Entry information : NcLDS02
Entry ID 5309
Creation 2007-05-01 (Christophe Dunand)
Last sequence changes 2007-05-01 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2012-04-25 (Catherine Mathe (Scipio))
Peroxidase information: NcLDS02
Name NcLDS02
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS002]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Sordariaceae Neurospora
Organism Neurospora crassa    [TaxId: 5141 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value NcLDS02
start..stop
S start..stop
GzLDS03 1358 0 21..1317 32..1358
GmoLDS03 810 0 360..1317 426..1372
GmoLDS03 374 8e-107 16..301 16..308
AflLDS02 350 7e-99 372..1245 434..1266
AflLDS02 236 9e-63 34..314 160..452
AorLDS02 338 3e-95 372..1245 434..1256
AorLDS02 235 9e-63 34..314 160..452
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 888294..888431 138 N° 2 886709..888224 1516 N° 3 884914..886649 1736 N° 4 884163..884847 685
N° 5 882215..883860 1646  
complement(join(882215..883860,884163..884847,884914..886649,886709..888224,8882 94..888431))


exon

Literature and cross-references NcLDS02
Literature Galagan,J.E., et al., The genome sequence of the filamentous fungus Neurospora crassa. Nature 422 (6934), 859-868 (2003)
Protein ref. GenPept:   XP_330320 UniProtKB:   Q7S7D1
DNA ref. JGI genome:   supercont10.5 (888431..882215)
Protein sequence: NcLDS02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1906
PWM (Da):   %s   213134.59  
PI (pH):   %s   6.31
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSSDVQRPLWGHAIQDSDSARLESLNEALSTQKYLAGFHGDTLIGVGLLDDLKSILELKNVPSIVAVLVNYLKERRLDIKAGASLLAAVSNNSVARADIIEKQVKIKYDRMLHPPLSYLGDAFKYRTADGKFNSAINPHLGQAGAPYAKTVPAKTHPLGALPDPGDLFDQLMAREENGRPSQSGLSSMLIYHATIIIHDLFRTNDNDKNISDTSSYLDLSPLYGFTEEMQRKVRDETYGLGLLKPDTFAEDRLLRQPPGVCIMLVMYNRYHNYAATQLRRINENGRFSVPREYREAKFIAAAKYFDKDRLLENIDNQEILKRFIDANKVFESNGRIRTKEYQDAENALDVFINKVQPDEKQVQAFKDSYDAAWKKLDDDLFHTARLITCGLYIQVSVHDYLRALMGFHQYDTNFTLDPRVNQSEAKEVSRGLGNQVTVEFNLLYRFHCAISRGDEEYLENYLEEYFEKHSRSDWNPKEMGLQEFLMEMGQARERRKNDPPVKPCDIEFGLKNKDEDEARKKMAFKRDPITKLFNDEQMVEHLTKVMDEPISNFGPRNVPRSLKAVEVMGILQARKWGVGTLNDFREFFGMKRHTTFESVSGCVEVQNALRDLYEHPDKIEFYPGVFCESDASQSADPGPSDVDSALWAAIFSDAITLVRSDRFYTLDWNTNSLTSWGMKEVTPDNDVLKSSVFHRLLQRSFPEWFPSTSVRFFHPFYTAQKNAEYATAQGYDKDFAIKPTVEKSERNWSGPATVTQTFDTSASNPRKPVQPKILTDPRQIMEVLNDTDNIVHPVRLEPEILPAKVAEVLAVREQEDTADGRKSHGEHRKEIDTDTDDLMTYFTDLMRDIIRRESVVMKPGQRNSEVDPIYQLDVTRDFAVPVVTRYVADFLGFGHLVKSEKNLHAKYSENEIYQHITNCHLYFSYNADETKLPKRRKMFKDSMSFLFDLTLNEGNVAEVKKFRLTRALQSVGSWLWRSAAGDNNNPMSELGLEVSQQLLQQQKGDTGRVAAILLLLALDSSYTSVLAFTSVLDSFINGLYTLAAKEPNPSSGVTENKSCNWRDVQRLACAEFLPDVSTNTFDDIKKIVLKAQRESMKLPILRKARITCVVKGSEPVLTVEKDQLIICDNPGDQEYKDDVPTYHTSFTERFTEYHPKNLAENSLTAMIKVLAQLKDLRRGNDTQGHLKKIGLDSSYATYTNFMAPQRIKHIKTQVRAKIAEADEADDLTMADKLKETYHLDRLQCPATDTYMTPEWDEMIPFPTTWKVRFNGYGESTYGGEKLPLLQPRLVPDNFPPFYELPGGPSRMGGSFGEPIHPYPSKPQEKSTSREEHGEHVLYMDRGSDAGDSAIDIDEGCHVPMQGLSRTAATTPLLALACTYSKPRSCKEQDLIETLLSSPSMKIPSSPFHRHHSSTVGQTAISIPVMMSQSEATWTSAFGGIPEIVIKPWKPPPRRTYLFKRANLVDTAQGTIISNVNIKIADGVIKLIEKNDPRITSLAHHQRGEDDLGSVIEVDLEGKFLCPGLIDCHVHVSAVPGELSLSSTAAISDPAISLLRQPFVCSQMLSRGFTTVRDTGGATLALKEAIEEGVFPGPRLFICNRALSQTGGHGDLRGAHDHKNRGGGGGGGGGGEGCCGGSAGQLAVVCDGVPECIRAAREQLRTGADFIKIMVGGGVASPTDRLTNTQFTAAEVRAICDVAESYGTYVTAHAYTPKAIRHAVDNGVKGIEHGNLIDEATARYMAERGIWLTPTLVTYDAMASDEYAGFLPPENQRKNEEVLRQGLKSLTIAEKAGVNMCYGSDLLGPLTREQSKEFGIRSVILKSKQVLQSATVNAAKMLGQESFLGQLKPGYAADMLILNVNPFNDVAMLDEPKKHVLAVIKDGRVCVSRWRKLPMDATHGEELIE

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 4 introns) and 2 ESTs with mismatches (AI398190 and AI398117). The sequence is much longer than the other LDS, extra sequence in C-Term, uncorrect prediction?. Strain="OR74A" and "74-OR23-IV A/FGSC 2489". Regions: 125-682 peroxidase domain; 1459-1890 aminohydrolase - metallo dependent hydrolase.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCGTCCGATGTGCAACGTCCTCTGTGGGGGCATGCCATCCAAGACTCTGACAGTGCTCGACTGGAGAGTTTGAACGAGGCATTGAGCACGCAAAAGTATTTGGCCGGGTTTCAC
GGCGATACACTCATTGGG
