Entry information : FoLDS01
Entry ID 5339
Creation 2007-05-11 (Marcel Zamocky)
Last sequence changes 2007-05-11 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: FoLDS01
Name FoLDS01
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Fusarium
Organism Fusarium oxysporum    [TaxId: 5507 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value FoLDS01
start..stop
S start..stop
GmoLDS01 2252 0 1..1093 1..1093
GzLDS01 2031 0 5..1093 7..1105
AalcLDS01 1491 0 25..1093 41..1120
MgrLDS01 1432 0 15..1093 9..1108
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 870945..871194 250 N° 2 870608..870846 239 N° 3 870355..870547 193 N° 4 868232..870279 2048
N° 5 867621..868172 552  
complement(join(867621..868172,868232..870279,870355..870547,870608..870846,8709 45..871194))


exon

Literature and cross-references FoLDS01
Literature Broad Institute genome project, unpublished.
DNA ref. JGI genome:   Supercontig_2.17 (871194..867621)
Protein sequence: FoLDS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1093
PWM (Da):   %s   122559.39  
PI (pH):   %s   8.84
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAEHKNGVATNGYEKKSSPASSSTKSEAKPLPNSDKKDGIVKSFKQLRVASKRPLPKEMGDGSYRVVENRPGLKQDIRRLRGRDLKTLLEIVKAKVKGETQQDDKTMIMERTIQLVANLSDHSKVQESLTNSFISQLWNSIDHPPMLYMGDKFRFRQPDGSNNPYLPQLGAARTPYSRTVRPKGMSLGAQPDPEAIFESVFARDAFRKNPNNVSSILWYWATIIIHDPNQNDSSSYLDLAPLYGSTEKDRDSIRTFKDGQLKPDCFADKRLIGNPPGVPILLIMFNRFHNHVATNLADINEGGRFSKPAEHLSPEAADAAWKKRDTELFETARLVTSGLYINITLIDYVRNIINLNRVDTTWTLDPRQEMGVSVGTKDLSESGTGNVVSAEFNLCYRWHSCLSEMDDKWVQDFYTELLGENYGPMNLQTMMKALKAFEASVADEPSERTFGGFKRGPDGKFNDDELVEALATAIEQPGGAFGGRNVPRIMKPIEMLGIMRGRKWNLAGLNEFRKHFGLKAYETFEDINSDPSVADALRNLYQHPDYVELYPGIVAEEAKTPMVPGVGIAPTYTISRVVLSDAVALVRGDRYYTTDYNPRHLTNWGYKEVDYDLKVNHGCVFYKLFLRAFPQHFKGNSVYAHYPMVIPSENEKILTNIKRADRFDFSRPEPTATRINIIGYNAAKYILEDQQKYRVCWEEGLKHLMGEAGGRFMLSGDTALHAQQRKCMGKLLYNDTWRNAVKSFYATTAEKLLAEKSYRLAGKMQVDVVRDVGNVAHTHFVARMFNLPLKTSENPKGVFSEQELYMILAVIFVCIFFDIDPAKSFPLRQGAREVAQKLGGIIEMNVKLANSIGVKGLFTSKPDKNDDPLARYGENMAKGLKKAGLSTEDIVWSQILPTAGAMVPNQAQFAQTLDWYLSPAGEKYRPELARIAALETGDETDALLLGYAMEGIRMAGTFGLYREATGPDTIHEDDGRSIPVNAGDRVFVSFVQAAQDPKIFPNPGVVDPKRPLDKYIHYGVGPHACLGRDISQVALTELFRAVFRKKGVRRVPGAQGELKKVPRPGGFFVYMTEDWGSIWPFPTSMKITWDE*

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 9, 4 introns predicted with FGENESH), no EST. Contig position: 248365-244795. Fusion of heme peroxidase domain with cytochrome P450. Format="sp. lycopersici" and Strain="4286".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGAACACAAGAATGGCGTAGCTACAAACGGCTACGAGAAGAAATCTTCTCCTGCTTCGTCTTCTACCAAATCTGAAGCTAAGCCTCTTCCTAACAGCGATAAGAAGGATGGTATC
GTCAAGAGCTTCAAGCAACTCCGTGTCGCGAGTAAACGGCCGCTCCCGAAGGAGATGGGCGATGGGTCGTATCGTGTTGTGGAGAATAGACCGGGTTTGAAGCAAGACATTCGACGTCTT
CGTGGAAGAG
GTATGTTCTCAATCTCCACTTTGCCATTCGTCTTGAGCGTGAAGCTGGTGTAGTGATTGATGAATGGAGTGTTGAGTGAATGAAGCTGATTGAAGTAGATCTGAAGACGT
TGCTCGAGATCGTCAAGGCCAAAGTCAAGGGTGAAACTCAACAGGATGACAAGACGATGATCATGGAGCGCACGATCCAGCTCGTCGCTAATCTGAGTGATCACTCCAAGGTTCAGGAGT
CTTTGACGAATAGTTTCATCTCGCAGCTTTGGAACTCGATCGATCATCCACCTATGCTGTACATGGGAGACAAGTTTCGGTTCAGGCAGCCTGATGGGTCCAACAAT
GTAAGTCTACACT
CTGTCTTGCTTCCGCCGATGCTTAGTTAATTGGTACTGACGATTTAGAACCCGTATCTTCCTCAATTGGGCGCCGCGAGAACCCCCTACTCTAGAACCGTCCGTCCCAAGGGCATGAGTC
TCGGTGCGCAGCCTGATCCCGAGGCTATTTTCGAGAGTGTCTTTGCGAGAGACGCTTTTAGGAAGAATCCGAACAATGTTTCGAGTATTCTTTGGTACTGGGCCACTATTATCATTCACG
GTAAGCTCCCTCCATTCACCTCATGCCTCATCAATTGACTAACATCCGCAGACCTCTTCTGGACAAACCTCCAAGACCCTAACCAGAACGACTCCTCCTCCTATCTCGACCTCGCCCCTC
TCTACGGCTCAACCGAAAAAGACCGCGACTCAATCAGAACATTCAAGGACGGTCAATTGAAACCTGATTGTTTCGCTGATAAGCGTCTGATCGGTAATCCACCCGGTGTTCCCATCCTTC
TCATCATGTTCAACCGCTTTCACAACCATGTCGCCACGAACCTCGCAGACATCAACGAGGGCGGTCGCTTCTCCAAACCAGCTGAGCATCTCTCCCCCGAAGCTGCAGATGCTGCTTGGA
AGAAGCGCGACACGGAGCTCTTCGAAACAGCGAGACTTGTTACCAGTGGGCTGTACATCAACATCACGCTTATTGACTATGTGAGAAACATCATCAATTTGAACAGGGTTGATACGACGT
