Entry information : CzmLDS01 (lds1)
Entry ID 5344
Creation 2007-05-14 (Marcel Zamocky)
Last sequence changes 2012-04-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-24 (Christophe Dunand)
Peroxidase information: CzmLDS01 (lds1)
Name (synonym) CzmLDS01 (lds1)
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Mycosphaerellaceae Cercospora
Organism Cercospora zeae-maydis    [TaxId: 135779 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CzmLDS01
start..stop
S start..stop
PnoLDS01 1104 0 2..1148 28..1106
NfLDS01 1035 0 7..1156 9..1078
AorLDS01 1025 0 13..1157 15..1079
AniLDS01 1024 0 13..1152 15..1074
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1148335..1150023 1689 N° 2 1147449..1148273 825 N° 3 1146425..1147390 966  
complement(join(1146425..1147390,1147449..1148273,1148335..1150023))


exon

Literature and cross-references CzmLDS01 (lds1)
Literature Choi Y.-E., Shim W.-B. Molecular characterization of linoleate diol synthase gene, LDS1, in maize pathogen Cercospora zeae-maydis. Submitted (AUG-2004) to the EMBL/GenBank/DDBJ databases.
Protein ref. UniProtKB:   Q3ZNB6 [Sequencing error]
DNA ref. GenBank:   AY707832 [Sequencing error] JGI genome:   scaffold_6 (1150023..1146425)
EST ref. GenBank:   FG246524.1 [3' end]   FG246523.1 [Fragment]
Protein sequence: CzmLDS01 (lds1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1159
PWM (Da):   %s   131095.2  
PI (pH):   %s   6.41
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSTLDRARTNVWQSLQQMRTLLNAVKAPLPTHTGDGSSLPQPEKDSLWKDVAEIFRDIPRQDVSDLEGLFKIIKSAKFGQPLNDKEYLMESMIAVATKMPDSFLQKKITETMVTTLWDDLEHPPKTLLSDEFLFRQPDGSNNSYLYPDIGKAGMPYARTVAPKVKQGGVLPDPAILFDSLMAREEGKHEQHPNKISSMLFYLASIIIHDIFRTDHDDYNKSNTSSYLDLAPLYGSNWKEQKRMRTFKDGKIKPDCFSETRLLTFPPGVGAMLICFNRYHNYVVEQLAAINEDGRFSVDPKKPTVSRYGDDKLDKRDDDLFQTARLITCGLYINIILIGRPGVITFLYRSLMIETDYVRTILNLNRTDDNWQLDPRIEIPDGPPVATGNQCAAEFNLVYRWHSSVSHRDDLWTQQLFREMFPGVSPADAAKPQHMYRFLGKLKEIQEDTESRMPNERDFPALKAEKMDRIKAGPFAGRYEDDDLANLLISSIEDCANAMGPRQVPTVMKAIEILGIQQARTWRCATLNEMRKHFDLQPHETFESITDNKEVQEALKHLYDTPDQVELYPGLVVEDAKDPKLPGSGLCPSYTTSRGVLSDAVALVRGDRFYTSSYTPALLTNWGYQEASSDLTIDNGCVFYKLFLRALPNSFNPASTYVHYPLTVPDEMHTILKGLNKAHLYNFDKPKESRHPIVLFSAEAAKKVTEDRETFKVTWGPAMEFLMGPRAKNFMLAGDGPKNTESRTVMEKAVYQGGSSRAMPKGNEKWLKAVRDFYEYKTTELLKEKSYKLGGTNYVDIIRDVSNMAHVHFGSELFSLPLKTKDFPRGIFTEAQMYLIMAAVFICVFFDLDPPKSFPLRVKAREACQQLGSLMKLQVESIKRTGRIAELLIDAIKPNDGPLGDYGVHMIAQLIRANPDMDVDELVWGNIMGTVGGMMPNQGQLFAQALDYFFTEGQSHWPEINRLAKLDTPEADDTLMHYLMEGARLYGETGAFRYATKDTTIVDDTGLENFPGSDKGKVTHNIKKGDVVMVNFKSASRDARAFPDPDKLDLTRDLDSYLVLGHGPHQCLGLPMTRVALTTMLKVIGRLDNLAPMPVAVGKMSEPHSVKKVMKEFVPGDGKVLPESWHYHLYLTEDWDQYFPFPTSLKVGWTGQVKDVQRRW*

Retrieve as FASTA  
Remarks Complete sequence from genomic. in NCBI files sequence on C-terminus shorter; regions: 223-614 heme peroxidase domain; 691-1125 "cypX" domain (cytochrome P450)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGACGCTTGATAGGGCACGCACGAATGTCTGGCAATCATTACAGCAAATGAGAACCCTCTTGAATGCGGTCAAAGCACCACTGCCAACACACACTGGAGATGGCTCCTCGCTGCCG
CAGCCAGAGAAAGATAGCCTGTGGAAGGATGTGGCCGAGATCTTCCGCGACATTCCCAGGCAAGATGTCAGTGACCTGGAGGGCCTGTTCAAGATTATCAAGTCTGCCAAGTTCGGCCAG
CCTCTCAACGACAAAGAGTACTTGATGGAAAGCATGATTGCAGTGGCCACGAAAATGCCTGACAGCTTTTTGCAAAAGAAAATCACCGAGACAATGGTCACAACGCTGTGGGACGATCTC
GAGCATCCTCCCAAGACACTCTTGAGCGACGAGTTCCTCTTCCGACAGCCCGATGGGAGCAACAACAGCTACTTGTACCCAGACATTGGAAAGGCCGGCATGCCTTATGCTCGTACGGTG
GCACCCAAAGTCAAACAAGGCGGCGTCTTGCCAGATCCCGCCATCTTGTTCGATTCGCTCATGGCTCGCGAAGAAGGCAAGCACGAGCAACACCCGAACAAGATTTCGTCCATGCTTTTC
TATCTTGCTTCAATCATCATCCACGACATTTTCCGCACGGATCACGATGACTACAACAAATCTAACACCTCATCATACCTCGATCTGGCGCCCTTATATGGGTCCAATTGGAAAGAGCAG
AAACGCATGCGGACATTCAAGGACGGCAAAATCAAGCCCGACTGCTTCTCCGAGACAAGACTCTTGACCTTTCCGCCTGGTGTTGGAGCAATGCTGATCTGCTTCAATCGGTACCATAAT
TATGTTGTCGAGCAGCTCGCCGCCATTAACGAAGACGGGAGATTCAGTGTCGACCCCAAGAAGCCTACCGTTTCCCGCTACGGTGACGACAAACTCGACAAGCGCGACGACGACCTGTTC
CAAACGGCTCGTCTCATTACCTGCGGGCTGTACATCAACATCATTCTTATTGGTAGGCCGGGAGTCATCACATTTCTGTATCGATCACTAATGATAGAAACAGATTACGTCCGAACTATC
CTGAACCTGAATCGAACCGATGACAACTGGCAGCTCGATCCGCGCATTGAAATCCCCGATGGCCCACCAGTAGCCACTGGCAACCAATGTGCAGCAGAATTTAATCTCGTCTATCGATGG
