Entry information : NcLDS01
Entry ID 5308
Creation 2007-05-01 (Christophe Dunand)
Last sequence changes 2007-05-01 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2012-04-25 (Catherine Mathe (Scipio))
Peroxidase information: NcLDS01
Name NcLDS01
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Sordariaceae Neurospora
Organism Neurospora crassa    [TaxId: 5141 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value NcLDS01
start..stop
S start..stop
CgLDS01 1482 0 35..1134 27..1099
AalcLDS01 1280 0 6..1134 8..1120
MgrLDS01 1261 0 49..1134 31..1108
GzLDS01 1182 0 76..1134 57..1105
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 174495..174813 319 N° 2 174877..175115 239 N° 3 175174..177702 2529 N° 4 177781..178098 318
join(174495..174813,174877..175115,175174..177702,177781..178098)


exon

Literature and cross-references NcLDS01
Literature Galagan J.E., et al., The genome sequence of the filamentous fungus Neurospora crassa. Nature 422:859-868(2003).
Protein ref. UniProtKB:   Q7S550
DNA ref. JGI genome:   supercont10.7 (174495..178098)
Protein sequence: NcLDS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1134
PWM (Da):   %s   125804.58  
PI (pH):   %s   7.18
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSHQNGTNGHSASTSDNGKESKSRNVIGPDPKAERTASMAKPRPTSMKLPFTGASRQGVENAFERHRQTIQSAVQPLPTQQGAGTFSENKKWGKLSSDLMTLRWADIKTLKHMVVAKIKGERLADDKTMIMEKVIQLVSNLPSNSKLRVELTNGFLGELWYTLEHPPSIYVGEYYQYRKADGSCNIMFPQLGAAGTTYARSVRPNVIRQGALPDPELIFDSVMKRTEYKSHPNNVSSILWYWASIIIHDLFWTDYRDMSKSKTSSYLDLSPLYGSNQDMQDTIRTFKDGKLKVDCYADKRLLGMPPGVSVLLIFFNRFHNYTCDNLIAINEDGRFNKPSPKLEGEKAEAAWKKYDNDLFQTARLITSGLYINITLLDYVRNIVNLNRVDTTWTLDPRADTGIDVGTKDGAERGTGNVVSAEFNLCYRWHSCISAKDEAWIEDFYYELFGKPGSDLSFHELIMGFGKFEGGIPADPADRPIRKDKGHFSRDANGKISDDELAECIADAIEDPAGSFGAKNVPPSMRAVEILGIIQGRKWNLAGLNEFRKHFGLKPYETFEDINSDPGVSEALRRLYDHPDFVELYPGIVAEEHKSPMVPGVGIAPTYTISRVVLSDAVCLVRGDRHYTIDYNPRNLTNWGYNEVQYDLNLKHGCVFYKLFMRALPNHFKENSVYAHYPMVTPAENKKILTDLKRDHLFDWARPTRQPKPHQVKTHAGAQHVLDNDKEGTSGAYMSSWHAGLESLLGKPLSNNNPDAHDSQRRDIHEQLYSAEWADQVKAFFAQTTDALLAGESYNVGGHLLVDLVRDVGNIVPTLFAAKVFGISLQTKNNTNGLYTPQELYAVLAVIFAAIFYDHDPVKTHQLRDAARTVATQLGTALESAVKSQTSFFGSLLGGGGSGSNNNALTAYGNDLVKRLSKAGLSASDVAFGQVLPIVASSVPSIAEAFASAADFYLGEKGQAHLGAIQELARQPASASADAQLLGYVLEGIRLSGNALGAFRQASAVDAIKEEDGSEVRVQPGDRVFVSVKSAAQSPTTFPSPEEVNPSRPLEAYKIFFFGTHSYLGHEVSQIALREMFRSLFKRSNVRRAPGPQGQLKKITRELNEELSQTFYLREDWGAVTPFPVTMKVTWDE*

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 7, 3 introns) and 10 ESTs. Strain="ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987" and "wild type". Regions: 178-645 peroxidase domain; 692-1101 "CypX" Cytochrome P450
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAGCCATCAGAATGGCACAAACGGCCACTCGGCCAGCACCAGCGACAATGGCAAGGAGTCCAAGAGTCGAAACGTCATCGGCCCCGACCCCAAGGCCGAGAGGACGGCTAGCATG
GCCAAGCCCAGACCTACCTCGATGAAGCTTCCCTTTACCGGCGCCAGCCGACAAGGAGTAGAGAATGCGTTTGAGAGGCACAGGCAGACCATCCAGTCCGCTGTCCAGCCGCTGCCTACC
CAGCAAGGCGCGGGCACTTTCAGCGAGAACAAGAAATGGGGCAAGCTCAGCAGTGACTTGATGACCCTTCGATGGGCAG
GTAAGTTGTGTCTGTCGTCATCACGGGATTATGGCCAGCCA
ATGCTAACAACATGCCTACCAGACATCAAGACCCTGAAGCACATGGTAGTGGCCAAGATCAAGGGCGAGAGGCTCGCAGATGACAAGACCATGATCATGGAAAAGGTCATCCAGCTGGTC
TCTAACCTCCCCAGCAACTCCAAGCTACGAGTCGAGTTGACCAACGGCTTCTTGGGTGAGCTGTGGTACACACTCGAGCATCCTCCCTCGATATACGTGGGCGAGTATTACCAGTACAGA
AAGGCCGATGGTTCTTGCAAC
GTATGTATTGTCCTCATCAACCCCAAGAACTTGACAGATTGCTGACACATGGATACAGAACATCATGTTCCCCCAGCTCGGTGCTGCCGGCACCACGTA
TGCGCGGTCTGTGAGGCCCAACGTCATCAGGCAGGGCGCTCTTCCCGACCCGGAACTCATCTTCGACTCGGTCATGAAGCGCACCGAGTACAAGTCGCACCCCAACAACGTGTCCAGCAT
CCTGTGGTACTGGGCCAGCATCATCATCCACGATCTGTTCTGGACCGACTACCGTGACATGAGCAAGTCCAAGACGTCTTCCTACCTCGACCTGTCGCCGCTGTACGGCAGCAACCAGGA
CATGCAGGACACGATCCGTACCTTCAAGGACGGTAAGCTCAAGGTGGACTGCTACGCCGACAAGCGCCTGCTGGGCATGCCTCCCGGCGTCAGCGTGCTGCTCATCTTCTTCAACCGGTT
CCACAACTACACGTGCGACAACCTGATTGCCATCAACGAGGACGGCCGGTTCAACAAGCCGTCGCCCAAGCTCGAGGGCGAGAAGGCTGAGGCGGCGTGGAAGAAGTACGACAACGACTT
