Entry information : PnoLDS01
Entry ID 5343
Creation 2007-05-14 (Marcel Zamocky)
Last sequence changes 2007-05-14 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PnoLDS01
Name PnoLDS01
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PnoLDS01
start..stop
S start..stop
AfumLDS01 1124 0 35..1107 11..1071
AorLDS01 1114 0 28..1107 4..1071
NfLDS01 1113 0 35..1107 11..1071
AclLDS01 1108 0 35..1107 11..1071
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 250745..254045 3301 N° 2 254101..254126 26  
join(250745..254045,254101..254126)


exon

Literature and cross-references PnoLDS01
Literature The Broad Institute Genome Sequencing Platform;
Birren B., et al., "Annotation of the Phaeosphaeria nodorum SN15 genome.";
Submitted (MAR-2005) to the EMBL/GenBank/DDBJ databases.
Protein ref. GenPept:   EAT84859 UniProtKB:   Q0ULH1
DNA ref. JGI genome:   scaffold_11 (250745..254126)
Protein sequence: PnoLDS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1108
PWM (Da):   %s   124078.25  
PI (pH):   %s   6.38
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASDAKAAWDSHVDTRTGITPPKPDEPSELAKLRASVGSKFGAFAALMGAAAAPVPQTGDGSKLAEEDPTVLKKIEGIMRDMSHLRIENMQTLLEAQKHKMTGELMDDKTYFMEGLIRTAAALPDGSKTRDTVTHSFLEQLWNDLEHPPQSYLGAKYQYRSADGSNNSLKHPQLGAAGTPYARTVKPSMMQTPARPDPGVVFDSIMTRKHAELHPNRISSMLFYLASIIIHDCFRTSHEDYSVSMTSSYLDLSPLYGSNQAEQDQMRTMIDGKIKPDCFSESRLLFFPPGVGALLIMFNRFHNYVVENLALVNEQNRFPKPAAEAPKSTGDEEKDEAAKAKYEKSKVKYDNDLFQTGRLITCGLYVNIILIDYVRTILDLNRTDSNWQLNPRAEMENVELGVGNQVSAEFNLVYRWHSTVSDRDEKWTQEMWDGLFGEGRDPKTVGKWEFLQRLNDVYKTTDPDPSKRKFAGLARNQDGTLPDQELVDMLVSSIEDCANSFGPNRVPSVFRAIEVLGIEQARSWNLGSLNEFRKHFDLEPHKTFEDITSDKYVQEQLKHLYDHPDKVEIYPGIVVEDAKKPMAPGSGLCPGYTTSRAVLSDAVALVRGDRFYTKDYNPSTLTNWGYRCVDSDTDIDNGCVFYKLFLRAFPNHFKQNSVYAHYPLTIPSAMQEALKDLKKDKLYDFSKPTPASTLHVVKEYKLATQILLDQSTFKVAWGKAMEFIMGPFGKEFSLAGDTPTNTASREMMSKALYVKDWEKDVRAFYTSKTKELLQEKSAHIADFNQVDIIRDVGNLAHVHFCAELFMLPLKTDERPHGIFTESELYLILSSVFALIFFDVDPAGSFPLHVKARKATQVLGSVIEKNVEAIAHGGLLHAVTKAIWPEQGGLQNYGIHMIQRLLQTGMPAPQLVWGHIFGTAGAMVANQGQLFAQTLEYYILGEGKAHWASIQALAHDESESAFAKLMHYAMEGGRLNGETAVMRDVAQDSTTTTIRAGDRVFVDLRAASHDPNVFPNPDSVDITRPLDAYIHLGFGPHQCLGLPMVRVIMTAMLKEVAKLKNLRPAPGPQGKIHKVEKGVGEEYPYHAYLTEMQDMYFPFPCSLKLVWDD

Retrieve as FASTA  