GTGAGTTCAGGGTACACCAGCCTTTGTGGCCTGGAAACTAATTCGCTGCAGAATAAAGTTGTTTCTAAGGTCGGGCTTTTGGACGACCTAAAGAGCATCCTG
GAGCTCAAGAACGTACCCAGCATTGTGGCAGTCTTGGTCAACTATCTCAAAGAACGTCGCCTCGACATCAAAGCTGGTGCATCGTTGCTGGCAGCCGTGTCGAACAACAGTGTAGCCAGG
GCCGATATCATCGAAAAGCAGGTCAAGATCAAGTACGACCGCATGCTGCACCCACCCTTGAGTTACTTGGGCGATGCTTTTAAGTACCGGACCGCCGATGGCAAGTTCAACAGCGCCATC
AACCCACACCTCGGCCAAGCCGGAGCTCCTTACGCCAAAACCGTACCTGCGAAGACTCATCCCCTCGGAGCCTTGCCAGATCCAGGAGACCTTTTCGACCAATTAATGGCAAGAGAGGAA
AATGGCCGTCCAAGTCAATCAGGCTTGTCCAGCATGCTCATATACCATGCCACCATCATCATCCACGATCTCTTCCGCACCAATGACAACGACAAGAACATTTCTGATACGTCGTCATAC
CTCGATCTGTCGCCACTGTACGGCTTCACAGAGGAGATGCAGCGCAAGGTTCGTGACGAAACGTATGGCCTTGGTTTGCTCAAGCCAGACACCTTTGCAGAGGACCGACTGCTTCGTCAA
CCGCCGGGAGTCTGTATTATGCTGGTCATGTACAACCGGTACCACAACTACGCAGCAACACAACTTCGGCGCATCAACGAAAACGGCCGCTTTTCAGTCCCCAGAGAATACCGGGAGGCC
AAGTTCATCGCAGCAGCGAAATACTTTGACAAAGATAGGCTGTTGGAGAACATCGACAACCAGGAAATCCTGAAGAGATTCATAGATGCCAACAAGGTATTTGAGAGCAACGGTCGGATT
CGCACCAAGGAGTACCAAGATGCGGAGAATGCCCTCGATGTCTTCATCAATAAGGTCCAGCCAGACGAAAAGCAAGTCCAAGCCTTCAAGGACAGCTACGACGCAGCCTGGAAGAAGCTG
GACGACGACCTTTTCCACACCGCTCGACTAATCACATGCGGCCTTTACATCCAGGTCTCCGTTCACGACTACCTCAGGGCATTGATGGGCTTCCACCAGTACGACACGAACTTCACCCTT
GATCCGAGAGTGAATCAATCGGAGGCCAAGGAGGTATCGCGGGGCCTGGGCAACCAGGTAACGGTTGAGTTCAACCTGCTCTATCGGTTCCACTGCGCCATCTCGCGGGGCGACGAGGAA
TACCTTGAGAACTATCTGGAGGAGTACTTTGAGAAGCATTCCAGGTCGGACTGGAACCCAAAGGAAATGGGATTACAGGAGTTCCTCATGGAGATGGGCCAGGCGCGGGAGCGGAGAAAG
AATGATCCTCCCGTCAAACCTTGTGATATTGAGTTTGGACTCAAAAACAAGGACGAAGACGAAGCCAGGAAGAAGATGGCCTTCAAGCGTGACCCCATCACCAAGCTCTTCAATGATGAG
CAAATGGTAGAACACCTCACCAAGGTGATGGACGAGCCAATCT
GTAAGTGCACAAACCGTCAATTCTGTTTGCTAGATTAATGCTAACATGGGCTGGAATAGCGAATTTCGGCCCCAGGA
ACGTACCTCGATCTCTGAAAGCCGTCGAGGTCATGGGTATCCTCCAGGCGCGCAAGTGGGGAGTTGGAACGCTGAACGACTTCCGTGAGTTTTTCGGGATGAAGCGTCACACAACGTTTG
AGAGTGTCTCAGGCTGTGTTGAGGTTCAGAATGCACTTCGGGACCTTTATGAGCACCCAGACAAGATCGAGTTTTATCCTGGTGTCTTTTGCGAGTCGGACGCGAGCCAAAGTGCAGATC
CAGGGCCAAGTGACGTTGATTCGGCGTTATGGGCCGCCATCTTCTCCGATGCTATCACTCTCGTGCGGTCGGATCGGTTTTACACCCTTGATTGGAACACGAACTCGCTCACCTCCTGGG