GGACTCTTGATCCGAGACAGGAAATGGGCGTTAGTGTCGGCACGAAGGACTTGTCGGAGAGTGGCACTGGAAACGTCGTCTCTGCTGAATTCAACCTTTGCTATCGCTGGCACTCGTGTC
TCTCAGAGATGGACGACAAGTGGGTTCAGGATTTCTACACTGAGCTTCTTGGTGAGAACTATGGGCCTATGAACCTGCAGACTATGATGAAGGCACTCAAAGCGTTCGAGGCTAGTGTTG
CTGATGAGCCGAGTGAGAGAACCTTTGGCGGCTTCAAGAGAGGTCCTGATGGCAAGTTCAACGATGATGAACTGGTTGAGGCGCTGGCTACGGCTATTGAACAGCCTGGTGGTGCATTCG
GCGGACGTAATGTTCCACGCATCATGAAGCCTATTGAGATGCTGGGTATCATGCGTGGGAGGAAGTGGAACTTGGCGGGATTGAATGAGTTTAGGAAGCATTTCGGGTTGAAGGCGTATG
AGACGTTTGAGGACATCAACTCTGATCCCTCCGTCGCTGATGCCCTGCGCAATCTGTATCAGCATCCTGATTACGTCGAGTTGTACCCTGGCATCGTCGCCGAGGAAGCAAAGACTCCCA
TGGTTCCTGGTGTTGGTATCGCACCGACTTACACCATCTCTCGAGTCGTCCTCTCCGATGCCGTGGCGCTGGTCAGAGGTGATAGGTACTACACCACCGACTACAACCCTCGCCACTTGA
CGAACTGGGGATACAAGGAAGTCGATTACGATCTCAAGGTCAACCACGGCTGTGTCTTTTACAAACTCTTCCTCCGTGCATTCCCCCAGCACTTCAAGGGCAACTCCGTCTACGCTCACT
ACCCAATGGTCATCCCCTCTGAGAACGAGAAGATCCTCACAAACATCAAGCGCGCAGACCGTTTTGACTTTTCCCGTCCCGAACCCACAGCCACACGTATCAATATCATCGGGTACAACG
CGGCAAAGTACATTCTCGAGGACCAGCAAAAGTACCGCGTCTGCTGGGAAGAAGGCCTCAAGCACCTCATGGGCGAAGCAGGCGGTCGCTTCATGCTATCGGGCGACACGGCGCTGCACG
CCCAGCAGCGTAAGTGCATGGGCAAGCTCTTGTACAACGACACGTGGCGCAATGCAGTGAAGTCGTTTTATGCGACGACCGCTGAGAAACTACTCGCGGAGAAGTCGTACAGACTTGCGG
GGAAGATGCAGGTTGATGTTGTACGGGACGTGGGTAACGTTGCGCACACGCACTTTGTCGCGAGGATGTTTAACCTGCCCCTCAAGACGAGTGAGAATCCAAAGGGTGTGTTCTCCGAGC
AGGAGCTGTACATGATTCTCGCTGTCATCTTTGTCTGCATCTTCTTTGACATTGATCCTGCCAAGAGTTTCCCGCTTAGACAGGGTGCGCGAGAGGTTGCGCAGAAACTTGGTGGTATTA
TTGAGATGAACGTCAAGCTGGCGAATAGCATTGGTGTCAAGGGACTTTTCACTAGCAAGCCGGATAAGAATGATGATCCGCTGGCGAGGTATGGTGAGAATATGGCGAAGGGATTGAAGA
AGGCGGGCTTGAGTACGGAGGATATTGTCTGGAGTCAGATCCTGCCTACGGCTGGTGCTATGGTGCCCAACCAGGCTCAAGTG
GTAAGTCAAACTTCCCCTACTCGTCAATTGAGTGAGT
GAGTGAGTGCTAATGAGATTAGTTTGCGCAAACGCTGGATTGGTATCTCTCCCCAGCAGGCGAGAAATACCGCCCCGAACTAGCCCGCATCGCCGCCCTCGAAACAGGCGACGAGACAGA
