Entry information : CgLDS01
Entry ID 5345
Creation 2009-03-28 (Christophe Dunand)
Last sequence changes 2009-03-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-24 (Catherine Mathe (Scipio))
Peroxidase information: CgLDS01
Name CgLDS01
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Chaetomiaceae Chaetomium
Organism Chaetomium globosum    [TaxId: 38033 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CgLDS01
start..stop
S start..stop
NcLDS01 1482 0 26..1099 34..1134
AalcLDS01 1253 0 6..1099 2..1120
MgrLDS01 1243 0 1..1099 1..1108
GzLDS01 1176 0 65..1099 54..1105
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1514575..1514869 295 N° 2 1514281..1514519 239 N° 3 1514036..1514228 193 N° 4 1513576..1513982 407
N° 5 1511908..1513527 1620 N° 6 1511609..1511854 246 N° 7 1511234..1511533 300  
complement(join(1511234..1511533,1511609..1511854,1511908..1513527,1513576..1513 982,1514036..1514228,1514281..1514519,1514575..1514869))


exon

Literature and cross-references CgLDS01
Literature The Broad Institute Genome Sequencing Platform. Birren B., et al. Annotation of the Chaetomium globosum CBS 148.51 Genome. Submitted (MAR-2005) to the EMBL/GenBank/DDBJ databases.
Protein ref. GenPept:   88176195 UniProtKB:   Q2GPN7
DNA ref. JGI genome:   scaffold_7 (1514869..1511234)
Protein sequence: CgLDS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1099
PWM (Da):   %s   122374.39  
PI (pH):   %s   8.55
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MERRPNGAEKSSSISHASSTTPIDVGERLSSKAKPKPNPLKLKPTKADRKGVANAFERHSQVLQARVKPLPTQAGTGTFYETPRWGKLRDDLKALRVADLKTLKNMLVAKVKGEKLTDDKTMIMERVIQMVANLPSNSKLRTELTNTFLGELWYSLEHPPSLYLGDQYKYRQADGSYNIMFPQLGAAGTAYARSVNANVLRQGALPDPNLVYDSVMKRSEYKKHPNNVSSILWYWASIIIHDLFWTDHRDMNKSKTSSYLDLSPLYGSNQEMQDSIRTFKDGKLKADSFADKRLLGMPPGVGVLLIMFNRVHNYTCDNLIAINEDGKFTPPSPRLEGEKAVAAWKKYDNDLFQTARLITSGLYINITLLDYVRNIVLNRVDTTWTLDPRQDTGIDAGTAEGAERGTGNVVSAEFNLCYRWHSCISEKDDKWIEEFYYDLFGKPGDEVSVQDLIMGFGKFEARIPADPAERSFNNFKRGPNGKFSDDDLVECITSSVEDVAGSFGARNVPTSMRAIEILGIIQGRKWNVAGLNEFRKHFGLKPYESFEDINSDPGVSDALRRLYDHPDFVELYPGLVAEEHKAPMVPGVGIAPTYTISRVVLSDAVCLVRGDRHYTVDYSSRNLTNWGYQDAQYDLNINHGCVFYKLFIRAFPHHFKHNSVYAHYPMVVPSENEKILKDLKRDHLFDFTRPTRISRETECGSFEGAQRVFANPDKYKSSWHANLNALAPNGKTRVSADSTHQDRHRHEVNQPLATADLVAQVKSFYRIATEQLLGHESYHLGGHKMVDVVRDVANVAPTRFVSALFGLPLRGKNFKGIYTDHELYAVLSTIAEAVFTNPDPVRKFPLFEAAKTVAAQLASSIERQVKSPKPGKNDPLKAYGMNLIKGLAKVGLNIHDITWGHVLVTCAAIVPYQAKLFAEAADFYLSPKGEAHLEAIRSLAAQPASEQSDALLLGYALEGVRLSGSTKLHYEATAADELTAADGSTIQVQAGDRIAVTSSAGSDTVDPSRPRESYLHITALPNASFLGPAARDMSEAALTEMFRALFKRPNLRRAPGPQGELKRVVGVSGVEGAVEYLREDWGSKGQWPVTMKVMWDE*

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns). No EST available. Strain="ATCC 6205 / CBS 148.51 / DSM 1962 / IFO 6347 / NRRL 1970". Heme peroxidase domain fused with cyt P450 domain
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAGAAGGCCCAATGGCGCCGAAAAATCAAGCAGCATCAGCCATGCGAGCTCCACGACCCCTATCGACGTCGGCGAGAGGCTTTCCAGCAAGGCGAAGCCGAAACCCAATCCCCTT
AAGCTCAAGCCGACGAAGGCCGACAGGAAGGGCGTTGCCAACGCCTTCGAACGTCACAGCCAGGTCCTCCAAGCGCGGGTTAAGCCATTGCCTACCCAGGCGGGCACCGGCACATTTTAT
GAGACCCCAAGATGGGGGAAGCTCCGCGACGATCTTAAGGCGTTGCGGGTTGCGG
GTACGGCGTTTGGAAACCCCAGGCAAAGGACTTGTGTGTGCTGATAATGTGCCAGATCTTAAGAC
CTTGAAGAACATGCTCGTCGCCAAGGTGAAGGGCGAGAAGTTGACGGACGACAAGACCATGATCATGGAGCGCGTCATTCAGATGGTCGCAAATCTGCCCAGCAACTCGAAGCTGCGGAC
CGAACTGACCAACACTTTCCTGGGGGAACTCTGGTACTCGCTGGAGCACCCACCATCGCTGTACCTGGGCGACCAGTACAAGTACCGCCAGGCCGATGGGTCGTACAAT
GTGGGTTGCCC
GTCATGACCAGGGAAGGGAGAACAACGCTGACGATGTCCAGAACATCATGTTCCCGCAACTAGGCGCGGCTGGGACTGCATATGCCCGGTCTGTTAACGCCAACGTCCTGCGACAGGGCG
CCCTTCCCGACCCCAACCTTGTTTACGACTCGGTCATGAAGCGTAGCGAGTACAAGAAGCACCCGAACAATGTGTCTAGCATCCTTTGGTACTGGGCCAGCATCATCATTCACG
GTCAGT
GACAGTGCTTCGAAATCCCAGGCGATAAGCTCTAACATACCGCGTAGATCTGTTCTGGACGGACCATCGGGATATGAACAAGTCCAAGACTTCTTCATACCTCGATCTGTCGCCGCTCTA
CGGCAGCAATCAGGAGATGCAAGACAGCATCCGGACGTTCAAGGACGGAAAGCTGAAGGCCGACTCCTTCGCCGACAAGCGGCTGCTGGGCATGCCGCCCGGAGTTGGTGTGCTTTTGAT
CATGTTCAACCGCGTCCACAACTACACCTGCGACAACCTCATCGCCATCAATGAGGACGGCAAGTTCACACCACCATCACCTAGACTGGAGGGTGAGAAGGCCGTGGCTGCCTGGAAGAA