GTATGAAGGAGGTAACCCCAGATAACGATGTGCTCAAGAGCTCTGTATTCCATCGACTTCTGCAACGATCGTTCCCGGAGTGGTTCCCCAGCACGTCGGTCCGCTTCTTCCATCCCTTCT
ACACAGCCCAGAAGAATGCCGAGTACGCAACGGCGCAGGGCTACGACAAAGACTTTGCCATCAAACCTACTGTGGAGAAGTCTGAACGGAACTGGTCCGGACCAGCAACGGTCACGCAGA
CGTTCGACACTTCAGCCTCAAATCCTCGCAAGCCTGTCCAGCCCAAAATTCTCACTGATCCTCGTCAAATCATGGAAGTCCTCAACGATACAGACAACATTGTTCATCCAGTCCGTCTGG
AGCCCGAGATTCTCCCCGCCAAGGTCGCCGAGGTTCTGGCTGTGCGCGAACAAGAAGACACGGCCGATGGTAGAAAGTCACATGGCGAACACCGGAAAGAGATTGATACTGATACCGACG
ACTTGATGACATACTTCACCGACCTCATGAGAGATATCATCAGGCGTGAATCTGTCGTGATGAAACCGGGACAAAGAAATTCGGAAGTCGATCCGATCTATCAGCTCGATGTCACTAGAG
ACTTTGCCGTCCCCGTTGTCACTCGGTATGTTGCTGACTTTCTTGGATTCGGACATCTCGTAAAGTCGGAGAAGAACCTGCATGCGAAGTACTCAGAGAACGAGATTTACCAGCATATCA
CCAACTGCCATCTCTACTTTTCGTACAACGCCGACGAGACCAAGCTTCCAAAACGGCGCAAGATGTTCAAAGACTCAATGAGCTTCCTCTTCGACCTGACACTCAACGAGGGGAACGTTG
CCGAAGTGAAGAAGTTCCGTCTCACACGGGCGCTCCAGAGTGTTGGATCATGGCTCTGGAGATCTGCAGCCGGCGACAACAACAACCCAATGAGCGAGCTCGGTTTGGAAGTTTCTCAAC
AGCTCTTGCAACAACAGAAGGGCGACACTGGTAGAGTGGCGGCGATTTTGTTGCTCCTTGCTCTCGACAGCTCGTATACCTCGGTTCTTGCCTTCACTTCGGTTCTGGATTCGTTCATCA
ACGGACTATACACGCTGGCAGCCAAGGAACCAAATCCTTCATCAGGAGTTACAGAAAATAAGAGTTGCAACTGGCGTGATGTCCAACGTCTCGCGTGTGCCGAGTTTCTTCCGGATGTGT
CGACCAATACCTTTGACGATATCAAGAAGATCGTCTTGAAAGCGCAACGGGAGAGCATGAAGCTACCCATCCTACGCAAGGCGCGCATAACTTGCGTAGTGAAGGGGAGTGAGCCTGTGT
TGACCGTGGAGAAAGATCAGCTAATCATTTGTGACATT
GTGAGTCCCCTAACCACGAAAACCCAGGACAACCGTTATACTAATAATCAAACCTCTTCTCGTTAGAACCCCGGTGATCAGG
AGTATAAGGACGATGTGCCAACCTACCACACCAGCTTCACCGAGAGGTTCACTGAATACCACCCCAAAAACCTCGCTGAAAACAGTCTGACCGCCATGATCAAAGTCCTAGCCCAGCTCA
AGGACCTCAGACGAGGCAACGACACCCAAGGCCATTTGAAGAAAATCGGACTCGACTCGTCATACGCGACTTATACTAACTTCATGGCACCACAACGTATCAAACATATCAAGACCCAAG
TAAGGGCCAAGATTGCAGAGGCCGACGAAGCCGACGACTTGACGATGGCCGACAAGCTGAAGGAGACGTACCACCTCGACAGACTGCAATGCCCTGCAACGGACACGTACATGACCCCTG
AGTGGGACGAGATGATTCCCTTCCCAACTACCTGGAAGGTCAGATTCAACGGCTACGGGGAGTCGACGTATGGTGGCGAGAAATTGCCTCTTCTCCAGCCACGGCTGGTGCCGGATAATT