Remarks Complete sequence from genomic (no intron). No EST. Strain="SN15". Contig position: 88242-91541. Regions: 159-622 heme peroxidase domain; 685-1068 "CypX" cytochrome P450 domain.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCCGACGCAAAAGCTGCATGGGATAGCCATGTCGACACAAGGACTGGAATTACACCACCAAAGCCAGATGAGCCGTCTGAGCTTGCGAAATTGAGAGCCTCTGTGGGAAGCAAG
TTCGGAGCATTTGCGGCTCTCATGGGAGCTGCAGCAGCGCCGGTACCACAGACTGGAGATGGCTCCAAGCTTGCAGAAGAGGACCCAACTGTGCTCAAAAAGATAGAAGGTATCATGCGC
GACATGTCCCACCTCCGAATTGAGAACATGCAGACTCTCCTGGAAGCCCAGAAGCACAAAATGACCGGAGAGCTGATGGACGACAAGACTTACTTCATGGAAGGACTAATCCGAACTGCT
GCTGCGTTACCGGATGGCTCAAAAACTAGAGACACTGTTACCCATAGTTTCCTGGAGCAATTGTGGAATGATCTAGAGCATCCACCTCAATCTTACCTTGGAGCGAAGTACCAGTATAGG
TCGGCTGATGGCTCGAACAACAGCTTGAAACATCCCCAGCTCGGTGCGGCAGGAACACCATATGCGCGCACCGTCAAGCCCTCGATGATGCAGACTCCTGCGCGACCAGATCCTGGCGTT
GTGTTCGATAGCATCATGACGAGAAAGCATGCCGAGCTGCACCCAAACAGAATCTCAAGTATGCTTTTCTATCTGGCCTCCATCATCATACACGACTGCTTCAGGACCAGCCATGAAGAC
TACTCCGTCTCGATGACATCGTCATATCTGGATCTTTCGCCTCTGTATGGCAGCAATCAAGCAGAGCAGGACCAGATGAGAACGATGATAGACGGAAAGATCAAGCCAGATTGTTTCTCC
GAATCTCGTCTGCTGTTCTTCCCACCTGGAGTCGGCGCGCTGCTGATCATGTTCAACCGTTTCCACAACTATGTAGTGGAGAACCTCGCACTTGTCAATGAGCAGAACCGCTTCCCGAAG
CCTGCTGCAGAGGCGCCAAAGTCTACTGGTGATGAGGAAAAGGATGAGGCAGCCAAGGCCAAGTACGAAAAGTCCAAGGTAAAGTACGACAACGATTTGTTCCAGACTGGACGTCTCATC
ACGTGCGGTCTCTACGTCAACATCATCCTCATCGACTACGTCCGCACTATTCTGGACCTCAACCGCACAGACAGCAACTGGCAGCTCAATCCTCGTGCTGAGATGGAGAACGTCGAGCTC
GGTGTCGGTAACCAGGTTTCTGCAGAGTTCAACCTCGTCTACAGGTGGCACTCGACAGTATCTGACCGTGACGAAAAGTGGACTCAGGAGATGTGGGACGGCCTCTTTGGTGAAGGCCGA
GATCCAAAGACTGTCGGAAAGTGGGAGTTTCTCCAGCGTTTGAACGATGTGTACAAGACAACCGATCCAGACCCGTCGAAACGAAAGTTTGCCGGGCTGGCACGCAATCAGGATGGCACT
TTGCCAGATCAAGAACTCGTCGACATGCTCGTATCTAGTATTGAAGACTGTGCCAACTCTTTTGGACCGAACAGGGTGCCGTCAGTGTTCCGCGCCATCGAGGTCCTTGGTATCGAACAA
GCGCGAAGCTGGAATCTGGGCTCTTTGAATGAGTTCCGAAAACACTTCGATCTTGAGCCTCACAAGACTTTCGAAGACATTACCAGTGATAAGTATGTTCAAGAACAGCTCAAGCACCTC
TACGACCATCCGGACAAGGTCGAAATCTACCCCGGTATCGTAGTGGAAGATGCGAAGAAGCCCATGGCACCTGGCTCTGGTCTTTGCCCTGGATACACGACATCGCGCGCTGTACTGTCA
GATGCCGTTGCTCTTGTCCGTGGCGATCGCTTTTACACCAAGGACTACAACCCCAGCACACTCACGAACTGGGGCTATCGTTGTGTGGATAGCGATACTGACATCGACAATGGCTGCGTC
TTCTACAAGCTCTTCCTCCGAGCTTTCCCCAACCATTTCAAACAGAACAGCGTATATGCCCACTATCCGCTCACCATTCCATCCGCCATGCAAGAAGCTCTCAAGGATTTGAAGAAGGAC
AAGCTATACGACTTCTCGAAGCCGACGCCAGCAAGTACTCTGCATGTCGTCAAAGAATACAAACTCGCCACACAGATCTTGCTAGACCAATCCACCTTCAAGGTAGCCTGGGGCAAAGCA
