Entry information : GzLDS01
Entry ID 5337
Creation 2007-05-11 (Marcel Zamocky)
Last sequence changes 2007-05-11 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: GzLDS01
Name GzLDS01
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Nectriaceae Gibberella
Organism Gibberella zeae (anamorph Fusarium graminearum)    [TaxId: 5518 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GzLDS01
start..stop
S start..stop
GmoLDS01 2056 0 7..1105 5..1093
FoLDS01 2038 0 7..1105 5..1093
AalcLDS01 1517 0 2..1105 11..1120
MgrLDS01 1451 0 23..1105 22..1108
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 795018..795279 262 N° 2 795342..795580 239 N° 3 795632..795824 193 N° 4 795877..797948 2072
N° 5 798009..798560 552  
join(795018..795279,795342..795580,795632..795824,795877..797948,798009..798560)


exon

Literature and cross-references GzLDS01
Literature REFERENCE 1 Birren B.W., et al. Fusarium graminearum genome sequence. Submitted (FEB-2004) to the EMBL/GenBank/DDBJ databases.
REFERENCE 2 Trail,F., Xu,J.-R., San Miguel,P., Halgren,R.G. and Kistler,H.C. Analysis of expressed sequence tags from Gibberella zeae (anamorph Fusarium graminearum). Fungal Genet. Biol. 38 (2), 187-197 (2003)
Protein ref. UniProtKB_Uniparc:   Q4HVP8
DNA ref. JGI genome:   Supercontig_3.8 (795018..798560)
Protein sequence: GzLDS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1105
PWM (Da):   %s   123867.15  
PI (pH):   %s   8.84
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASNQVKNGAVASNGYGKEKSPSSASSSQKNEVPAPPHNKSEGLVKSIKKLRLASKRPLPTEMGDGSYRQVATRPGLKQDVRRLRGKDLKTLLEIISSKLKGEMQQDDKTMIMERTIQLVANLSDHSKVQEALTNSFIAQLWNSIDHPPMLYMGNKYRFRQPDGSWNPYLPQLGAARTPYSRTVRPKGMSLGAQPDPEAIFESVFARGIFRKNPNNVSSILWYWATIIIHDLFWTNTKDPDQNDSSSYLDLAPLYGSTVKDRDSIRTFKDGQLKPDCFADKRLIGNPPGVPIILIMFNRFHNHVATNLADINEGGRFSKPGAHLDAEAAAAAWKKRDEELFETARLVTSGLYINITLIDYVRNIINLNRVDTTWTLDPRQEMGVSVGTKNLSESGTGNVVSAEFNLCYRWHSCLSEMDEKWVEDFYTELLGENYGPMNLQTMMRALKAFEATVAEEPSERTFGGFKRGPDGKFNDDELVEALATAIEQPGGAFGGRNVPRIMKPIEMLGIMRGRKWNLAGLNEFRKHFGLKAYDTFEDINSDPEVADALRNLYQHPDYVELYPGIVAEEAKTPMVPGVGIAPTYTISRVVLSDAVALVRGDRYYTIDYHPRNLTNWGYKEVDYDLNINHGCVFYKLFLRAFPQHFKGNSVYAHYPMVIPTENHKILTDLKRVDRFDFSRPAPTATRINIVGYKAAKYILEDQAKYRVCWEEGLKHLMGEGGGRFMLSGDTALHAQQRKCMGRLLYNDTWRNAVKSFYSTTAEMLLNEKSYTLAGKKQVDVVRDVGNVAHTHFVARMFNLPLKTKQNPKGVFSEQELYMILAVIFVCIFFDIDPAKSFPLRQAAREVAQQLGKIVEMNVKLATSVGIKGLFTSKPNKNDDPLAAYGENMAKGLKKAGLSIDDIVWSQILPTAGAMVPNQAQFAQTLDWYLSPAGEKYRPELHRIAALETGDETDALLLGYAMEGIRMAGTFGLYREATTADVIQEDDGREVPVKAGDRVFVSFVTAAKDPNIFPDPEVVDPRRPLDSYIHYGVGPHACLGRDISQVALTELFRALFRKKGLRRVAGAQGELKKVPRPGGFFVYMTEDWGSIWPFPTSMKVTWDE*

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 3, 4 introns) and 18 ESTs (3' end: BU068800, BU067710, BU067088, BI749858, BU068971, BU066630, BU067358...). Strain="PH-1 / NRRL 31084". Regions: 158-622 peroxidase domain; 674-1069 "CypX" cytochrome P450.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCGAACCAAGTAAAGAACGGCGCTGTCGCCTCGAATGGATATGGCAAGGAAAAATCCCCTTCTTCAGCTTCTTCAAGCCAGAAGAATGAGGTTCCTGCCCCGCCTCACAACAAG
AGTGAGGGTCTGGTCAAGAGCATCAAAAAGCTGCGCCTAGCTTCAAAGAGACCTCTCCCTACAGAGATGGGTGATGGCTCGTACCGACAGGTTGCGACCCGTCCAGGATTGAAGCAAGAT
GTTCGTCGTCTTCGCGGAAAAG
GTTAGTGAGCGAGTGGATGTGAGATCAACGAAGCAAGAGTGGTGAGCGCTAACGAGAAACAGATCTCAAGACATTGCTCGAGATCATCTCAAGCAAGC
TCAAGGGAGAGATGCAACAAGATGACAAGACCATGATCATGGAGCGAACGATCCAGCTGGTTGCAAATTTGAGCGATCATTCCAAAGTCCAGGAGGCTTTGACGAATAGCTTCATTGCGC
AGCTCTGGAACTCGATTGATCACCCACCTATGCTGTACATGGGAAACAAGTATCGTTTCCGCCAGCCTGACGGATCGTGGAAC
GTGAGTTGTCACTAAGTGAGCTTGGGGCAAACAATTG
ACTGACCTGTGTAGAACCCTTATCTTCCCCAGCTTGGTGCCGCTAGAACACCATACTCGAGAACAGTGCGTCCCAAGGGTATGAGTTTAGGTGCTCAGCCTGATCCAGAGGCCATTTTCG
AGTCTGTTTTTGCGCGAGGTATCTTCCGCAAGAACCCGAACAATGTGTCGAGTATCCTCTGGTACTGGGCCACAATCATTATCCATG
GTATGCCGCCTTCAATCTCAATACATCTCAGGC
AATGACTAACGCAATACAGACCTCTTCTGGACAAACACCAAAGACCCAGACCAAAACGACTCATCTTCCTACCTCGACCTTGCCCCTCTCTACGGCTCAACCGTGAAAGACCGCGACTCG
ATCCGAACATTCAAGGATGGCCAGCTCAAGCCCGATTGCTTCGCTGACAAGCGTCTCATCGGCAACCCTCCCGGTGTTCCCATCATCCTCATCATGTTCAACCGTTTCCACAATCACGTC
