Entry information : GzLDS02
Entry ID 5328
Creation 2007-05-10 (Christophe Dunand)
Last sequence changes 2007-05-10 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: GzLDS02
Name GzLDS02
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Nectriaceae Gibberella
Organism Gibberella zeae (anamorph Fusarium graminearum)    [TaxId: 5518 ]
Cellular localisation N/D
Tissue type Mycelium
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GzLDS02
start..stop
S start..stop
GmoLDS02 2138 0 1..1151 1..1151
AalcLDS02 1719 0 1..1150 1..1153
AteLDS02 1144 0 6..1114 91..1134
AflLDS02 1137 0 6..1132 160..1245
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 8548559..8548767 209 N° 2 8548809..8551434 2626 N° 3 8551484..8551702 219 N° 4 8551755..8552031 277
N° 5 8552082..8552212 131  
join(8548559..8548767,8548809..8551434,8551484..8551702,8551755..8552031,8552082 ..8552212)


exon

Literature and cross-references GzLDS02
Literature REFERENCE 2 Birren BW. et al.,Fusarium graminearum genome sequence.
Submitted (FEB-2004.
REFERENCE 2 Ouellet,T., Wang,L., Couroux,P., Harris,L.J., Hattori,J.I., Hubbard ,K., Lacroix,C., Robert,L.S., Singh,J.A. and Tinker,N.A. Expressed Sequence Tags from Fusarium graminearum Growing on Wheat Heads 96 Hours after Spray Inoculation
Protein ref. UniProtKB_Uniparc:   Q4IJE0
DNA ref. JGI genome:   Supercontig_3.1 (8548559..8552212)
Protein sequence: GzLDS02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1153
PWM (Da):   %s   128897.09  
PI (pH):   %s   7.12
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFNEKYQAGESYKDTSKEDPSSLLDNPEKLVADLMKDFAGVRSQASPADLLALVKQLLSKGQPLDDKKGVRTTELLIGILTALPRSSKARTALTNKLIDTLWGNLQHPPLSYVGGDVKYEVAGAEPDHKSHCAQYDTIEFQVPGTNVTLKEQVPQAPDGLHQYRMPDGSFNNILEPNLGKAGTPYAKSVRTEKRLHGVKPDPGLLFDLLMARDEGSFKENPAGISSMLFYHAAIIIHDIFRTNRTDMNKSDTSSYLDLAPLYGSSLKDQLEIRTMKEGKLKPDTFHEKRLLGQPAGVNVMLVLYSRFHNYVADILLKINENGRFSMSTPPNATEEEKAKAIAKQDHDLFNVARLITGGLYINICLHDYLRAITNTHHSASDWTLDPRVAIDKQFDGEGVPRGVGNQVSVEFNLLYRFHSCISKRDERWINGFFLKLFPGRKAEDLQDVSWTELGQALMTFEANTPKDPSVRTFDGLERQADGTFKDEDLVNILKTAMEDPAGCFGARMVPKALKVVEVLGIIQGRKWQCASLNEFREFFGLKRYNQFSDINSDPEIANILEKLYTDPDMVELYPGLMVEDIKPQRNPGSGIMPTYSVGRAVLSDAITLVRSDRFNTIDYTVSNLTSWGYNEVQQDYKTLGGSMLYKLIQRGVPNWFPYNSVAVMQPMYTKSANEKIAKEIGTFDQFTTDDPKPPAKVAVTMSNETIKKVLSNTKQYVVPWLKPLNDLFPGKKEYGWFMLAGDEAKNYQHRADWTKALKKVPNLHDAVHTFIEREGARLIKKESFTFKKGLDQIDIIRDVAIPLNAQLLSDMFYFDMRTDENPDGELGAAELYRSLLDIRVWGVNNNDPGQAWNRRRRAQEGVKRIYDSTKKLVSEVEVARPRGIGLISAVSNRIGAKSYLKKDSLRSCGLKLVEELLAQGSSIDHVTDNLWLTAFGGIGVPVTFYEVLAFFLRPENASIWAEVQAIAQKGDDATLHAYVAEALRMTSSQRNVRISKTPGEVDGQSIAPGTAVVLMLGEAGRNPKEIPDADKFNAQRKQQEVSAFSYGQHECVAKDVALAFVTGLIKLVADLKELRPAPGQMGTVKTIRVGTEKAYLNDSWSYLGFDASTWKVHFNGHGKGNFEGDRVPTSNTPIQEYYSLLQKRKDELLRR

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 1, 4 introns) and 14 ESTs (5' end: EB511444, EB511056... and 3'end: CD457564, EB511228, EB511764, CD459046...). Strain="PH-1 / NRRL 31084" and "DAOM 180378". Regions of the protein: 162-633 peroxidase domain; 792-1082 "CypX" cytochrome P450 domain
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTTCAACGAAAAGTATCAGGCTGGAGAGTCCTACAAGGACACCTCCAAGGAAGACCCTTCAAGTCTTCTCGACAACCCTGAGAAGCTTGTTGCGGATCTGATGAAGGATTTTGCT
GGTGTTCGAAGCCAAGCTAGTCCTGCTGATCTCTTGGCTCTTGTCAAGCAGCTTCTCTCCAAGGGACAGCCTCTTGATGATAAGAAGGG
GTAAGTTGTCGTCCATTGAACCCAATTGCTG
CCACTAACAGAGTTAGAACTACTGAACTCCTCATCGGTATTCTCACTGCCCTGCCTCGCTCCTCCAAGGCTCGCACCGCTCTTACAAACAAGCTCATCGACACTCTCTGGGGCAATCTTC
AACATCCCCCACTGAGCTACGTTGGTGGCGACGTCAAGTATGAAGTCGCTGGCGCAGAGCCAGACCACAAGAGCCATTGCGCACAATACGACACAATCGAGTTTCAGGTACCAGGTACCA
ATGTTACCCTCAAAGAACAAGTCCCTCAAGCACCCGACGGTCTCCATCAATACCGCATGCCTGATGGAAGCTTCAACAACATCCTTGAGCCAAACTTGGGCAAAGCTGGCACCCCCTACG
CCAAATCTGTCAGGACTGAGAAGCGCCTGCACGGCGTCAAGCCTGATCCTGGTTTGCTCTTTGATCTCCTCATGGCTCGTGATGAAGGCTCCTTCAAGGAGAACCCAGCTGGTATCTCTT
CCATGCTGTTTTACCACGCCGCCATCATCATTCATGACATCTTCCGCACAAACCGCACAGACATGAACAAGTCTGACACATCTTCATACCTTGATCTTGCGCCTTTGTATGGATCTTCTC
TCAAGGATCAGCTTGAGATCCGTACCATGAAGGAGGGTAAGCTCAAGCCTGATACCTTCCATGAGAAGCGTCTCTTGGGTCAACCTGCCGGTGTCAATGTGATGCTTGTCCTCTACAGTC
GTTTTCACAACTATGTGGCCGACATCTTGCTCAAGATCAACGAGAACGGTCGCTTCTCGATGTCAACACCACCCAATGCCACCGAGGAAGAGAAGGCCAAGGCAATTGCAAAGCAGGACC