CGCCTTGCTCCTCGGCTACGCAATGGAAGGCATCCGCATGGCCGGCACATTCGGTCTCTACCGCGAAGCCACAGGCCCCGACACAATCCACGAAGACGACGGCCGCAGCATCCCCGTCAA
CGCCGGCGACCGCGTCTTCGTATCGTTCGTTCAAGCCGCCCAAGACCCCAAGATCTTCCCCAACCCTGGAGTCGTGGACCCGAAGCGTCCGCTGGATAAGTACATCCACTATGGCGTTGG
ACCGCACGCGTGTCTGGGACGGGATATCAGCCAGGTTGCGCTCACGGAGCTATTCAGAGCGGTGTTTAGGAAGAAGGGTGTTAGGAGAGTGCCGGGCGCGCAGGGAGAGTTAAAGAAGGT
GCCGAGACCGGGCGGTTTCTTTGTCTATATGACGGAGGATTGGGGAAGCATTTGGCCGTTTCCTACAAGCATGAAGATTACCTGGGATGAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGAACACAAGAATGGCGTAGCTACAAACGGCTACGAGAAGAAATCTTCTCCTGCTTCGTCTTCTACCAAATCTGAAGCTAAGCCTCTTCCTAACAGCGATAAGAAGGATGGTATC
GTCAAGAGCTTCAAGCAACTCCGTGTCGCGAGTAAACGGCCGCTCCCGAAGGAGATGGGCGATGGGTCGTATCGTGTTGTGGAGAATAGACCGGGTTTGAAGCAAGACATTCGACGTCTT
CGTGGAAGAG
ATCTGAAGACGTTGCTCGAGATCGTCAAGGCCAAAGTCAAGGGTGAAACTCAACAGGATGACAAGACGATGATCATGGAGCGCACGATCCAGCTCGTCGCTAATCTGAGT
GATCACTCCAAGGTTCAGGAGTCTTTGACGAATAGTTTCATCTCGCAGCTTTGGAACTCGATCGATCATCCACCTATGCTGTACATGGGAGACAAGTTTCGGTTCAGGCAGCCTGATGGG
TCCAACAAT
AACCCGTATCTTCCTCAATTGGGCGCCGCGAGAACCCCCTACTCTAGAACCGTCCGTCCCAAGGGCATGAGTCTCGGTGCGCAGCCTGATCCCGAGGCTATTTTCGAGAGT
GTCTTTGCGAGAGACGCTTTTAGGAAGAATCCGAACAATGTTTCGAGTATTCTTTGGTACTGGGCCACTATTATCATTCACG
ACCCTAACCAGAACGACTCCTCCTCCTATCTCGACCTC
GCCCCTCTCTACGGCTCAACCGAAAAAGACCGCGACTCAATCAGAACATTCAAGGACGGTCAATTGAAACCTGATTGTTTCGCTGATAAGCGTCTGATCGGTAATCCACCCGGTGTTCCC
ATCCTTCTCATCATGTTCAACCGCTTTCACAACCATGTCGCCACGAACCTCGCAGACATCAACGAGGGCGGTCGCTTCTCCAAACCAGCTGAGCATCTCTCCCCCGAAGCTGCAGATGCT
GCTTGGAAGAAGCGCGACACGGAGCTCTTCGAAACAGCGAGACTTGTTACCAGTGGGCTGTACATCAACATCACGCTTATTGACTATGTGAGAAACATCATCAATTTGAACAGGGTTGAT
ACGACGTGGACTCTTGATCCGAGACAGGAAATGGGCGTTAGTGTCGGCACGAAGGACTTGTCGGAGAGTGGCACTGGAAACGTCGTCTCTGCTGAATTCAACCTTTGCTATCGCTGGCAC
TCGTGTCTCTCAGAGATGGACGACAAGTGGGTTCAGGATTTCTACACTGAGCTTCTTGGTGAGAACTATGGGCCTATGAACCTGCAGACTATGATGAAGGCACTCAAAGCGTTCGAGGCT
AGTGTTGCTGATGAGCCGAGTGAGAGAACCTTTGGCGGCTTCAAGAGAGGTCCTGATGGCAAGTTCAACGATGATGAACTGGTTGAGGCGCTGGCTACGGCTATTGAACAGCCTGGTGGT
