Entry information : MgrLDS01
Entry ID 5336
Creation 2007-05-11 (Marcel Zamocky)
Last sequence changes 2012-04-23 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: MgrLDS01
Name MgrLDS01
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Magnaporthaceae Magnaporthe
Organism Magnaporthe grisea (Pyricularia grisea)    [TaxId: 148305 ]
Cellular localisation N/D
Tissue types Appressorium
Conidia
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MgrLDS01
start..stop
S start..stop
AalcLDS01 1541 0 47..1109 62..1121
GzLDS01 1438 0 33..1108 36..1105
GmoLDS01 1437 0 12..1108 9..1093
FoLDS01 1427 0 32..1108 31..1093
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1076064..1076322 259 N° 2 1075725..1075963 239 N° 3 1075043..1075648 606 N° 4 1073010..1074926 1917
N° 5 1072607..1072915 309  
complement(join(1072607..1072915,1073010..1074926,1075043..1075648,1075725..1075 963,1076064..1076322))


exon

Literature and cross-references MgrLDS01
Literature REFERENCE 1 Dean RA, Talbot NJ, Ebbote DJ, Farman ML, Mitchell TK, Orbach MJ, ... and Birren BW "The genome sequence of the rice blast fungus Magnaporthe grisea." Nature 434 (7036), 980-986 (2005).
REFERENCE 2 Choi,W., Fang,E., Sasinowski,M., Wing,R. and Dean,R.A. Expressed sequence characterization during appressorium formation in rice blast fungus, Magnaporthe grisea. Unpublished (1998)
DNA ref. JGI genome:   Supercontig_6.28 (1076322..1072607)
Cluster/Prediction ref. UniGene:   Mgr.14401
Protein sequence: MgrLDS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1109
PWM (Da):   %s   124477.96  
PI (pH):   %s   8.58
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSKESPSRKSSTIGQSTRNGSCQADTQKGQLPPVGEKPKPVKENPMKKLKEMSQRPLPTQHGDGTYPTEKKLTGIGEDLKHIRGYDVKTLLAMVKSKLKGEKLKDDKTMLMERVMQLVARLPTESKKRAELTDSLINELWESLDHPPLNYLGPEHSYRTPDGSYHPFNPQLGAAGSRYARSVIPTVTPPGALPDPGLIFDSIMGRTPNSYRKHPNNVSSILWYWATIIIHDIFWTDPRDINTNKSSSYLDLAPLYGNSQEMQDSIRTFKDGRMKPDCYADKRLAGMPPGVSVLLIMFNRFHNHVAENLALINEGGRFNKPSDLLEGEAREAAWKKYDNDLFQVARLVTSGLYINITLVDYVRNIVNLNRVDTTWTLDPRQDAGAHVGTADGAERGTGNAVSAEFNLCYRWHSCISEKDSKFVEAQFQNIFGKPASEVRPDEMWKGFAKMEQNTPADPGQRTFGGFKRGPDGKFDDDDLVRCISEAVEDVAGAFGARNVPQAMKVVETMGIIQGRKWNVAGLNEFRKHFHLKPYSTFEDINSDPGVAEALRRLYDHPDNVELYPGLVAEEDKQPMVPGVGIAPTYTISRVVLSDAVCLVRGDRFYTTDFTPRNLTNWGYKEVDYDLSVNHGCVFYKLFIRAFPNHFKQNSVYAHYPMVVPSENKRILEALGRADLFDFEAPKYIPPRVNITSYGGAEYILETQEKYKVTWHEGLGFLMGEGGLKFMLSGDDPLHAQQRKCMAAQLYKDGWTEAVKAFYAGMMEELLVSKSYFLGNNKHRHVDIIRDVGNMVHVHFASQVFGLPLKTAKNPTGVFTEQEMYGILAAIFTTIFFDLDPSKSFPLRTKTREVCQKLAKLVEANVKLINKIPWSRGMFVGKPAKDEPLSIYGKTMIKGLKAHGLSDYDIAWSHVVPTSGAMVPNQAQVFAQAVDYYLSPAGMHYIPEIHMVALQPSTPETDALLLGYAMEGIRLAGTFGSYREAAVDDVVKEDNGRQVPVKAGDRVFVSFVDAARDPKHFPDPEVVNPRRPAKKYIHYGVGPHACLGRDASQIAITEMFRCLFRRRNVRRVPGPQGELKKVPRPGGFYVYMREDWGGLFPFPVTMRVMWDDE*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns) and 8 ESTs. Strain="70-15". Fusion of heme peroxidase domain with cytochrome P450
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCCAAGGAGTCACCGAGCCGCAAGAGCTCAACCATTGGGCAGTCTACCAGGAATGGCAGCTGCCAGGCTGACACGCAAAAGGGTCAACTCCCCCCCGTGGGGGAGAAGCCGAAA
CCTGTCAAGGAGAACCCCATGAAGAAGCTCAAGGAGATGTCCCAGCGTCCACTCCCCACGCAGCACGGCGACGGAACATATCCCACCGAGAAGAAATTGACTGGTATCGGGGAGGACCTC
AAGCATATTCGTGGTTACG
GTCAGTTGTGTTGCAATGCAATGTTCTTTCGAACAGACCTGTGTGTTTGTGTGTTTGGGTGTGTGTATGTGTGTGTGCCTCGCGTCCTAACTTGCCGCAGA
TGTCAAGACTCTCCTCGCCATGGTCAAGTCCAAGCTCAAGGGAGAGAAGCTAAAGGACGACAAGACCATGTTGATGGAGCGGGTGATGCAGCTCGTCGCTAGACTCCCTACCGAGTCCAA
GAAGCGTGCCGAGCTCACCGACTCGCTGATCAATGAGCTATGGGAGTCTCTCGACCACCCTCCGCTCAACTATCTCGGCCCCGAGCACTCGTACCGCACGCCTGATGGAAGCTACAAC
GT
ACGTGTGCTGCCACTGCTGCAAGAAAATAAATATAAGAAGAAAAAACAAAAATAAATGGCTAACATACAAGCAGCATCCCTTCAACCCGCAGCTCGGCGCGGCAGGCTCCCGCTACGCCC
GGTCCGTCATACCCACCGTCACGCCTCCGGGTGCGCTGCCAGACCCTGGGCTGATCTTTGACTCGATCATGGGACGCACGCCAAACTCGTACCGCAAGCATCCCAACAACGTCTCATCTA
TTCTGTGGTACTGGGCGACCATCATCATCCATGACATCTTTTGGACCGATCCTCGCGACATCAACACCAACAAGTCGTCGTCGTATCTCGACCTGGCGCCTCTCTACGGCAACAGCCAGG
AGATGCAGGACTCGATTCGTACCTTCAAGGATGGTCGGATGAAGCCCGACTGCTACGCCGACAAGAGGCTTGCAGGGATGCCGCCTGGCGTCAGCGTCCTCTTGATCATGTTCAACCGCT