TCCCCCCCTTCTACGAGCTTCCTGGCGGACCAAGTCGTATGGGAGGTTCGTTCGGAGAGCCAATCCACCCATATCCCTCGAAGCCTCAGGAGAAGTCGACCAGCAGAGAGGAACATGGTG
AACATGTTCTGTATATGGATCGCGGCAGTGATGCGGGTGACTCTGCCATTGATATAGATGAGGGCTGTC
GTAAGGAGATGCCGAAGGGAGTTACAAATGGGTGCGGCATCGGAATATGAG
CCAGCCCATCAGGTCAGGAGAGTTAGATTTGCGTTGTACGGAATCCATTGGTGAGCGTTTTGGGCATGCTTCTCCAGAGAGATAAATAGGTAGGGTGAAGTCAGGTCACCTTGTGAAGTC
TGATGCATCGTGATTGTCGCCACCATATCTCATCGCGAGAATGCATCCTTCTGTACTCCACAGGCCTCAGGCCCAGTTTCTGCCATGATTGGTTCTTGACCCCTCTCAGCAACACTATCT
CATGCAGATAGATGTGCCTATGCAGGGACTCTCTCGTACCGCGGCTACAACCCCGCTTCTTGCCCTTGCCTGTACCTATTCCAAGCCTCGAAGTTGCAAAGAACAAGATCTCATTGAGAC
GCTCTTGTCAAGCCCGAGTATGAAAATCCCGTCATCACCATTCCATCGCCATCACTCTTCGACTGTTGGGCAGACAGCAATTTCCATACCTGTCATGATGAGTCAATCTGAAGCAACGTG
GACCTCAGCCTTTGGAGGGATCCCGGAAATCGTCATCAAACCATGGAAACCACCGCCACGAAGGACCTATCTCTTTAAAAGAGCGAACCTCGTTGATACCGCTCAAGGAACCATTATCTC
CAACGTAAACATCAAGATCGCAGATGGCGTGATCAAGCTCATCGAGAAAAACGATCCCAGAATTACCAGCCTCGCTCATCATCAACGAGGCGAAGATGACTTGGGATCGGTAATCGAAGT
TGACCTTGAAGGCAAATTTCTGTGCCCTGGGCTTATTGACTGCCATGTCCACGTCAGTGCCGTACCAGGGGAACTCAGTCTTTCATCCACCGCCGCTATCTCTGATCCCGCCATTTCGCT
TCTTCGTCAACCCTTCGTCTGCTCCCAGATGCTTAGCAGGGGATTTACCACCGTTCGTGACACAGGCGGTGCCACGCTTGCTTTGAAGGAGGCCATCGAAGAGGGTGTTTTTCCCGGGCC
ACGGCTCTTCATCTGTAATCGGGCTCTGTCTCAGACAGGTGGCCATGGTGACCTCCGCGGCGCGCACGACCACAAGAACCGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGAAGGCTG
CTGCGGGGGCTCAGCGGGTCAACTGGCTGTGGTCTGTGATGGAGTACCGGAGTGCATTCGTGCGGCGCGAGAGCAGTTGAGAACAGGAGCGGACTTCATCAAGATTATGGTAGGAGGCGG
CGTTGCCTCCCCCACGGATCGGTTGACCAACACGCAATTCACGGCTGCTGAGGTCCGGGCCATCTGCGATGTGGCAGAGAGCTATGGAACCTACGTGACAGCTCATGCGTACACGCCCAA
AGCAATTCGCCATGCTGTTGACAATGGTGTCAAGGGTATCGAACATGGAAATCTTATTGACGAAGCGACGGCACGGTACATGGCCGAGAGGGGAATATGGTTAACACCAACGCTAGTGAC
ATATGATGCGATGGCATCAGATGAGTATGCCGGCTTCCTACCACCAGAGAATCAGCGAAAAAACGAAGAGGTATTGCGGCAGGGGCTGAAGTCGCTCACAATTGCGGAAAAGGCAGGAGT
CAACATGTGTTATGGCTCTGATCTTTTAGGACCTTTGACGAGAGAGCAGTCAAAGGAGTTTGGCATCCGGTCGGTCATCCTAAAGAGCAAGCAGGTTTTGCAGTCAGCTACTGTGAATGC
GGCAAAGATGCTAGGACAGGAGTCGTTTCTGGGCCAACTCAAACCAGGATATGCTGCCGATATGCTTATTCTCAACGTCAACCCATTCAATGACGTGGCGATGCTGGATGAACCAAAGAA