GCATTCGGCGGACGTAATGTTCCACGCATCATGAAGCCTATTGAGATGCTGGGTATCATGCGTGGGAGGAAGTGGAACTTGGCGGGATTGAATGAGTTTAGGAAGCATTTCGGGTTGAAG
GCGTATGAGACGTTTGAGGACATCAACTCTGATCCCTCCGTCGCTGATGCCCTGCGCAATCTGTATCAGCATCCTGATTACGTCGAGTTGTACCCTGGCATCGTCGCCGAGGAAGCAAAG
ACTCCCATGGTTCCTGGTGTTGGTATCGCACCGACTTACACCATCTCTCGAGTCGTCCTCTCCGATGCCGTGGCGCTGGTCAGAGGTGATAGGTACTACACCACCGACTACAACCCTCGC
CACTTGACGAACTGGGGATACAAGGAAGTCGATTACGATCTCAAGGTCAACCACGGCTGTGTCTTTTACAAACTCTTCCTCCGTGCATTCCCCCAGCACTTCAAGGGCAACTCCGTCTAC
GCTCACTACCCAATGGTCATCCCCTCTGAGAACGAGAAGATCCTCACAAACATCAAGCGCGCAGACCGTTTTGACTTTTCCCGTCCCGAACCCACAGCCACACGTATCAATATCATCGGG
TACAACGCGGCAAAGTACATTCTCGAGGACCAGCAAAAGTACCGCGTCTGCTGGGAAGAAGGCCTCAAGCACCTCATGGGCGAAGCAGGCGGTCGCTTCATGCTATCGGGCGACACGGCG
CTGCACGCCCAGCAGCGTAAGTGCATGGGCAAGCTCTTGTACAACGACACGTGGCGCAATGCAGTGAAGTCGTTTTATGCGACGACCGCTGAGAAACTACTCGCGGAGAAGTCGTACAGA
CTTGCGGGGAAGATGCAGGTTGATGTTGTACGGGACGTGGGTAACGTTGCGCACACGCACTTTGTCGCGAGGATGTTTAACCTGCCCCTCAAGACGAGTGAGAATCCAAAGGGTGTGTTC
TCCGAGCAGGAGCTGTACATGATTCTCGCTGTCATCTTTGTCTGCATCTTCTTTGACATTGATCCTGCCAAGAGTTTCCCGCTTAGACAGGGTGCGCGAGAGGTTGCGCAGAAACTTGGT
GGTATTATTGAGATGAACGTCAAGCTGGCGAATAGCATTGGTGTCAAGGGACTTTTCACTAGCAAGCCGGATAAGAATGATGATCCGCTGGCGAGGTATGGTGAGAATATGGCGAAGGGA
TTGAAGAAGGCGGGCTTGAGTACGGAGGATATTGTCTGGAGTCAGATCCTGCCTACGGCTGGTGCTATGGTGCCCAACCAGGCTCAAGTG
TTTGCGCAAACGCTGGATTGGTATCTCTCC
CCAGCAGGCGAGAAATACCGCCCCGAACTAGCCCGCATCGCCGCCCTCGAAACAGGCGACGAGACAGACGCCTTGCTCCTCGGCTACGCAATGGAAGGCATCCGCATGGCCGGCACATTC
GGTCTCTACCGCGAAGCCACAGGCCCCGACACAATCCACGAAGACGACGGCCGCAGCATCCCCGTCAACGCCGGCGACCGCGTCTTCGTATCGTTCGTTCAAGCCGCCCAAGACCCCAAG
ATCTTCCCCAACCCTGGAGTCGTGGACCCGAAGCGTCCGCTGGATAAGTACATCCACTATGGCGTTGGACCGCACGCGTGTCTGGGACGGGATATCAGCCAGGTTGCGCTCACGGAGCTA
TTCAGAGCGGTGTTTAGGAAGAAGGGTGTTAGGAGAGTGCCGGGCGCGCAGGGAGAGTTAAAGAAGGTGCCGAGACCGGGCGGTTTCTTTGTCTATATGACGGAGGATTGGGGAAGCATT
TGGCCGTTTCCTACAAGCATGAAGATTACCTGGGATGAGTAG

Retrieve as FASTA