TCCACAACCACGTGGCCGAGAACCTTGCCCTGATCAACGAGGGTGGCAGGTTCAACAAGCCCAGTGACCTGCTCGAGGGGGAGGCCAGGGAGGCTGCCTGGAAAAAGTACGACAATGACC
TGTTCCAGGTGGCACGTCTGGTGACCTCGGGTCTGTACATCAACATCACCCTGGTGGATTACGTTCGGAATATTGTGAAT
GTGAGTTGGGATTAAATCCTCATCCCATCCTTTACCTTTT
TTTACTTTTAACCTACATTGGCCTATTAAGTAGGTACTGTACCTTGTTTTGCACCACTCGCTGACAGTGTTCACAGCTTAACCGTGTCGACACCACATGGACCCTGGACCCCCGCCAAGA
TGCTGGTGCCCACGTCGGTACCGCTGACGGAGCCGAGCGGGGCACGGGCAACGCCGTCTCGGCCGAGTTCAACCTCTGCTACCGTTGGCACTCGTGCATCTCGGAGAAGGACAGCAAGTT
TGTCGAGGCGCAGTTCCAAAACATCTTTGGCAAGCCGGCCTCCGAGGTCCGTCCCGACGAGATGTGGAAGGGCTTTGCCAAGATGGAACAAAACACCCCCGCGGACCCCGGTCAGCGCAC
CTTTGGCGGCTTCAAGCGTGGTCCCGACGGCAAGTTTGACGATGACGATCTCGTGCGCTGCATTTCAGAGGCCGTCGAGGACGTCGCCGGCGCTTTCGGTGCCCGTAACGTGCCTCAGGC
CATGAAGGTTGTCGAGACCATGGGTATCATTCAGGGCAGGAAGTGGAACGTCGCCGGTCTGAACGAGTTCCGCAAGCATTTCCACCTCAAGCCGTACTCCACCTTTGAGGACATCAACTC
GGATCCTGGTGTCGCCGAGGCCCTCCGTCGTCTTTACGACCACCCGGATAACGTCGAGCTCTACCCTGGTTTGGTGGCCGAGGAGGACAAGCAGCCCATGGTCCCTGGTGTCGGAATCGC
ACCCACCTACACCATCAGCCGTGTCGTGCTTTCGGACGCCGTGTGCCTGGTGCGTGGAGACAGGTTCTACACCACCGACTTTACGCCTCGCAACCTGACCAACTGGGGCTACAAGGAGGT
CGACTACGATCTCAGTGTCAACCACGGTTGTGTCTTTTACAAGCTCTTCATCCGGGCCTTCCCCAACCACTTCAAGCAGAACTCGGTCTACGCCCACTACCCCATGGTGGTCCCGTCGGA
GAACAAGCGCATCCTGGAAGCCCTGGGCCGTGCAGACCTGTTCGACTTTGAAGCCCCCAAGTACATCCCGCCGCGCGTCAACATCACGTCGTACGGTGGTGCCGAGTACATCCTCGAGAC
GCAGGAAAAATACAAGGTCACGTGGCACGAGGGCCTCGGGTTCCTCATGGGCGAGGGAGGTCTCAAGTTTATGCTTTCGGGCGACGACCCGCTGCACGCGCAGCAGAGGAAGTGCATGGC
CGCTCAGCTGTACAAGGACGGCTGGACCGAGGCGGTCAAGGCCTTTTACGCCGGCATGATGGAGGAGCTGCTCGTCAGCAAGAGCTACTTCTTGGGCAACAACAAGCACCGCCACGTCGA
CATCATCAGGGACGTCGGCAACATGGTGCATGTGCACTTTGCCAGCCAGGTCTTTGGCCTTCCCCTCAAGACGGCCAAGAACCCGACCGGTGTCTTCACCGAGCAGGAGATGTACGGCAT
CCTGGCCGCCATCTTCACCACCATCTTCTTCGACCTCGACCCGTCCAAGTCGTTTCCCCTGCGCACCAAGACCCGCGAGGTCTGCCAAAAGCTGGCCAAGCTGGTCGAGGCCAACGTCAA
GCTCATCAACAAGATCCCCTGGTCCAGGGGCATGTTTGTCGGCAAGCCGGCCAAGGATGAGCCGCTGTCCATCTACGGCAAGACCATGATCAAGGGATTGAAGGCTCACGGCCTGAGCGA
CTACGACATTGCCTGGAGCCACGTCGTCCCCACCTCGGGCGCCATGGTCCCCAACCAGGCTCAGGTGTTTGCCCAAGCTGTCGACTACTACCTGTCTCCCGCCGGCATGCACTACATTCC
