAGCTTCTCGTTGGACTTGGCAAGTATGAGAGAGAGATCCCGAAAGACCCGTCAAAGCGCACATTTGCCGGTCTGAAGCGACAG
GAAGATGGAACATTCAAGGACGAGGATCTCGTTAGAATCCTGGCCAATGCGATTGAGGATGTTGCCA
GCTCCTTCGGTGCACGGAATGTGCCCAAGGTCTTGAGATCTGTGGAAATTCTT
GGTATTGAGCAGGGTCGCAAGTGGAACGTCGGCTCTCTGAACGAATTCCGCAAGTTCTTCGATCTCAAGCCATACGAAACGTTCGAAGAGATCAACTCTGACCCGGATGTCGCTGACTCC
TTGCGTCACCTGTACGAGCACCCAGACTATGTGGAACTCTACCCTGGTATTGTCGCCGAGGAAGCGAAGGAGCCTATGATCCCTGGTGTTGGTATTGCACCTACCTACACCATCTCCCGC
GCAGTTCTCTCCGATGCTGTGGCTCTCGTCCGTGGTGACAGATACTATACC
ATCGACTACAACCCACGCAACCTTACGAACTGGGGATACAATGAGGTCCGCTACGATCTCAACATCAAC
CAGGGATGTGTGTTCTACAAGCTCGCCATGCGGGCCTTCCCCAACTACTTCAAGCCTGACTCCATCTACGCACACTACCCAATGACCATCCCCAGCGAGAACAGGAATATCATGAAGAAC
CTCGGTCGCGAGTCCCACTATTCGTACGACAGACCCCGTTACACGGAGCCTGTTCCGAACCTGTTGTCCTACGCCAACGCCAAATTAGTCTTGAACAACCAGAAAGACTTCACTGTGCCT
TGGGGTGGACTCAGCTCGATCCATGCCGGAAAGGGAGGCGCTGACTTCTGGAGCAAGTCATTCGATAATGAGCAGTGGAGAAATAGCGTGAAGGAATTTTACGAGGATGCTACCTTGAAG
CTACTCAACGAGAAGTCTTGCAAACTTGCTGGCAACAAGCAGGTTGACATTGCAAGGGA
CGTCGGAAACCTCGTGCCTGTGCATTTCGTCTCCAAGGTCTTCTCGCTGCCCCTGAAGACG
AACAGCAATCCCCGCGGGATCTTTACCGAACATGAGATGTTCATGATCATGGCGGTGGTCTTCACTTCCACCTTCTTCGATGTTGACCCTACCAAGTCCTTCCCGCTCCAGCATGCAGCC
CGCGCGGTTTCCCAGGAGCTGGGTAAGGTTGTGGAAGCCCATGTCAAGTCCATCAACCACCCTGGCTTCCTTCATGGTATCATCGATAGCTTCCGCGACGACCACAATGCCTTGAAAGAC
TACGGAGATCAGCTGATCAAGCGCCTTTTGGAAAGTGGTCTGGGAGTCTCCGATGTGACCTGGGGCCAGATCTTGCCGGCAGCTGTCGAGATGGTTCACACTCAGTCGCAAATG
TTCACC
CAGATCATCCACTTCTACCTTACCGAAGGTCAGAAGTATCTCCCGGAAATCAACCGCCTGGCCAACGAGAACACTGCGGAGGCTAATGACAGGCTCACCCGCTTTTGCCTGGAGGCTGTC
CGCCTGAACGGCAATCTGGGCATCTACCGCGAGGCCCAGGCCGATATCAACGTGTCTGATGAGACCGGCCAATACAGCGTCAAATCGGGAGAGAAGGTGTTTGTCGGCTCG
TCGAAGGCA
AACCGTGACCCTCAGGCCTTCCCATCGCCTGATGAGGTTCGCCTTGACCGCCCTCTCGACTCCTACCTACACTATGGTCTTGGCCCCCAGAGTGGCCTGGGTAAGGATGCCACCCTCGCC
GCGGTGACCGCCATGGTGCGGGTTGTCGCCCGCCTGGACACTCTCCGCCCTGCTCCTGGCGCTCAAGGGCAGTTGAAGAAGATTCCCCAGGAAGCTGGGTTCTCCGTATACATGCGGGAG
GACTACGGCAGCTACTCCCCGTTCCCGACTA
CCTACAAAGTCCACTACAACGGCGATGTGCCGGCGCCTAAGCGACAGGTCACGACTGCTTGA

Retrieve as FASTA