ACGATCTCTTCAACGTGGCTCGCCTCATCACAGGTGGTTTGTACATCAACATCTGCCTTCACGACTACCTTCGAGCCATCACCAACACACACCACTCCGCCAGTGACTGGACTCTCGACC
CTCGTGTTGCTATTGACAAGCAATTCGACGGCGAAGGAGTCCCTCGCGGTGTTGGTAACCAGGTTAGCGTTGAATTTAACCTTCTCTATCGCTTCCACTCGTGTATCTCCAAGAGAGACG
AGCGCTGGATCAACGGCTTCTTCCTCAAGCTTTTCCCCGGCCGCAAGGCAGAGGACCTCCAGGATGTCAGCTGGACTGAACTTGGTCAAGCCCTCATGACCTTTGAGGCAAACACCCCCA
AGGACCCCAGTGTCCGAACCTTTGATGGTCTTGAGCGTCAAGCCGATGGTACCTTCAAGGATGAGGATCTCGTTAATATCCTCAAGACAGCCATGGAGGACCCTGCTGGTTGCTTTGGAG
CTCGCATGGTCCCCAAGGCTCTCAAGGTCGTTGAAGTGCTTGGTATCATACAGGGCCGCAAGTGGCAGTGCGCTTCTCTTAACGAGTTCCGCGAGTTCTTCGGACTCAAGCGCTACAACC
AGTTCAGCGATATCAATTCGGATCCCGAGATTGCAAACATCCTCGAGAAGCTGTACACTGACCCTGACATGGTTGAGCTCTATCCTGGTCTCATGGTCGAGGACATCAAGCCCCAGCGCA
ACCCAGGATCCGGTATCATGCCGACCTACTCAGTCGGTCGAGCTGTTCTCTCTGATGCAATCACGCTTGTGCGCTCAGACAGATTCAACACGATTGATTACACCGTATCCAACCTCACTT
CTTGGGGTTACAACGAGGTCCAGCAGGACTACAAGACCCTCGGTGGTTCAATGCTGTACAAGCTCATCCAGCGCGGTGTCCCCAACTGGTTCCCCTACAACTCTGTCGCTGTCATGCAGC
CCATGTACACCAAGAGTGCCAATGAGAAGATCGCCAAGGAGATTGGCACCTTTGACCAGTTTACAACAGATGATCCCAAGCCACCAGCCAAGGTCGCTGTGACGATGTCCAACGAGACCA
TCAAGAAGGTCCTCAGCAACACCAAGCAGTATGTCGTGCCCTGGCTCAAACCATTGAACGACCTGTTCCCTGGTAAGAAGGAATATGGATGGTTCATGCTTGCAGGCGATGAAGCCAAGA
ACTATCAACATCGCGCCGACTGGACAAAGGCTCTCAAGAAGGTTCCCAATCTTCATGATGCCGTTCACACCTTTATTGAGCGTGAGGGTGCTAGGCTCATCAAGAAGGAGTCCTTCACCT
TTAAGAAGGGTCTGGACCAGATCGACATCATCCGCGACGTCGCAATTCCCCTCAACGCACAGCTTCTCTCAGACATGTTCTATTTCGACATGCGTACAGATGAAAACCCTGACGGAGAAC
TTGGCGCTGCTGAGCTTTACCGCAGCCTTCTTGACATCCGCGTCTGGGGAGTCAACAACAACGACCCAGGCCAGGCGTGGAACCGCCGACGCCGTGCTCAAGAAGGTGTCAAGAGAATAT
ACGACTCGACCAAGAAGCTCGTTTCCGAAGTCGAGGTGGCACGTCCCAGAGGTATTGGCCTGATCTCTGCCGTTTCTAACAGAATCGGCGCCAAGTCGTACCTCAAGAAGGATTCGCTAC
GATCCTGTGGTCTCAAGCTTGTTGAGGAGCTTCTTGCACAAGGCAGCTCGATTGACCATGTTACTGACAACCTCTGGCTAACTGCCTTTGGAGGCATTGGCGTTCCTGTTACAGCC
GTAA
GTCAGTTTGTGAAAGGGTTGGGTATAGCACTGACTTATTGTACAGTTTTACGAGGTTTTGGCCTTTTTCCTCCGCCCCGAGAATGCGTCTATCTGGGCTGAAGTTCAGGCCATCGCTCAA
AAGGGTGATGATGCGACACTCCACGCCTATGTTGCCGAAGCTCTGCGCATGACGAGCTCCCAGCGCAATGTTCGTATTTCCAAGACACCAGGTGAAGTTGATGGCCAATCCATCGCGCCT