ATACGACAACGACCTCTTCCAAACAGCTCGCCTGATCACCTCGGGCTTGTACATCAACATCACTCTCCTTGATTACGTGCGGAACATTGTCAAT
GTGAGTCTCCCTGGGAATATGGCGAT
GGGGATGTGCTAACCACTGCAGCTCAACCGTGTTGACACCACCTGGACGCTCGACCCTAGGCAAGACACTGGTATCGACGCGGGGACGGCTGAGGGGGCCGAGCGTGGGACGGGCAACGT
TGTGTCGGCCGAATTCAACCTTTGCTACCGGTGGCACAGTTGCATTTCTGAGAAGGATGACAAGTGGATCGAGGAATTCTACTACGATCTGTTTGGAAAGCCGGGCGACGAAGTGTCTGT
CCAGGACCTGATCATGGGTTTTGGCAAGTTTGAGGCCAGGATTCCCGCCGACCCCGCCGAGCGATCGTTCAACAACTTCAAGAGGGGTCCAAACGGGAAGTTCAGCGACGATGACCTAGT
CGAGTGCATTACTTCTTCTGTCGAGGACGTTGCTGGGTCATTTGGCGCGCGGAATGTGCCCACCTCGATGCGCGCCATCGAGATCCTGGGTATCATCCAAGGCCGGAAGTGGAACGTCGC
TGGTCTTAACGAGTTCAGGAAGCACTTCGGCCTCAAGCCGTACGAGTCGTTCGAGGACATCAACTCCGACCCTGGCGTTTCGGATGCGCTCCGCCGTCTGTACGACCACCCGGATTTCGT
GGAGCTGTACCCTGGCTTGGTTGCCGAGGAGCACAAGGCGCCCATGGTGCCCGGCGTGGGGATTGCTCCGACGTACACCATCTCGCGCGTGGTTCTGTCCGATGCCGTCTGCCTCGTTCG
CGGTGACCGCCATTACACTGTTGACTACAGCTCCCGTAACCTCACCAACTGGGGTTACCAGGACGCGCAGTACGACCTGAACATCAACCACGGTTGCGTCTTCTACAAGCTGTTCATCCG
GGCGTTCCCGCATCACTTCAAGCACAACTCGGTCTACGCGCATTACCCCATGGTGGTGCCCTCGGAGAACGAGAAGATTCTGAAGGACCTCAAGCGTGATCATCTCTTCGACTTCACGCG
ACCCACTCGTATCTCCCGCGAGACAGAGTGTGGTTCGTTTGAGGGAGCCCAGCGGGTGTTCGCTAACCCTGACAAGTACAAGTCGTCATGGCACGCCAACCTCAATGCCCTCGCCCCCAA
CGGCAAGACTAGGGTCTCGGCCGACTCGACTCACCAGGACCGCCACCGTCATGAGGTCAACCAGCCGCTGGCTACAGCCGATCTCGTGGCCCAGGTCAAGTCATTTTACCGCATCGCGAC
GGAGCAGCTGCTTGGACATGAGAGCTACCACCTCGGTGGCCACAAAATGGTTGATGTCGTGCGCGATGTGGCCAACGTAGCGCCGACCCGCTTTGTTTCCGCTCTCTTCGGCCTTCCCCT
GAGGGGCAAGAACTTCAAGGGTATCTACACGGACCATGAGCTGTATGCCGTGCTTTCGACTATCGCCGAGGCCGTCTTCACGAACCCCGACCCTGTCAGGAAATTCCCCTTGTTCGAGGC
AGCCAAGACGGTCGCCGCCCAGTTAGCCTCCTCGATCGAGCGCCAAGTCAAGAGCCCCAAGCCGGGAAAGAATGACCCGCTGAAGGCGTACGGCATGAACCTCATCAAGGGTCTGGCCAA
GGTCGGGTTGAACATCCACGACATTACCTGGGGCCACGTCCTCGTAACTTGCGCTGCCATCGTTCCGTACCAAGCCAAGCTT
GTAAGCTATTTGTTTCTTACCCCTTAACAATGCCCTAT
TAACACCACGACCAGTTCGCCGAGGCCGCCGATTTCTACCTCTCCCCCAAGGGCGAGGCCCATCTCGAAGCAATCCGGTCGCTTGCCGCGCAGCCCGCGTCGGAGCAGTCTGACGCCCTG
CTCCTGGGCTACGCGCTCGAAGGCGTCCGCCTTTCGGGCTCCACGAAGCTTCACTACGAGGCCACGGCAGCCGACGAGCTCACCGCCGCGGACGGAAGCACCATCCAAGTTCAGGCCGGC