GCGACTAACCTCGCCGACATCAACGAAGGTGGTCGCTTCAGCAAGCCTGGCGCTCATCTCGACGCTGAAGCTGCTGCTGCCGCGTGGAAGAAGCGTGATGAGGAGCTGTTCGAGACCGCC
AGATTGGTCACGAGTGGATTGTACATCAACATCACTCTCATCGACTACGTGCGCAACATTATCAACCTGAACCGTGTTGACACGACTTGGACTCTTGATCCTCGCCAGGAGATGGGTGTC
TCTGTCGGCACCAAGAACCTTTCTGAGAGCGGCACTGGAAACGTGGTTTCAGCCGAGTTCAACCTGTGCTACCGCTGGCACTCTTGCCTGTCCGAGATGGATGAGAAATGGGTTGAGGAC
TTCTATACTGAACTTCTCGGTGAGAACTATGGCCCCATGAACCTGCAGACCATGATGAGGGCTCTCAAGGCATTCGAGGCAACAGTCGCCGAAGAGCCTTCCGAGCGTACCTTTGGCGGC
TTCAAGAGAGGCCCCGACGGCAAGTTCAACGATGATGAGCTTGTTGAGGCACTCGCTACGGCGATTGAACAGCCTGGTGGTGCTTTCGGTGGCCGTAACGTGCCACGTATTATGAAGCCC
ATCGAGATGCTCGGCATCATGCGAGGTCGCAAGTGGAACTTGGCAGGTCTGAACGAGTTCCGAAAGCACTTCGGTCTCAAGGCGTACGACACTTTTGAGGACATCAACTCAGATCCTGAA
GTCGCTGATGCCTTGCGGAACTTGTACCAACACCCCGACTACGTCGAACTGTACCCCGGTATCGTCGCAGAGGAGGCAAAGACGCCTATGGTTCCCGGTGTTGGTATCGCTCCCACGTAT
ACAATCTCCCGAGTGGTCCTCTCGGATGCTGTGGCTCTTGTTCGTGGTGACAGGTACTACACTATTGACTACCATCCCCGCAACTTGACCAACTGGGGTTACAAGGAGGTTGACTACGAC
CTCAACATCAACCATGGCTGCGTCTTCTATAAGCTCTTCCTGCGTGCATTCCCTCAACACTTCAAGGGTAACTCTGTCTACGCCCACTACCCCATGGTCATCCCCACAGAGAACCACAAG
ATTCTCACCGACCTGAAGCGCGTGGATCGTTTCGACTTCAGCCGTCCTGCACCCACAGCCACACGCATCAATATCGTGGGCTACAAGGCGGCTAAGTACATCCTGGAAGACCAGGCCAAG
TACCGTGTCTGCTGGGAGGAGGGCCTCAAGCACCTCATGGGCGAGGGTGGTGGTCGCTTCATGTTGTCTGGTGACACAGCGTTGCACGCACAGCAGCGCAAGTGCATGGGTCGTCTGCTG
TACAATGATACCTGGCGCAACGCGGTTAAGTCGTTCTACTCGACAACGGCCGAGATGCTTCTGAATGAAAAGTCGTACACGCTCGCGGGCAAGAAGCAGGTTGATGTCGTGCGTGACGTG
GGTAACGTTGCACACACGCACTTTGTCGCGAGGATGTTCAACCTTCCTCTCAAGACGAAGCAGAACCCCAAGGGTGTCTTTTCGGAGCAGGAGCTGTACATGATCCTGGCGGTTATCTTT
GTTTGCATCTTCTTCGACATTGATCCTGCTAAGTCTTTCCCTCTGAGACAAGCCGCCAGAGAGGTTGCACAGCAGCTGGGTAAGATTGTGGAGATGAACGTCAAGCTGGCCACCAGCGTT
GGCATCAAGGGTCTGTTCACCAGCAAGCCCAACAAGAACGATGACCCGCTTGCTGCGTATGGTGAGAACATGGCCAAGGGTCTCAAGAAGGCTGGTCTGAGCATTGATGACATCGTGTGG
AGCCAGATCTTGCCCACCGCTGGGGCTATGGTGCCGAATCAGGCTCAGGTG
GTAAGTCGAGTTCTATTTCGAGATTGGCGAGAGAAGTGTCGGCTAACAAATTGTGTGTAGTTTGCCCAA