GTTCCAGACGGCCAGACTCATCACTTCGGGTCTGTACATCAACATCACCCTGCTCGACTACGTGCGCAACATTGTCAACCTCAACCGGGTCGACACCACGTGGACGCTCGACCCCCGTGC
CGACACGGGCATTGACGTGGGCACCAAGGACGGTGCGGAGCGCGGTACCGGCAACGTGGTCTCGGCCGAGTTCAACCTTTGCTACCGGTGGCACTCGTGCATCTCGGCCAAGGACGAGGC
CTGGATCGAGGATTTCTACTACGAGCTCTTTGGCAAGCCCGGCAGCGACCTCAGCTTCCACGAGCTGATCATGGGCTTCGGCAAGTTTGAGGGCGGGATTCCTGCGGATCCGGCCGACCG
GCCCATTCGCAAGGACAAGGGCCACTTCAGCCGCGACGCCAACGGCAAGATCAGCGACGACGAGCTGGCCGAGTGCATCGCCGACGCCATTGAGGATCCCGCCGGTTCCTTTGGCGCCAA
GAACGTGCCTCCTTCCATGCGGGCCGTCGAGATCCTCGGTATCATCCAGGGCCGCAAATGGAACCTGGCCGGCCTGAACGAGTTCCGCAAGCACTTTGGCCTCAAGCCGTACGAGACCTT
TGAGGACATCAACTCGGACCCGGGTGTGTCCGAGGCTCTTCGTAGGCTGTACGACCACCCGGACTTTGTCGAGCTGTACCCTGGTATCGTCGCTGAAGAGCACAAGTCGCCCATGGTTCC
CGGCGTGGGCATCGCGCCGACCTACACCATCTCGCGCGTGGTGCTGTCGGACGCCGTCTGTCTCGTCCGTGGCGACCGCCACTACACCATCGACTACAACCCGCGCAACCTGACCAACTG
GGGCTACAACGAGGTGCAGTACGACCTGAACCTCAAACACGGCTGCGTCTTCTACAAGCTCTTCATGCGCGCCCTGCCCAACCACTTCAAGGAAAACTCGGTGTATGCGCACTACCCGAT
GGTAACCCCCGCAGAGAACAAGAAGATCCTCACGGACCTCAAGCGCGACCACCTCTTTGACTGGGCCCGGCCCACCCGCCAACCCAAGCCGCACCAGGTGAAGACGCACGCGGGCGCCCA
GCACGTGCTCGACAACGACAAGGAGGGCACGAGCGGCGCGTACATGTCCTCATGGCACGCCGGTCTCGAGTCCCTCCTCGGCAAACCCCTCAGCAACAACAACCCCGACGCCCACGACAG
CCAACGCCGCGACATCCACGAGCAGCTGTACAGCGCCGAGTGGGCCGACCAAGTCAAGGCCTTTTTCGCGCAGACCACTGACGCCCTCCTGGCCGGGGAGAGCTACAACGTCGGCGGCCA
CCTGCTCGTCGACCTCGTCCGCGACGTTGGCAACATTGTGCCTACCCTGTTCGCCGCCAAGGTGTTTGGCATTTCCCTGCAGACCAAGAACAACACCAATGGGCTGTACACTCCGCAGGA
ACTGTATGCCGTGCTAGCTGTCATTTTCGCCGCCATCTTCTACGACCACGACCCCGTCAAGACGCATCAGCTGCGTGACGCGGCCCGCACGGTGGCGACGCAGCTCGGTACCGCTTTGGA
GAGCGCCGTCAAGAGCCAGACTTCCTTCTTTGGGTCGCTTCTTGGTGGTGGTGGTAGCGGTAGCAACAATAACGCGCTGACTGCGTATGGCAACGACCTCGTCAAGCGGTTGTCCAAGGC
TGGGCTGAGCGCGTCGGATGTTGCGTTTGGTCAGGTGTTGCCGATCGTGGCGTCGAGCGTGCCGAGTATTGCCGAGGCGTTCGCGAGCGCGGCGGACTTTTATCTCGGTGAGAAGGGACA
GGCGCACTTGGGTGCCATTCAGGAGCTGGCGAGGCAGCCGGCGAGTGCGAGCGCGGATGCGCAGTTGCTTGGGTACGTGTTGGAGGGCATTCGGTTGTCGGGCAACGCTTTGGGGGCGTT
CAGGCAGGCGAGTGCGGTGGATGCCATCAAGGAGGAGGATGGCAGCGAGGTGAGGGTGCAGCCTGGTGATAGGGTGTTTGTTAGCGTG