CATTCTTCTGTCTCCCATCGAGATGATCTATGGACACAGCAATTATTCAGAGAGATGTTCCCAGGAGTGTCGCCTGCGGACGCCGCAAAGCCACAGCACATGTACAGATTTCTCGGGAAG
CTCAAGGAGATTCAAGAGGACACAGAATCTAGGATGCCCAACGAGCGCGACTTCCCTGCGTTGAAGGCGGAGAAAATGGACCGAATCAAAGCTGGACCTTTCGCAGGCAGGTACGAGGAT
GATGACCTCGCCAATCTACTGATCAGTAGTATTGAGGACTGCGCCAATGCCATGGGCCCACGCCAAGTTCCCACCGTTATGAAAGCAATTGAGATTCTCGGCATCCAGCAGGCACGGACA
TGGAGGTGTGCAACATTGAACGAGATGCGAAAGCATTTCGACCTTCAGCCGCATGAGACTTTTGAGTCGATCACGGACAACAAAGAAGTACAAGAAGCTTTGAAGCATCTCTACGATACT
CCGGATCAG
GTGACGAAAACTGTACCAGCCATGCAACTGCATTGATGGAGACTGATGACTTGTGCTATAGGTCGAACTTTACCCCGGACTCGTCGTAGAAGACGCAAAGGACCCCAAACT
ACCTGGCTCTGGTCTTTGCCCATCATACACGACATCTCGCGGTGTCTTGTCCGATGCTGTCGCTTTAGTCCGTGGCGACAGATTCTACACAAGCTCGTACACCCCTGCACTGCTCACGAA
CTGGGGTTACCAAGAGGCCTCGTCAGATTTGACGATCGATAATGGCTGCGTCTTCTACAAGCTCTTCCTTCGTGCGCTACCAAACAGCTTTAACCCAGCTTCGACCTACGTGCACTACCC
TCTGACTGTGCCAGATGAGATGCACACTATCTTGAAGGGTCTGAACAAAGCTCATTTGTACAACTTTGACAAGCCCAAGGAGAGTCGTCACCCGATAGTACTTTTCAGTGCAGAAGCTGC
GAAGAAGGTCACCGAGGATCGGGAAACCTTCAAGGTCACCTGGGGTCCAGCAATGGAGTTCCTTATGGGACCCAGAGCCAAGAACTTTATGCTTGCTGGCGACGGTCCCAAGAATACCGA
GTCCAGGACTGTGATGGAGAAGGCGGTATATCAAGGTGGCTCTTCGCGTGCGATGCCAAAAGGCAACGAGAAGTGGCTAAAGGCTGTTCGCGACTTCTACGAGTACAAGACCACAGAGCT
ATTGAAGGAAAAGTCCTACAAGCTTGGTGGTACCAATTATGTCGACATCATCCGCGATGTGAGCAACATGGCCCATGTGCATTTTGGGTCTGAGCTATTCAGCCTCCCACTTAAAACCAA
GGACTTTCCTAGGGGGATTTTCACCGAGGCGCAGATGTACCTCATCATGGCTGCT
GTAAGTCTTTCATATTTGACATGCCGATATTGACAGATGGAAGCTGACTAAACTCCAGGTCTTCA
TTTGCGTCTTCTTCGATCTAGACCCACCCAAATCATTTCCTCTACGCGTCAAGGCTCGCGAAGCCTGCCAACAACTCGGATCGCTCATGAAGCTACAAGTCGAAAGCATCAAGCGTACAG
GCCGCATCGCAGAGCTCCTCATCGATGCCATCAAGCCCAATGATGGACCTCTCGGCGACTATGGTGTTCACATGATCGCCCAGCTCATCAGAGCCAATCCAGACATGGACGTGGACGAGC
TCGTTTGGGGAAACATCATGGGCACTGTTGGAGGCATGATGCCGAACCAAGGACAGCTTTTCGCCCAAGCTCTTGATTACTTCTTCACCGAAGGCCAATCGCACTGGCCGGAAATCAACC
GTCTTGCAAAACTCGACACCCCTGAAGCGGATGATACCCTAATGCACTATCTCATGGAAGGTGCTCGCCTCTACGGCGAAACTGGCGCTTTCCGCTACGCAACCAAGGACACCACCATCG