ACCTTGGATTGGTATCTTTCTCCTGCTGGTGAGAAGTATCGCCCCGAGCTTCATCGTATTGCCGCTCTGGAGACAGGCGACGAGACAGATGCTCTGCTGCTTGGTTACGCGATGGAAGGT
ATTCGCATGGCTGGAACATTCGGACTGTACCGAGAAGCCACAACCGCGGATGTCATCCAAGAAGATGACGGCCGTGAAGTACCCGTCAAGGCTGGCGACAGGGTGTTCGTTTCCTTCGTC
ACTGCTGCCAAAGACCCTAACATCTTCCCCGACCCCGAGGTAGTCGATCCTCGTCGGCCGCTGGACTCGTATATCCACTATGGCGTAGGCCCACACGCATGTCTTGGAAGGGACATCAGC
CAGGTTGCGCTGACGGAGCTATTCAGAGCCCTATTCAGGAAGAAGGGCCTGAGGAGGGTGGCGGGTGCGCAGGGAGAGCTCAAGAAGGTGCCTCGACCTGGTGGTTTCTTTGTGTACATG
ACGGAGGACTGGGGCAGCATTTGGCCGTTCCCTACAAGTATGAAGGTAACATGGGATGAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCGAACCAAGTAAAGAACGGCGCTGTCGCCTCGAATGGATATGGCAAGGAAAAATCCCCTTCTTCAGCTTCTTCAAGCCAGAAGAATGAGGTTCCTGCCCCGCCTCACAACAAG
AGTGAGGGTCTGGTCAAGAGCATCAAAAAGCTGCGCCTAGCTTCAAAGAGACCTCTCCCTACAGAGATGGGTGATGGCTCGTACCGACAGGTTGCGACCCGTCCAGGATTGAAGCAAGAT
GTTCGTCGTCTTCGCGGAAAAG
ATCTCAAGACATTGCTCGAGATCATCTCAAGCAAGCTCAAGGGAGAGATGCAACAAGATGACAAGACCATGATCATGGAGCGAACGATCCAGCTGGTT
GCAAATTTGAGCGATCATTCCAAAGTCCAGGAGGCTTTGACGAATAGCTTCATTGCGCAGCTCTGGAACTCGATTGATCACCCACCTATGCTGTACATGGGAAACAAGTATCGTTTCCGC
CAGCCTGACGGATCGTGGAAC
AACCCTTATCTTCCCCAGCTTGGTGCCGCTAGAACACCATACTCGAGAACAGTGCGTCCCAAGGGTATGAGTTTAGGTGCTCAGCCTGATCCAGAGGCC
ATTTTCGAGTCTGTTTTTGCGCGAGGTATCTTCCGCAAGAACCCGAACAATGTGTCGAGTATCCTCTGGTACTGGGCCACAATCATTATCCATG
ACCTCTTCTGGACAAACACCAAAGAC
CCAGACCAAAACGACTCATCTTCCTACCTCGACCTTGCCCCTCTCTACGGCTCAACCGTGAAAGACCGCGACTCGATCCGAACATTCAAGGATGGCCAGCTCAAGCCCGATTGCTTCGCT
GACAAGCGTCTCATCGGCAACCCTCCCGGTGTTCCCATCATCCTCATCATGTTCAACCGTTTCCACAATCACGTCGCGACTAACCTCGCCGACATCAACGAAGGTGGTCGCTTCAGCAAG
CCTGGCGCTCATCTCGACGCTGAAGCTGCTGCTGCCGCGTGGAAGAAGCGTGATGAGGAGCTGTTCGAGACCGCCAGATTGGTCACGAGTGGATTGTACATCAACATCACTCTCATCGAC
TACGTGCGCAACATTATCAACCTGAACCGTGTTGACACGACTTGGACTCTTGATCCTCGCCAGGAGATGGGTGTCTCTGTCGGCACCAAGAACCTTTCTGAGAGCGGCACTGGAAACGTG
GTTTCAGCCGAGTTCAACCTGTGCTACCGCTGGCACTCTTGCCTGTCCGAGATGGATGAGAAATGGGTTGAGGACTTCTATACTGAACTTCTCGGTGAGAACTATGGCCCCATGAACCTG