ATGGAATTCATAATGGGCCCATTCGGCAAAGAGTTCTCGCTCGCCGGCGACACCCCAACCAACACTGCGTCGCGCGAGATGATGTCCAAAGCTCTATACGTAAAAGACTGGGAGAAAGAC
GTGCGAGCATTCTACACCTCCAAGACCAAAGAACTCCTGCAAGAAAAATCCGCACACATTGCAGACTTCAACCAAGTCGACATCATCCGCGATGTCGGCAATCTCGCCCACGTCCACTTC
TGCGCGGAGCTCTTCATGCTCCCGCTCAAAACCGACGAGCGCCCGCACGGCATCTTCACCGAGTCGGAGCTCTACCTGATCCTGTCCAGCGTGTTTGCGCTCATCTTCTTCGACGTCGAC
CCCGCGGGCTCGTTTCCGCTGCACGTCAAGGCGCGCAAGGCCACGCAAGTCCTCGGGTCGGTCATCGAGAAGAACGTCGAGGCCATCGCGCACGGCGGCCTGCTGCACGCCGTCACAAAG
GCCATCTGGCCCGAGCAAGGCGGGCTGCAGAACTACGGCATCCACATGATCCAGCGGCTCCTGCAGACGGGCATGCCCGCGCCGCAGCTCGTCTGGGGCCATATCTTCGGCACCGCGGGC
GCCATGGTCGCGAACCAGGGGCAGTTGTTTGCGCAGACGCTCGAGTACTACATCCTAGGCGAAGGCAAGGCGCACTGGGCTAGTATCCAGGCGCTCGCGCACGACGAGAGCGAGAGCGCG
TTTGCAAAACTGATGCATTACGCCATGGAGGGCGGGCGCTTGAATGGCGAAACGGCCGTCATGCGAGACGTCGCGCAAGACTCGACGACGACGACGATTAGGGCTGGCGACAGGGTTTTT
GTAGACCTCCGTGCTGCGTCGCATGATCCGAATGTCTTCCCCAACCCGGACTCCGTCGACATCACACGCCCGCTCGACGCGTACATTCATCTGGGCTTCGGCCCGCACCAGTGCCTTGGG
CTGCCGATGGTGCGCGTCATAATGACTGCGATGCTCAAGGAGGTCGCGAAGTTGAAGAATCTCCGGCCCGCGCCGGGGCCGCAGGGGAAGATACATAAAGTAGAGAAGGGCGTGGGCGAA
GAATATCCGTATCATGCATACTTGACGGAGATGCAGGATATGTACTTTCCGTTCCCTTGTT
GTAAGTTCTGAAATCCGCAGTGAGTTAGGGAGATATGCTAACTTGATTGTTGTAGCGCT
GAAGCTTGTTTGGGACGACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCCGACGCAAAAGCTGCATGGGATAGCCATGTCGACACAAGGACTGGAATTACACCACCAAAGCCAGATGAGCCGTCTGAGCTTGCGAAATTGAGAGCCTCTGTGGGAAGCAAG
TTCGGAGCATTTGCGGCTCTCATGGGAGCTGCAGCAGCGCCGGTACCACAGACTGGAGATGGCTCCAAGCTTGCAGAAGAGGACCCAACTGTGCTCAAAAAGATAGAAGGTATCATGCGC
GACATGTCCCACCTCCGAATTGAGAACATGCAGACTCTCCTGGAAGCCCAGAAGCACAAAATGACCGGAGAGCTGATGGACGACAAGACTTACTTCATGGAAGGACTAATCCGAACTGCT
GCTGCGTTACCGGATGGCTCAAAAACTAGAGACACTGTTACCCATAGTTTCCTGGAGCAATTGTGGAATGATCTAGAGCATCCACCTCAATCTTACCTTGGAGCGAAGTACCAGTATAGG
TCGGCTGATGGCTCGAACAACAGCTTGAAACATCCCCAGCTCGGTGCGGCAGGAACACCATATGCGCGCACCGTCAAGCCCTCGATGATGCAGACTCCTGCGCGACCAGATCCTGGCGTT
GTGTTCGATAGCATCATGACGAGAAAGCATGCCGAGCTGCACCCAAACAGAATCTCAAGTATGCTTTTCTATCTGGCCTCCATCATCATACACGACTGCTTCAGGACCAGCCATGAAGAC
TACTCCGTCTCGATGACATCGTCATATCTGGATCTTTCGCCTCTGTATGGCAGCAATCAAGCAGAGCAGGACCAGATGAGAACGATGATAGACGGAAAGATCAAGCCAGATTGTTTCTCC
GAATCTCGTCTGCTGTTCTTCCCACCTGGAGTCGGCGCGCTGCTGATCATGTTCAACCGTTTCCACAACTATGTAGTGGAGAACCTCGCACTTGTCAATGAGCAGAACCGCTTCCCGAAG
CCTGCTGCAGAGGCGCCAAAGTCTACTGGTGATGAGGAAAAGGATGAGGCAGCCAAGGCCAAGTACGAAAAGTCCAAGGTAAAGTACGACAACGATTTGTTCCAGACTGGACGTCTCATC