ACACGTGTTGGCAGTAATTAAGGACGGACGAGTATGTGTGAGCCGTTGGAGAAAGCTTCCCATGGATGCAACACACGGAGAGGAGTTAATTGAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCGTCCGATGTGCAACGTCCTCTGTGGGGGCATGCCATCCAAGACTCTGACAGTGCTCGACTGGAGAGTTTGAACGAGGCATTGAGCACGCAAAAGTATTTGGCCGGGTTTCAC
GGCGATACACTCATTGGG
GTCGGGCTTTTGGACGACCTAAAGAGCATCCTGGAGCTCAAGAACGTACCCAGCATTGTGGCAGTCTTGGTCAACTATCTCAAAGAACGTCGCCTCGACATC
AAAGCTGGTGCATCGTTGCTGGCAGCCGTGTCGAACAACAGTGTAGCCAGGGCCGATATCATCGAAAAGCAGGTCAAGATCAAGTACGACCGCATGCTGCACCCACCCTTGAGTTACTTG
GGCGATGCTTTTAAGTACCGGACCGCCGATGGCAAGTTCAACAGCGCCATCAACCCACACCTCGGCCAAGCCGGAGCTCCTTACGCCAAAACCGTACCTGCGAAGACTCATCCCCTCGGA
GCCTTGCCAGATCCAGGAGACCTTTTCGACCAATTAATGGCAAGAGAGGAAAATGGCCGTCCAAGTCAATCAGGCTTGTCCAGCATGCTCATATACCATGCCACCATCATCATCCACGAT
CTCTTCCGCACCAATGACAACGACAAGAACATTTCTGATACGTCGTCATACCTCGATCTGTCGCCACTGTACGGCTTCACAGAGGAGATGCAGCGCAAGGTTCGTGACGAAACGTATGGC
CTTGGTTTGCTCAAGCCAGACACCTTTGCAGAGGACCGACTGCTTCGTCAACCGCCGGGAGTCTGTATTATGCTGGTCATGTACAACCGGTACCACAACTACGCAGCAACACAACTTCGG
CGCATCAACGAAAACGGCCGCTTTTCAGTCCCCAGAGAATACCGGGAGGCCAAGTTCATCGCAGCAGCGAAATACTTTGACAAAGATAGGCTGTTGGAGAACATCGACAACCAGGAAATC
CTGAAGAGATTCATAGATGCCAACAAGGTATTTGAGAGCAACGGTCGGATTCGCACCAAGGAGTACCAAGATGCGGAGAATGCCCTCGATGTCTTCATCAATAAGGTCCAGCCAGACGAA
AAGCAAGTCCAAGCCTTCAAGGACAGCTACGACGCAGCCTGGAAGAAGCTGGACGACGACCTTTTCCACACCGCTCGACTAATCACATGCGGCCTTTACATCCAGGTCTCCGTTCACGAC
TACCTCAGGGCATTGATGGGCTTCCACCAGTACGACACGAACTTCACCCTTGATCCGAGAGTGAATCAATCGGAGGCCAAGGAGGTATCGCGGGGCCTGGGCAACCAGGTAACGGTTGAG
TTCAACCTGCTCTATCGGTTCCACTGCGCCATCTCGCGGGGCGACGAGGAATACCTTGAGAACTATCTGGAGGAGTACTTTGAGAAGCATTCCAGGTCGGACTGGAACCCAAAGGAAATG
GGATTACAGGAGTTCCTCATGGAGATGGGCCAGGCGCGGGAGCGGAGAAAGAATGATCCTCCCGTCAAACCTTGTGATATTGAGTTTGGACTCAAAAACAAGGACGAAGACGAAGCCAGG
AAGAAGATGGCCTTCAAGCGTGACCCCATCACCAAGCTCTTCAATGATGAGCAAATGGTAGAACACCTCACCAAGGTGATGGACGAGCCAATCT
CGAATTTCGGCCCCAGGAACGTACCT
CGATCTCTGAAAGCCGTCGAGGTCATGGGTATCCTCCAGGCGCGCAAGTGGGGAGTTGGAACGCTGAACGACTTCCGTGAGTTTTTCGGGATGAAGCGTCACACAACGTTTGAGAGTGTC