TCGACGACACCGGTCTCGAGAACTTCCCTGGCTCCGACAAAGGCAAAGTCACTCACAACATCAAAAAGGGAGACGTCGTCATGGTCAACTTCAAATCCGCTTCTCGTGATGCTCGAGCTT
TCCCTGATCCAGACAAACTTGACCTCACGCGCGACCTCGACAGCTACTTGGTTCTCGGCCACGGGCCGCACCAATGTCTCGGTCTTCCCATGACGCGTGTAGCTCTCACGACCATGCTCA
AAGTCATTGGCCGCCTCGACAACCTCGCGCCTATGCCCGTGGCGGTGGGGAAGATGAGCGAACCGCACAGCGTGAAGAAGGTCATGAAGGAGTTTGTGCCCGGCGACGGAAAGGTTTTGC
CCGAGAGTTGGCATTATCATCTTTATTTGACGGAGGATTGGGATCAGTATTTCCCGTTCCCGACTAGTTTGAAAGTTGGGTGGACGGGGCAGGTGAAGGATGTGCAGAGACGGTGGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGACGCTTGATAGGGCACGCACGAATGTCTGGCAATCATTACAGCAAATGAGAACCCTCTTGAATGCGGTCAAAGCACCACTGCCAACACACACTGGAGATGGCTCCTCGCTGCCG
CAGCCAGAGAAAGATAGCCTGTGGAAGGATGTGGCCGAGATCTTCCGCGACATTCCCAGGCAAGATGTCAGTGACCTGGAGGGCCTGTTCAAGATTATCAAGTCTGCCAAGTTCGGCCAG
CCTCTCAACGACAAAGAGTACTTGATGGAAAGCATGATTGCAGTGGCCACGAAAATGCCTGACAGCTTTTTGCAAAAGAAAATCACCGAGACAATGGTCACAACGCTGTGGGACGATCTC
GAGCATCCTCCCAAGACACTCTTGAGCGACGAGTTCCTCTTCCGACAGCCCGATGGGAGCAACAACAGCTACTTGTACCCAGACATTGGAAAGGCCGGCATGCCTTATGCTCGTACGGTG
GCACCCAAAGTCAAACAAGGCGGCGTCTTGCCAGATCCCGCCATCTTGTTCGATTCGCTCATGGCTCGCGAAGAAGGCAAGCACGAGCAACACCCGAACAAGATTTCGTCCATGCTTTTC
TATCTTGCTTCAATCATCATCCACGACATTTTCCGCACGGATCACGATGACTACAACAAATCTAACACCTCATCATACCTCGATCTGGCGCCCTTATATGGGTCCAATTGGAAAGAGCAG
AAACGCATGCGGACATTCAAGGACGGCAAAATCAAGCCCGACTGCTTCTCCGAGACAAGACTCTTGACCTTTCCGCCTGGTGTTGGAGCAATGCTGATCTGCTTCAATCGGTACCATAAT
TATGTTGTCGAGCAGCTCGCCGCCATTAACGAAGACGGGAGATTCAGTGTCGACCCCAAGAAGCCTACCGTTTCCCGCTACGGTGACGACAAACTCGACAAGCGCGACGACGACCTGTTC
CAAACGGCTCGTCTCATTACCTGCGGGCTGTACATCAACATCATTCTTATTGGTAGGCCGGGAGTCATCACATTTCTGTATCGATCACTAATGATAGAAACAGATTACGTCCGAACTATC
CTGAACCTGAATCGAACCGATGACAACTGGCAGCTCGATCCGCGCATTGAAATCCCCGATGGCCCACCAGTAGCCACTGGCAACCAATGTGCAGCAGAATTTAATCTCGTCTATCGATGG
CATTCTTCTGTCTCCCATCGAGATGATCTATGGACACAGCAATTATTCAGAGAGATGTTCCCAGGAGTGTCGCCTGCGGACGCCGCAAAGCCACAGCACATGTACAGATTTCTCGGGAAG
CTCAAGGAGATTCAAGAGGACACAGAATCTAGGATGCCCAACGAGCGCGACTTCCCTGCGTTGAAGGCGGAGAAAATGGACCGAATCAAAGCTGGACCTTTCGCAGGCAGGTACGAGGAT
GATGACCTCGCCAATCTACTGATCAGTAGTATTGAGGACTGCGCCAATGCCATGGGCCCACGCCAAGTTCCCACCGTTATGAAAGCAATTGAGATTCTCGGCATCCAGCAGGCACGGACA