ACGTGCGGTCTCTACGTCAACATCATCCTCATCGACTACGTCCGCACTATTCTGGACCTCAACCGCACAGACAGCAACTGGCAGCTCAATCCTCGTGCTGAGATGGAGAACGTCGAGCTC
GGTGTCGGTAACCAGGTTTCTGCAGAGTTCAACCTCGTCTACAGGTGGCACTCGACAGTATCTGACCGTGACGAAAAGTGGACTCAGGAGATGTGGGACGGCCTCTTTGGTGAAGGCCGA
GATCCAAAGACTGTCGGAAAGTGGGAGTTTCTCCAGCGTTTGAACGATGTGTACAAGACAACCGATCCAGACCCGTCGAAACGAAAGTTTGCCGGGCTGGCACGCAATCAGGATGGCACT
TTGCCAGATCAAGAACTCGTCGACATGCTCGTATCTAGTATTGAAGACTGTGCCAACTCTTTTGGACCGAACAGGGTGCCGTCAGTGTTCCGCGCCATCGAGGTCCTTGGTATCGAACAA
GCGCGAAGCTGGAATCTGGGCTCTTTGAATGAGTTCCGAAAACACTTCGATCTTGAGCCTCACAAGACTTTCGAAGACATTACCAGTGATAAGTATGTTCAAGAACAGCTCAAGCACCTC
TACGACCATCCGGACAAGGTCGAAATCTACCCCGGTATCGTAGTGGAAGATGCGAAGAAGCCCATGGCACCTGGCTCTGGTCTTTGCCCTGGATACACGACATCGCGCGCTGTACTGTCA
GATGCCGTTGCTCTTGTCCGTGGCGATCGCTTTTACACCAAGGACTACAACCCCAGCACACTCACGAACTGGGGCTATCGTTGTGTGGATAGCGATACTGACATCGACAATGGCTGCGTC
TTCTACAAGCTCTTCCTCCGAGCTTTCCCCAACCATTTCAAACAGAACAGCGTATATGCCCACTATCCGCTCACCATTCCATCCGCCATGCAAGAAGCTCTCAAGGATTTGAAGAAGGAC
AAGCTATACGACTTCTCGAAGCCGACGCCAGCAAGTACTCTGCATGTCGTCAAAGAATACAAACTCGCCACACAGATCTTGCTAGACCAATCCACCTTCAAGGTAGCCTGGGGCAAAGCA
ATGGAATTCATAATGGGCCCATTCGGCAAAGAGTTCTCGCTCGCCGGCGACACCCCAACCAACACTGCGTCGCGCGAGATGATGTCCAAAGCTCTATACGTAAAAGACTGGGAGAAAGAC
GTGCGAGCATTCTACACCTCCAAGACCAAAGAACTCCTGCAAGAAAAATCCGCACACATTGCAGACTTCAACCAAGTCGACATCATCCGCGATGTCGGCAATCTCGCCCACGTCCACTTC
TGCGCGGAGCTCTTCATGCTCCCGCTCAAAACCGACGAGCGCCCGCACGGCATCTTCACCGAGTCGGAGCTCTACCTGATCCTGTCCAGCGTGTTTGCGCTCATCTTCTTCGACGTCGAC
CCCGCGGGCTCGTTTCCGCTGCACGTCAAGGCGCGCAAGGCCACGCAAGTCCTCGGGTCGGTCATCGAGAAGAACGTCGAGGCCATCGCGCACGGCGGCCTGCTGCACGCCGTCACAAAG
GCCATCTGGCCCGAGCAAGGCGGGCTGCAGAACTACGGCATCCACATGATCCAGCGGCTCCTGCAGACGGGCATGCCCGCGCCGCAGCTCGTCTGGGGCCATATCTTCGGCACCGCGGGC
GCCATGGTCGCGAACCAGGGGCAGTTGTTTGCGCAGACGCTCGAGTACTACATCCTAGGCGAAGGCAAGGCGCACTGGGCTAGTATCCAGGCGCTCGCGCACGACGAGAGCGAGAGCGCG
TTTGCAAAACTGATGCATTACGCCATGGAGGGCGGGCGCTTGAATGGCGAAACGGCCGTCATGCGAGACGTCGCGCAAGACTCGACGACGACGACGATTAGGGCTGGCGACAGGGTTTTT
GTAGACCTCCGTGCTGCGTCGCATGATCCGAATGTCTTCCCCAACCCGGACTCCGTCGACATCACACGCCCGCTCGACGCGTACATTCATCTGGGCTTCGGCCCGCACCAGTGCCTTGGG
CTGCCGATGGTGCGCGTCATAATGACTGCGATGCTCAAGGAGGTCGCGAAGTTGAAGAATCTCCGGCCCGCGCCGGGGCCGCAGGGGAAGATACATAAAGTAGAGAAGGGCGTGGGCGAA
GAATATCCGTATCATGCATACTTGACGGAGATGCAGGATATGTACTTTCCGTTCCCTTGTT
CGCTGAAGCTTGTTTGGGACGACTAA

Retrieve as FASTA