TCAGGCTGTGTTGAGGTTCAGAATGCACTTCGGGACCTTTATGAGCACCCAGACAAGATCGAGTTTTATCCTGGTGTCTTTTGCGAGTCGGACGCGAGCCAAAGTGCAGATCCAGGGCCA
AGTGACGTTGATTCGGCGTTATGGGCCGCCATCTTCTCCGATGCTATCACTCTCGTGCGGTCGGATCGGTTTTACACCCTTGATTGGAACACGAACTCGCTCACCTCCTGGGGTATGAAG
GAGGTAACCCCAGATAACGATGTGCTCAAGAGCTCTGTATTCCATCGACTTCTGCAACGATCGTTCCCGGAGTGGTTCCCCAGCACGTCGGTCCGCTTCTTCCATCCCTTCTACACAGCC
CAGAAGAATGCCGAGTACGCAACGGCGCAGGGCTACGACAAAGACTTTGCCATCAAACCTACTGTGGAGAAGTCTGAACGGAACTGGTCCGGACCAGCAACGGTCACGCAGACGTTCGAC
ACTTCAGCCTCAAATCCTCGCAAGCCTGTCCAGCCCAAAATTCTCACTGATCCTCGTCAAATCATGGAAGTCCTCAACGATACAGACAACATTGTTCATCCAGTCCGTCTGGAGCCCGAG
ATTCTCCCCGCCAAGGTCGCCGAGGTTCTGGCTGTGCGCGAACAAGAAGACACGGCCGATGGTAGAAAGTCACATGGCGAACACCGGAAAGAGATTGATACTGATACCGACGACTTGATG
ACATACTTCACCGACCTCATGAGAGATATCATCAGGCGTGAATCTGTCGTGATGAAACCGGGACAAAGAAATTCGGAAGTCGATCCGATCTATCAGCTCGATGTCACTAGAGACTTTGCC
GTCCCCGTTGTCACTCGGTATGTTGCTGACTTTCTTGGATTCGGACATCTCGTAAAGTCGGAGAAGAACCTGCATGCGAAGTACTCAGAGAACGAGATTTACCAGCATATCACCAACTGC
CATCTCTACTTTTCGTACAACGCCGACGAGACCAAGCTTCCAAAACGGCGCAAGATGTTCAAAGACTCAATGAGCTTCCTCTTCGACCTGACACTCAACGAGGGGAACGTTGCCGAAGTG
AAGAAGTTCCGTCTCACACGGGCGCTCCAGAGTGTTGGATCATGGCTCTGGAGATCTGCAGCCGGCGACAACAACAACCCAATGAGCGAGCTCGGTTTGGAAGTTTCTCAACAGCTCTTG
CAACAACAGAAGGGCGACACTGGTAGAGTGGCGGCGATTTTGTTGCTCCTTGCTCTCGACAGCTCGTATACCTCGGTTCTTGCCTTCACTTCGGTTCTGGATTCGTTCATCAACGGACTA
TACACGCTGGCAGCCAAGGAACCAAATCCTTCATCAGGAGTTACAGAAAATAAGAGTTGCAACTGGCGTGATGTCCAACGTCTCGCGTGTGCCGAGTTTCTTCCGGATGTGTCGACCAAT
ACCTTTGACGATATCAAGAAGATCGTCTTGAAAGCGCAACGGGAGAGCATGAAGCTACCCATCCTACGCAAGGCGCGCATAACTTGCGTAGTGAAGGGGAGTGAGCCTGTGTTGACCGTG
GAGAAAGATCAGCTAATCATTTGTGACATT
AACCCCGGTGATCAGGAGTATAAGGACGATGTGCCAACCTACCACACCAGCTTCACCGAGAGGTTCACTGAATACCACCCCAAAAACCTC
GCTGAAAACAGTCTGACCGCCATGATCAAAGTCCTAGCCCAGCTCAAGGACCTCAGACGAGGCAACGACACCCAAGGCCATTTGAAGAAAATCGGACTCGACTCGTCATACGCGACTTAT
ACTAACTTCATGGCACCACAACGTATCAAACATATCAAGACCCAAGTAAGGGCCAAGATTGCAGAGGCCGACGAAGCCGACGACTTGACGATGGCCGACAAGCTGAAGGAGACGTACCAC
CTCGACAGACTGCAATGCCCTGCAACGGACACGTACATGACCCCTGAGTGGGACGAGATGATTCCCTTCCCAACTACCTGGAAGGTCAGATTCAACGGCTACGGGGAGTCGACGTATGGT