CAGACCATGATGAGGGCTCTCAAGGCATTCGAGGCAACAGTCGCCGAAGAGCCTTCCGAGCGTACCTTTGGCGGCTTCAAGAGAGGCCCCGACGGCAAGTTCAACGATGATGAGCTTGTT
GAGGCACTCGCTACGGCGATTGAACAGCCTGGTGGTGCTTTCGGTGGCCGTAACGTGCCACGTATTATGAAGCCCATCGAGATGCTCGGCATCATGCGAGGTCGCAAGTGGAACTTGGCA
GGTCTGAACGAGTTCCGAAAGCACTTCGGTCTCAAGGCGTACGACACTTTTGAGGACATCAACTCAGATCCTGAAGTCGCTGATGCCTTGCGGAACTTGTACCAACACCCCGACTACGTC
GAACTGTACCCCGGTATCGTCGCAGAGGAGGCAAAGACGCCTATGGTTCCCGGTGTTGGTATCGCTCCCACGTATACAATCTCCCGAGTGGTCCTCTCGGATGCTGTGGCTCTTGTTCGT
GGTGACAGGTACTACACTATTGACTACCATCCCCGCAACTTGACCAACTGGGGTTACAAGGAGGTTGACTACGACCTCAACATCAACCATGGCTGCGTCTTCTATAAGCTCTTCCTGCGT
GCATTCCCTCAACACTTCAAGGGTAACTCTGTCTACGCCCACTACCCCATGGTCATCCCCACAGAGAACCACAAGATTCTCACCGACCTGAAGCGCGTGGATCGTTTCGACTTCAGCCGT
CCTGCACCCACAGCCACACGCATCAATATCGTGGGCTACAAGGCGGCTAAGTACATCCTGGAAGACCAGGCCAAGTACCGTGTCTGCTGGGAGGAGGGCCTCAAGCACCTCATGGGCGAG
GGTGGTGGTCGCTTCATGTTGTCTGGTGACACAGCGTTGCACGCACAGCAGCGCAAGTGCATGGGTCGTCTGCTGTACAATGATACCTGGCGCAACGCGGTTAAGTCGTTCTACTCGACA
ACGGCCGAGATGCTTCTGAATGAAAAGTCGTACACGCTCGCGGGCAAGAAGCAGGTTGATGTCGTGCGTGACGTGGGTAACGTTGCACACACGCACTTTGTCGCGAGGATGTTCAACCTT
CCTCTCAAGACGAAGCAGAACCCCAAGGGTGTCTTTTCGGAGCAGGAGCTGTACATGATCCTGGCGGTTATCTTTGTTTGCATCTTCTTCGACATTGATCCTGCTAAGTCTTTCCCTCTG
AGACAAGCCGCCAGAGAGGTTGCACAGCAGCTGGGTAAGATTGTGGAGATGAACGTCAAGCTGGCCACCAGCGTTGGCATCAAGGGTCTGTTCACCAGCAAGCCCAACAAGAACGATGAC
CCGCTTGCTGCGTATGGTGAGAACATGGCCAAGGGTCTCAAGAAGGCTGGTCTGAGCATTGATGACATCGTGTGGAGCCAGATCTTGCCCACCGCTGGGGCTATGGTGCCGAATCAGGCT
CAGGTG
TTTGCCCAAACCTTGGATTGGTATCTTTCTCCTGCTGGTGAGAAGTATCGCCCCGAGCTTCATCGTATTGCCGCTCTGGAGACAGGCGACGAGACAGATGCTCTGCTGCTTGGT
TACGCGATGGAAGGTATTCGCATGGCTGGAACATTCGGACTGTACCGAGAAGCCACAACCGCGGATGTCATCCAAGAAGATGACGGCCGTGAAGTACCCGTCAAGGCTGGCGACAGGGTG
TTCGTTTCCTTCGTCACTGCTGCCAAAGACCCTAACATCTTCCCCGACCCCGAGGTAGTCGATCCTCGTCGGCCGCTGGACTCGTATATCCACTATGGCGTAGGCCCACACGCATGTCTT
GGAAGGGACATCAGCCAGGTTGCGCTGACGGAGCTATTCAGAGCCCTATTCAGGAAGAAGGGCCTGAGGAGGGTGGCGGGTGCGCAGGGAGAGCTCAAGAAGGTGCCTCGACCTGGTGGT
TTCTTTGTGTACATGACGGAGGACTGGGGCAGCATTTGGCCGTTCCCTACAAGTATGAAGGTAACATGGGATGAGTAG

Retrieve as FASTA