CGAGATCCACATGGTTGCCCTCCAGCCGTCCACCCCCGAGACTGATGCGCTCCTGCTAGGCTACGCCATGGAAGGTATCCGACTTGCTGGAACCTTTGGTTCGTACAGGGAGGCTGCCGT
CGACGACGTGGTGAAGGAGGATAACGGCCGCCAGGTGCCAGTCAAGGCTGGCGACCGCGTCTTTGTATCCTTT
GTAAGTTTGGACACCCTTTTTTTTTCTTTTTCTTTTTCTTTTTTTTT
TCTTTTGCTCTCCATCACCACAGAGTATCTGCTAACATACGACCCAGGTTGATGCCGCGCGTGACCCCAAACACTTCCCCGACCCAGAGGTGGTCAACCCCCGCCGCCCCGCCAAAAAGT
ACATTCACTACGGCGTTGGCCCCCACGCATGCCTGGGCAGGGATGCCAGCCAGATTGCCATCACCGAGATGTTCCGGTGCCTGTTCCGCCGCAGGAACGTCAGGAGGGTGCCGGGACCCC
AGGGAGAGCTGAAGAAGGTGCCCCGTCCCGGCGGCTTCTATGTCTACATGAGGGAGGACTGGGGTGGCTTGTTCCCCTTCCCCGTCACCATGCGGGTTATGTGGGATGACGAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCCAAGGAGTCACCGAGCCGCAAGAGCTCAACCATTGGGCAGTCTACCAGGAATGGCAGCTGCCAGGCTGACACGCAAAAGGGTCAACTCCCCCCCGTGGGGGAGAAGCCGAAA
CCTGTCAAGGAGAACCCCATGAAGAAGCTCAAGGAGATGTCCCAGCGTCCACTCCCCACGCAGCACGGCGACGGAACATATCCCACCGAGAAGAAATTGACTGGTATCGGGGAGGACCTC
AAGCATATTCGTGGTTACG
ATGTCAAGACTCTCCTCGCCATGGTCAAGTCCAAGCTCAAGGGAGAGAAGCTAAAGGACGACAAGACCATGTTGATGGAGCGGGTGATGCAGCTCGTCGCT
AGACTCCCTACCGAGTCCAAGAAGCGTGCCGAGCTCACCGACTCGCTGATCAATGAGCTATGGGAGTCTCTCGACCACCCTCCGCTCAACTATCTCGGCCCCGAGCACTCGTACCGCACG
CCTGATGGAAGCTACAAC
CATCCCTTCAACCCGCAGCTCGGCGCGGCAGGCTCCCGCTACGCCCGGTCCGTCATACCCACCGTCACGCCTCCGGGTGCGCTGCCAGACCCTGGGCTGATC
TTTGACTCGATCATGGGACGCACGCCAAACTCGTACCGCAAGCATCCCAACAACGTCTCATCTATTCTGTGGTACTGGGCGACCATCATCATCCATGACATCTTTTGGACCGATCCTCGC
GACATCAACACCAACAAGTCGTCGTCGTATCTCGACCTGGCGCCTCTCTACGGCAACAGCCAGGAGATGCAGGACTCGATTCGTACCTTCAAGGATGGTCGGATGAAGCCCGACTGCTAC
GCCGACAAGAGGCTTGCAGGGATGCCGCCTGGCGTCAGCGTCCTCTTGATCATGTTCAACCGCTTCCACAACCACGTGGCCGAGAACCTTGCCCTGATCAACGAGGGTGGCAGGTTCAAC
AAGCCCAGTGACCTGCTCGAGGGGGAGGCCAGGGAGGCTGCCTGGAAAAAGTACGACAATGACCTGTTCCAGGTGGCACGTCTGGTGACCTCGGGTCTGTACATCAACATCACCCTGGTG
GATTACGTTCGGAATATTGTGAAT
CTTAACCGTGTCGACACCACATGGACCCTGGACCCCCGCCAAGATGCTGGTGCCCACGTCGGTACCGCTGACGGAGCCGAGCGGGGCACGGGCAAC
GCCGTCTCGGCCGAGTTCAACCTCTGCTACCGTTGGCACTCGTGCATCTCGGAGAAGGACAGCAAGTTTGTCGAGGCGCAGTTCCAAAACATCTTTGGCAAGCCGGCCTCCGAGGTCCGT