GGCGAGAAATTGCCTCTTCTCCAGCCACGGCTGGTGCCGGATAATTTCCCCCCCTTCTACGAGCTTCCTGGCGGACCAAGTCGTATGGGAGGTTCGTTCGGAGAGCCAATCCACCCATAT
CCCTCGAAGCCTCAGGAGAAGTCGACCAGCAGAGAGGAACATGGTGAACATGTTCTGTATATGGATCGCGGCAGTGATGCGGGTGACTCTGCCATTGATATAGATGAGGGCTGTC
ATGTG
CCTATGCAGGGACTCTCTCGTACCGCGGCTACAACCCCGCTTCTTGCCCTTGCCTGTACCTATTCCAAGCCTCGAAGTTGCAAAGAACAAGATCTCATTGAGACGCTCTTGTCAAGCCCG
AGTATGAAAATCCCGTCATCACCATTCCATCGCCATCACTCTTCGACTGTTGGGCAGACAGCAATTTCCATACCTGTCATGATGAGTCAATCTGAAGCAACGTGGACCTCAGCCTTTGGA
GGGATCCCGGAAATCGTCATCAAACCATGGAAACCACCGCCACGAAGGACCTATCTCTTTAAAAGAGCGAACCTCGTTGATACCGCTCAAGGAACCATTATCTCCAACGTAAACATCAAG
ATCGCAGATGGCGTGATCAAGCTCATCGAGAAAAACGATCCCAGAATTACCAGCCTCGCTCATCATCAACGAGGCGAAGATGACTTGGGATCGGTAATCGAAGTTGACCTTGAAGGCAAA
TTTCTGTGCCCTGGGCTTATTGACTGCCATGTCCACGTCAGTGCCGTACCAGGGGAACTCAGTCTTTCATCCACCGCCGCTATCTCTGATCCCGCCATTTCGCTTCTTCGTCAACCCTTC
GTCTGCTCCCAGATGCTTAGCAGGGGATTTACCACCGTTCGTGACACAGGCGGTGCCACGCTTGCTTTGAAGGAGGCCATCGAAGAGGGTGTTTTTCCCGGGCCACGGCTCTTCATCTGT
AATCGGGCTCTGTCTCAGACAGGTGGCCATGGTGACCTCCGCGGCGCGCACGACCACAAGAACCGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGAAGGCTGCTGCGGGGGCTCAGCG
GGTCAACTGGCTGTGGTCTGTGATGGAGTACCGGAGTGCATTCGTGCGGCGCGAGAGCAGTTGAGAACAGGAGCGGACTTCATCAAGATTATGGTAGGAGGCGGCGTTGCCTCCCCCACG
GATCGGTTGACCAACACGCAATTCACGGCTGCTGAGGTCCGGGCCATCTGCGATGTGGCAGAGAGCTATGGAACCTACGTGACAGCTCATGCGTACACGCCCAAAGCAATTCGCCATGCT
GTTGACAATGGTGTCAAGGGTATCGAACATGGAAATCTTATTGACGAAGCGACGGCACGGTACATGGCCGAGAGGGGAATATGGTTAACACCAACGCTAGTGACATATGATGCGATGGCA
TCAGATGAGTATGCCGGCTTCCTACCACCAGAGAATCAGCGAAAAAACGAAGAGGTATTGCGGCAGGGGCTGAAGTCGCTCACAATTGCGGAAAAGGCAGGAGTCAACATGTGTTATGGC
TCTGATCTTTTAGGACCTTTGACGAGAGAGCAGTCAAAGGAGTTTGGCATCCGGTCGGTCATCCTAAAGAGCAAGCAGGTTTTGCAGTCAGCTACTGTGAATGCGGCAAAGATGCTAGGA
CAGGAGTCGTTTCTGGGCCAACTCAAACCAGGATATGCTGCCGATATGCTTATTCTCAACGTCAACCCATTCAATGACGTGGCGATGCTGGATGAACCAAAGAAACACGTGTTGGCAGTA
ATTAAGGACGGACGAGTATGTGTGAGCCGTTGGAGAAAGCTTCCCATGGATGCAACACACGGAGAGGAGTTAATTGAGTGA

Retrieve as FASTA