TGGAGGTGTGCAACATTGAACGAGATGCGAAAGCATTTCGACCTTCAGCCGCATGAGACTTTTGAGTCGATCACGGACAACAAAGAAGTACAAGAAGCTTTGAAGCATCTCTACGATACT
CCGGATCAG
GTCGAACTTTACCCCGGACTCGTCGTAGAAGACGCAAAGGACCCCAAACTACCTGGCTCTGGTCTTTGCCCATCATACACGACATCTCGCGGTGTCTTGTCCGATGCTGTC
GCTTTAGTCCGTGGCGACAGATTCTACACAAGCTCGTACACCCCTGCACTGCTCACGAACTGGGGTTACCAAGAGGCCTCGTCAGATTTGACGATCGATAATGGCTGCGTCTTCTACAAG
CTCTTCCTTCGTGCGCTACCAAACAGCTTTAACCCAGCTTCGACCTACGTGCACTACCCTCTGACTGTGCCAGATGAGATGCACACTATCTTGAAGGGTCTGAACAAAGCTCATTTGTAC
AACTTTGACAAGCCCAAGGAGAGTCGTCACCCGATAGTACTTTTCAGTGCAGAAGCTGCGAAGAAGGTCACCGAGGATCGGGAAACCTTCAAGGTCACCTGGGGTCCAGCAATGGAGTTC
CTTATGGGACCCAGAGCCAAGAACTTTATGCTTGCTGGCGACGGTCCCAAGAATACCGAGTCCAGGACTGTGATGGAGAAGGCGGTATATCAAGGTGGCTCTTCGCGTGCGATGCCAAAA
GGCAACGAGAAGTGGCTAAAGGCTGTTCGCGACTTCTACGAGTACAAGACCACAGAGCTATTGAAGGAAAAGTCCTACAAGCTTGGTGGTACCAATTATGTCGACATCATCCGCGATGTG
AGCAACATGGCCCATGTGCATTTTGGGTCTGAGCTATTCAGCCTCCCACTTAAAACCAAGGACTTTCCTAGGGGGATTTTCACCGAGGCGCAGATGTACCTCATCATGGCTGCT
GTCTTC
ATTTGCGTCTTCTTCGATCTAGACCCACCCAAATCATTTCCTCTACGCGTCAAGGCTCGCGAAGCCTGCCAACAACTCGGATCGCTCATGAAGCTACAAGTCGAAAGCATCAAGCGTACA
GGCCGCATCGCAGAGCTCCTCATCGATGCCATCAAGCCCAATGATGGACCTCTCGGCGACTATGGTGTTCACATGATCGCCCAGCTCATCAGAGCCAATCCAGACATGGACGTGGACGAG
CTCGTTTGGGGAAACATCATGGGCACTGTTGGAGGCATGATGCCGAACCAAGGACAGCTTTTCGCCCAAGCTCTTGATTACTTCTTCACCGAAGGCCAATCGCACTGGCCGGAAATCAAC
CGTCTTGCAAAACTCGACACCCCTGAAGCGGATGATACCCTAATGCACTATCTCATGGAAGGTGCTCGCCTCTACGGCGAAACTGGCGCTTTCCGCTACGCAACCAAGGACACCACCATC
GTCGACGACACCGGTCTCGAGAACTTCCCTGGCTCCGACAAAGGCAAAGTCACTCACAACATCAAAAAGGGAGACGTCGTCATGGTCAACTTCAAATCCGCTTCTCGTGATGCTCGAGCT
TTCCCTGATCCAGACAAACTTGACCTCACGCGCGACCTCGACAGCTACTTGGTTCTCGGCCACGGGCCGCACCAATGTCTCGGTCTTCCCATGACGCGTGTAGCTCTCACGACCATGCTC
AAAGTCATTGGCCGCCTCGACAACCTCGCGCCTATGCCCGTGGCGGTGGGGAAGATGAGCGAACCGCACAGCGTGAAGAAGGTCATGAAGGAGTTTGTGCCCGGCGACGGAAAGGTTTTG
CCCGAGAGTTGGCATTATCATCTTTATTTGACGGAGGATTGGGATCAGTATTTCCCGTTCCCGACTAGTTTGAAAGTTGGGTGGACGGGGCAGGTGAAGGATGTGCAGAGACGGTGGTAG

Retrieve as FASTA