CCCGACGAGATGTGGAAGGGCTTTGCCAAGATGGAACAAAACACCCCCGCGGACCCCGGTCAGCGCACCTTTGGCGGCTTCAAGCGTGGTCCCGACGGCAAGTTTGACGATGACGATCTC
GTGCGCTGCATTTCAGAGGCCGTCGAGGACGTCGCCGGCGCTTTCGGTGCCCGTAACGTGCCTCAGGCCATGAAGGTTGTCGAGACCATGGGTATCATTCAGGGCAGGAAGTGGAACGTC
GCCGGTCTGAACGAGTTCCGCAAGCATTTCCACCTCAAGCCGTACTCCACCTTTGAGGACATCAACTCGGATCCTGGTGTCGCCGAGGCCCTCCGTCGTCTTTACGACCACCCGGATAAC
GTCGAGCTCTACCCTGGTTTGGTGGCCGAGGAGGACAAGCAGCCCATGGTCCCTGGTGTCGGAATCGCACCCACCTACACCATCAGCCGTGTCGTGCTTTCGGACGCCGTGTGCCTGGTG
CGTGGAGACAGGTTCTACACCACCGACTTTACGCCTCGCAACCTGACCAACTGGGGCTACAAGGAGGTCGACTACGATCTCAGTGTCAACCACGGTTGTGTCTTTTACAAGCTCTTCATC
CGGGCCTTCCCCAACCACTTCAAGCAGAACTCGGTCTACGCCCACTACCCCATGGTGGTCCCGTCGGAGAACAAGCGCATCCTGGAAGCCCTGGGCCGTGCAGACCTGTTCGACTTTGAA
GCCCCCAAGTACATCCCGCCGCGCGTCAACATCACGTCGTACGGTGGTGCCGAGTACATCCTCGAGACGCAGGAAAAATACAAGGTCACGTGGCACGAGGGCCTCGGGTTCCTCATGGGC
GAGGGAGGTCTCAAGTTTATGCTTTCGGGCGACGACCCGCTGCACGCGCAGCAGAGGAAGTGCATGGCCGCTCAGCTGTACAAGGACGGCTGGACCGAGGCGGTCAAGGCCTTTTACGCC
GGCATGATGGAGGAGCTGCTCGTCAGCAAGAGCTACTTCTTGGGCAACAACAAGCACCGCCACGTCGACATCATCAGGGACGTCGGCAACATGGTGCATGTGCACTTTGCCAGCCAGGTC
TTTGGCCTTCCCCTCAAGACGGCCAAGAACCCGACCGGTGTCTTCACCGAGCAGGAGATGTACGGCATCCTGGCCGCCATCTTCACCACCATCTTCTTCGACCTCGACCCGTCCAAGTCG
TTTCCCCTGCGCACCAAGACCCGCGAGGTCTGCCAAAAGCTGGCCAAGCTGGTCGAGGCCAACGTCAAGCTCATCAACAAGATCCCCTGGTCCAGGGGCATGTTTGTCGGCAAGCCGGCC
AAGGATGAGCCGCTGTCCATCTACGGCAAGACCATGATCAAGGGATTGAAGGCTCACGGCCTGAGCGACTACGACATTGCCTGGAGCCACGTCGTCCCCACCTCGGGCGCCATGGTCCCC
AACCAGGCTCAGGTGTTTGCCCAAGCTGTCGACTACTACCTGTCTCCCGCCGGCATGCACTACATTCCCGAGATCCACATGGTTGCCCTCCAGCCGTCCACCCCCGAGACTGATGCGCTC
CTGCTAGGCTACGCCATGGAAGGTATCCGACTTGCTGGAACCTTTGGTTCGTACAGGGAGGCTGCCGTCGACGACGTGGTGAAGGAGGATAACGGCCGCCAGGTGCCAGTCAAGGCTGGC
GACCGCGTCTTTGTATCCTTT
GTTGATGCCGCGCGTGACCCCAAACACTTCCCCGACCCAGAGGTGGTCAACCCCCGCCGCCCCGCCAAAAAGTACATTCACTACGGCGTTGGCCCCCAC
GCATGCCTGGGCAGGGATGCCAGCCAGATTGCCATCACCGAGATGTTCCGGTGCCTGTTCCGCCGCAGGAACGTCAGGAGGGTGCCGGGACCCCAGGGAGAGCTGAAGAAGGTGCCCCGT
CCCGGCGGCTTCTATGTCTACATGAGGGAGGACTGGGGTGGCTTGTTCCCCTTCCCCGTCACCATGCGGGTTATGTGGGATGACGAGTAG

Retrieve as FASTA