GTAAGTTTTGATCTCCCTTCCCTTTTCCCCCT
CTCGTTACCTAGTGATGGAAGAAATGATACTAACAGACGAAAACAGAAATCCGCGGCCCAGTCACCAACCACCTTCCCCAGCCCCGAGGAAGTCAACCCGTCCCGCCCGCTGGAGGCCTA
CAAAATCTTCTTCTTCGGCACGCACTCGTACCTTGGTCACGAGGTCAGCCAGATTGCGCTTAGGGAAATGTTCCGCAGCTTGTTCAAGCGGAGCAACGTCCGTCGGGCGCCCGGCCCCCA
GGGCCAGCTGAAGAAGATCACGAGGGAGTTGAATGAGGAGCTGAGCCAGACGTTCTACCTCCGCGAGGACTGGGGTGCTGTGACGCCGTTCCCCGTGACCATGAAGGTTACTTGGGATGA
GTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAGCCATCAGAATGGCACAAACGGCCACTCGGCCAGCACCAGCGACAATGGCAAGGAGTCCAAGAGTCGAAACGTCATCGGCCCCGACCCCAAGGCCGAGAGGACGGCTAGCATG
GCCAAGCCCAGACCTACCTCGATGAAGCTTCCCTTTACCGGCGCCAGCCGACAAGGAGTAGAGAATGCGTTTGAGAGGCACAGGCAGACCATCCAGTCCGCTGTCCAGCCGCTGCCTACC
CAGCAAGGCGCGGGCACTTTCAGCGAGAACAAGAAATGGGGCAAGCTCAGCAGTGACTTGATGACCCTTCGATGGGCAG
ACATCAAGACCCTGAAGCACATGGTAGTGGCCAAGATCAAG
GGCGAGAGGCTCGCAGATGACAAGACCATGATCATGGAAAAGGTCATCCAGCTGGTCTCTAACCTCCCCAGCAACTCCAAGCTACGAGTCGAGTTGACCAACGGCTTCTTGGGTGAGCTG
TGGTACACACTCGAGCATCCTCCCTCGATATACGTGGGCGAGTATTACCAGTACAGAAAGGCCGATGGTTCTTGCAAC
AACATCATGTTCCCCCAGCTCGGTGCTGCCGGCACCACGTAT
GCGCGGTCTGTGAGGCCCAACGTCATCAGGCAGGGCGCTCTTCCCGACCCGGAACTCATCTTCGACTCGGTCATGAAGCGCACCGAGTACAAGTCGCACCCCAACAACGTGTCCAGCATC
CTGTGGTACTGGGCCAGCATCATCATCCACGATCTGTTCTGGACCGACTACCGTGACATGAGCAAGTCCAAGACGTCTTCCTACCTCGACCTGTCGCCGCTGTACGGCAGCAACCAGGAC
ATGCAGGACACGATCCGTACCTTCAAGGACGGTAAGCTCAAGGTGGACTGCTACGCCGACAAGCGCCTGCTGGGCATGCCTCCCGGCGTCAGCGTGCTGCTCATCTTCTTCAACCGGTTC
CACAACTACACGTGCGACAACCTGATTGCCATCAACGAGGACGGCCGGTTCAACAAGCCGTCGCCCAAGCTCGAGGGCGAGAAGGCTGAGGCGGCGTGGAAGAAGTACGACAACGACTTG
TTCCAGACGGCCAGACTCATCACTTCGGGTCTGTACATCAACATCACCCTGCTCGACTACGTGCGCAACATTGTCAACCTCAACCGGGTCGACACCACGTGGACGCTCGACCCCCGTGCC
GACACGGGCATTGACGTGGGCACCAAGGACGGTGCGGAGCGCGGTACCGGCAACGTGGTCTCGGCCGAGTTCAACCTTTGCTACCGGTGGCACTCGTGCATCTCGGCCAAGGACGAGGCC
TGGATCGAGGATTTCTACTACGAGCTCTTTGGCAAGCCCGGCAGCGACCTCAGCTTCCACGAGCTGATCATGGGCTTCGGCAAGTTTGAGGGCGGGATTCCTGCGGATCCGGCCGACCGG