GGAACAGCCGTTGTTCTCATGCTT
GTAAGTCACTACCAGTCATGCCTTCAACATCAGATTTCTAACAGTCTCGCAGGGTGAAGCCGGACGAAACCCCAAGGAGATTCCAGATGCCGACAA
GTTCAACGCCCAGCGCAAGCAGCAAGAAGTATCGGCATTCAGCTATGGTCAACACGAGTGTGTCGCCAAGGACGTTGCCCTCGCTTTTGTTACCGGTCTTATCAAGCTTGTTGCCGATCT
CAAAGAACTTCGACCGGCACCTGGCCAGATGGGAACTGTCAAGACAATTCGTGTTGGTACCGAGAAGGCTTATCTCAACGACAGCTGGTCGTACCTTGGATTTGATGCTAGCA
GTAAGTC
TTTTGACCGCGCGGAACGAATTGATATGCTAACTGTGTGACAGCTTGGAAGGTACACTTCAACGGCCATGGCAAGGGTAACTTTGAAGGTGACAGAGTCCCTACGAGCAACACTCCCATC
CAGGAATACTACTCGTTGCTCCAGAAGCGCAAGGACGAGCTTCTGCGTCGATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTTCAACGAAAAGTATCAGGCTGGAGAGTCCTACAAGGACACCTCCAAGGAAGACCCTTCAAGTCTTCTCGACAACCCTGAGAAGCTTGTTGCGGATCTGATGAAGGATTTTGCT
GGTGTTCGAAGCCAAGCTAGTCCTGCTGATCTCTTGGCTCTTGTCAAGCAGCTTCTCTCCAAGGGACAGCCTCTTGATGATAAGAAGGG
AGTTAGAACTACTGAACTCCTCATCGGTATT
CTCACTGCCCTGCCTCGCTCCTCCAAGGCTCGCACCGCTCTTACAAACAAGCTCATCGACACTCTCTGGGGCAATCTTCAACATCCCCCACTGAGCTACGTTGGTGGCGACGTCAAGTAT
GAAGTCGCTGGCGCAGAGCCAGACCACAAGAGCCATTGCGCACAATACGACACAATCGAGTTTCAGGTACCAGGTACCAATGTTACCCTCAAAGAACAAGTCCCTCAAGCACCCGACGGT
CTCCATCAATACCGCATGCCTGATGGAAGCTTCAACAACATCCTTGAGCCAAACTTGGGCAAAGCTGGCACCCCCTACGCCAAATCTGTCAGGACTGAGAAGCGCCTGCACGGCGTCAAG
CCTGATCCTGGTTTGCTCTTTGATCTCCTCATGGCTCGTGATGAAGGCTCCTTCAAGGAGAACCCAGCTGGTATCTCTTCCATGCTGTTTTACCACGCCGCCATCATCATTCATGACATC
TTCCGCACAAACCGCACAGACATGAACAAGTCTGACACATCTTCATACCTTGATCTTGCGCCTTTGTATGGATCTTCTCTCAAGGATCAGCTTGAGATCCGTACCATGAAGGAGGGTAAG
CTCAAGCCTGATACCTTCCATGAGAAGCGTCTCTTGGGTCAACCTGCCGGTGTCAATGTGATGCTTGTCCTCTACAGTCGTTTTCACAACTATGTGGCCGACATCTTGCTCAAGATCAAC
GAGAACGGTCGCTTCTCGATGTCAACACCACCCAATGCCACCGAGGAAGAGAAGGCCAAGGCAATTGCAAAGCAGGACCACGATCTCTTCAACGTGGCTCGCCTCATCACAGGTGGTTTG
TACATCAACATCTGCCTTCACGACTACCTTCGAGCCATCACCAACACACACCACTCCGCCAGTGACTGGACTCTCGACCCTCGTGTTGCTATTGACAAGCAATTCGACGGCGAAGGAGTC
CCTCGCGGTGTTGGTAACCAGGTTAGCGTTGAATTTAACCTTCTCTATCGCTTCCACTCGTGTATCTCCAAGAGAGACGAGCGCTGGATCAACGGCTTCTTCCTCAAGCTTTTCCCCGGC
CGCAAGGCAGAGGACCTCCAGGATGTCAGCTGGACTGAACTTGGTCAAGCCCTCATGACCTTTGAGGCAAACACCCCCAAGGACCCCAGTGTCCGAACCTTTGATGGTCTTGAGCGTCAA