CCCATTCGCAAGGACAAGGGCCACTTCAGCCGCGACGCCAACGGCAAGATCAGCGACGACGAGCTGGCCGAGTGCATCGCCGACGCCATTGAGGATCCCGCCGGTTCCTTTGGCGCCAAG
AACGTGCCTCCTTCCATGCGGGCCGTCGAGATCCTCGGTATCATCCAGGGCCGCAAATGGAACCTGGCCGGCCTGAACGAGTTCCGCAAGCACTTTGGCCTCAAGCCGTACGAGACCTTT
GAGGACATCAACTCGGACCCGGGTGTGTCCGAGGCTCTTCGTAGGCTGTACGACCACCCGGACTTTGTCGAGCTGTACCCTGGTATCGTCGCTGAAGAGCACAAGTCGCCCATGGTTCCC
GGCGTGGGCATCGCGCCGACCTACACCATCTCGCGCGTGGTGCTGTCGGACGCCGTCTGTCTCGTCCGTGGCGACCGCCACTACACCATCGACTACAACCCGCGCAACCTGACCAACTGG
GGCTACAACGAGGTGCAGTACGACCTGAACCTCAAACACGGCTGCGTCTTCTACAAGCTCTTCATGCGCGCCCTGCCCAACCACTTCAAGGAAAACTCGGTGTATGCGCACTACCCGATG
GTAACCCCCGCAGAGAACAAGAAGATCCTCACGGACCTCAAGCGCGACCACCTCTTTGACTGGGCCCGGCCCACCCGCCAACCCAAGCCGCACCAGGTGAAGACGCACGCGGGCGCCCAG
CACGTGCTCGACAACGACAAGGAGGGCACGAGCGGCGCGTACATGTCCTCATGGCACGCCGGTCTCGAGTCCCTCCTCGGCAAACCCCTCAGCAACAACAACCCCGACGCCCACGACAGC
CAACGCCGCGACATCCACGAGCAGCTGTACAGCGCCGAGTGGGCCGACCAAGTCAAGGCCTTTTTCGCGCAGACCACTGACGCCCTCCTGGCCGGGGAGAGCTACAACGTCGGCGGCCAC
CTGCTCGTCGACCTCGTCCGCGACGTTGGCAACATTGTGCCTACCCTGTTCGCCGCCAAGGTGTTTGGCATTTCCCTGCAGACCAAGAACAACACCAATGGGCTGTACACTCCGCAGGAA
CTGTATGCCGTGCTAGCTGTCATTTTCGCCGCCATCTTCTACGACCACGACCCCGTCAAGACGCATCAGCTGCGTGACGCGGCCCGCACGGTGGCGACGCAGCTCGGTACCGCTTTGGAG
AGCGCCGTCAAGAGCCAGACTTCCTTCTTTGGGTCGCTTCTTGGTGGTGGTGGTAGCGGTAGCAACAATAACGCGCTGACTGCGTATGGCAACGACCTCGTCAAGCGGTTGTCCAAGGCT
GGGCTGAGCGCGTCGGATGTTGCGTTTGGTCAGGTGTTGCCGATCGTGGCGTCGAGCGTGCCGAGTATTGCCGAGGCGTTCGCGAGCGCGGCGGACTTTTATCTCGGTGAGAAGGGACAG
GCGCACTTGGGTGCCATTCAGGAGCTGGCGAGGCAGCCGGCGAGTGCGAGCGCGGATGCGCAGTTGCTTGGGTACGTGTTGGAGGGCATTCGGTTGTCGGGCAACGCTTTGGGGGCGTTC
AGGCAGGCGAGTGCGGTGGATGCCATCAAGGAGGAGGATGGCAGCGAGGTGAGGGTGCAGCCTGGTGATAGGGTGTTTGTTAGCGTG
AAATCCGCGGCCCAGTCACCAACCACCTTCCCC
AGCCCCGAGGAAGTCAACCCGTCCCGCCCGCTGGAGGCCTACAAAATCTTCTTCTTCGGCACGCACTCGTACCTTGGTCACGAGGTCAGCCAGATTGCGCTTAGGGAAATGTTCCGCAGC
TTGTTCAAGCGGAGCAACGTCCGTCGGGCGCCCGGCCCCCAGGGCCAGCTGAAGAAGATCACGAGGGAGTTGAATGAGGAGCTGAGCCAGACGTTCTACCTCCGCGAGGACTGGGGTGCT
GTGACGCCGTTCCCCGTGACCATGAAGGTTACTTGGGATGAGTAG

Retrieve as FASTA