GCCGATGGTACCTTCAAGGATGAGGATCTCGTTAATATCCTCAAGACAGCCATGGAGGACCCTGCTGGTTGCTTTGGAGCTCGCATGGTCCCCAAGGCTCTCAAGGTCGTTGAAGTGCTT
GGTATCATACAGGGCCGCAAGTGGCAGTGCGCTTCTCTTAACGAGTTCCGCGAGTTCTTCGGACTCAAGCGCTACAACCAGTTCAGCGATATCAATTCGGATCCCGAGATTGCAAACATC
CTCGAGAAGCTGTACACTGACCCTGACATGGTTGAGCTCTATCCTGGTCTCATGGTCGAGGACATCAAGCCCCAGCGCAACCCAGGATCCGGTATCATGCCGACCTACTCAGTCGGTCGA
GCTGTTCTCTCTGATGCAATCACGCTTGTGCGCTCAGACAGATTCAACACGATTGATTACACCGTATCCAACCTCACTTCTTGGGGTTACAACGAGGTCCAGCAGGACTACAAGACCCTC
GGTGGTTCAATGCTGTACAAGCTCATCCAGCGCGGTGTCCCCAACTGGTTCCCCTACAACTCTGTCGCTGTCATGCAGCCCATGTACACCAAGAGTGCCAATGAGAAGATCGCCAAGGAG
ATTGGCACCTTTGACCAGTTTACAACAGATGATCCCAAGCCACCAGCCAAGGTCGCTGTGACGATGTCCAACGAGACCATCAAGAAGGTCCTCAGCAACACCAAGCAGTATGTCGTGCCC
TGGCTCAAACCATTGAACGACCTGTTCCCTGGTAAGAAGGAATATGGATGGTTCATGCTTGCAGGCGATGAAGCCAAGAACTATCAACATCGCGCCGACTGGACAAAGGCTCTCAAGAAG
GTTCCCAATCTTCATGATGCCGTTCACACCTTTATTGAGCGTGAGGGTGCTAGGCTCATCAAGAAGGAGTCCTTCACCTTTAAGAAGGGTCTGGACCAGATCGACATCATCCGCGACGTC
GCAATTCCCCTCAACGCACAGCTTCTCTCAGACATGTTCTATTTCGACATGCGTACAGATGAAAACCCTGACGGAGAACTTGGCGCTGCTGAGCTTTACCGCAGCCTTCTTGACATCCGC
GTCTGGGGAGTCAACAACAACGACCCAGGCCAGGCGTGGAACCGCCGACGCCGTGCTCAAGAAGGTGTCAAGAGAATATACGACTCGACCAAGAAGCTCGTTTCCGAAGTCGAGGTGGCA
CGTCCCAGAGGTATTGGCCTGATCTCTGCCGTTTCTAACAGAATCGGCGCCAAGTCGTACCTCAAGAAGGATTCGCTACGATCCTGTGGTCTCAAGCTTGTTGAGGAGCTTCTTGCACAA
GGCAGCTCGATTGACCATGTTACTGACAACCTCTGGCTAACTGCCTTTGGAGGCATTGGCGTTCCTGTTACAGCC
TTTTACGAGGTTTTGGCCTTTTTCCTCCGCCCCGAGAATGCGTCT
ATCTGGGCTGAAGTTCAGGCCATCGCTCAAAAGGGTGATGATGCGACACTCCACGCCTATGTTGCCGAAGCTCTGCGCATGACGAGCTCCCAGCGCAATGTTCGTATTTCCAAGACACCA
GGTGAAGTTGATGGCCAATCCATCGCGCCTGGAACAGCCGTTGTTCTCATGCTT
GGTGAAGCCGGACGAAACCCCAAGGAGATTCCAGATGCCGACAAGTTCAACGCCCAGCGCAAGCAG
CAAGAAGTATCGGCATTCAGCTATGGTCAACACGAGTGTGTCGCCAAGGACGTTGCCCTCGCTTTTGTTACCGGTCTTATCAAGCTTGTTGCCGATCTCAAAGAACTTCGACCGGCACCT
GGCCAGATGGGAACTGTCAAGACAATTCGTGTTGGTACCGAGAAGGCTTATCTCAACGACAGCTGGTCGTACCTTGGATTTGATGCTAGCA
CTTGGAAGGTACACTTCAACGGCCATGGC
AAGGGTAACTTTGAAGGTGACAGAGTCCCTACGAGCAACACTCCCATCCAGGAATACTACTCGTTGCTCCAGAAGCGCAAGGACGAGCTTCTGCGTCGATAA

Retrieve as FASTA