GACCGCATCGCCGTCACCTCG
GTAAGCCCCTCCCCCACCTCAGCCCATCACATCATGTCAACCCCCCCAACTAACAACTCCCTCCCCCACCCGCAGTCCGCCGGCTCCGACACCGTCGAC
CCGTCCCGTCCGCGCGAGAGCTACTTGCACATCACGGCGCTGCCCAACGCGTCCTTCCTGGGCCCCGCGGCACGCGACATGTCCGAGGCGGCGCTGACCGAGATGTTCCGCGCGCTCTTC
AAGCGGCCCAACCTGCGCCGCGCGCCGGGCCCCCAGGGCGAGCTGAAGCGCGTCGTGGGCGTCAGCGGCGTCGAGGGCGCGGTCGAGTATCTCCGCGAGGATTGGGGCTCGAAGGGCCAG
TGGCCGGTTACGATGAAGGTGATGTGGGATGAATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAGAAGGCCCAATGGCGCCGAAAAATCAAGCAGCATCAGCCATGCGAGCTCCACGACCCCTATCGACGTCGGCGAGAGGCTTTCCAGCAAGGCGAAGCCGAAACCCAATCCCCTT
AAGCTCAAGCCGACGAAGGCCGACAGGAAGGGCGTTGCCAACGCCTTCGAACGTCACAGCCAGGTCCTCCAAGCGCGGGTTAAGCCATTGCCTACCCAGGCGGGCACCGGCACATTTTAT
GAGACCCCAAGATGGGGGAAGCTCCGCGACGATCTTAAGGCGTTGCGGGTTGCGG
ATCTTAAGACCTTGAAGAACATGCTCGTCGCCAAGGTGAAGGGCGAGAAGTTGACGGACGACAAG
ACCATGATCATGGAGCGCGTCATTCAGATGGTCGCAAATCTGCCCAGCAACTCGAAGCTGCGGACCGAACTGACCAACACTTTCCTGGGGGAACTCTGGTACTCGCTGGAGCACCCACCA
TCGCTGTACCTGGGCGACCAGTACAAGTACCGCCAGGCCGATGGGTCGTACAAT
AACATCATGTTCCCGCAACTAGGCGCGGCTGGGACTGCATATGCCCGGTCTGTTAACGCCAACGTC
CTGCGACAGGGCGCCCTTCCCGACCCCAACCTTGTTTACGACTCGGTCATGAAGCGTAGCGAGTACAAGAAGCACCCGAACAATGTGTCTAGCATCCTTTGGTACTGGGCCAGCATCATC
ATTCACG
ATCTGTTCTGGACGGACCATCGGGATATGAACAAGTCCAAGACTTCTTCATACCTCGATCTGTCGCCGCTCTACGGCAGCAATCAGGAGATGCAAGACAGCATCCGGACGTTC
AAGGACGGAAAGCTGAAGGCCGACTCCTTCGCCGACAAGCGGCTGCTGGGCATGCCGCCCGGAGTTGGTGTGCTTTTGATCATGTTCAACCGCGTCCACAACTACACCTGCGACAACCTC
ATCGCCATCAATGAGGACGGCAAGTTCACACCACCATCACCTAGACTGGAGGGTGAGAAGGCCGTGGCTGCCTGGAAGAAATACGACAACGACCTCTTCCAAACAGCTCGCCTGATCACC
TCGGGCTTGTACATCAACATCACTCTCCTTGATTACGTGCGGAACATTGTCAAT
CTCAACCGTGTTGACACCACCTGGACGCTCGACCCTAGGCAAGACACTGGTATCGACGCGGGGACG
GCTGAGGGGGCCGAGCGTGGGACGGGCAACGTTGTGTCGGCCGAATTCAACCTTTGCTACCGGTGGCACAGTTGCATTTCTGAGAAGGATGACAAGTGGATCGAGGAATTCTACTACGAT
CTGTTTGGAAAGCCGGGCGACGAAGTGTCTGTCCAGGACCTGATCATGGGTTTTGGCAAGTTTGAGGCCAGGATTCCCGCCGACCCCGCCGAGCGATCGTTCAACAACTTCAAGAGGGGT
CCAAACGGGAAGTTCAGCGACGATGACCTAGTCGAGTGCATTACTTCTTCTGTCGAGGACGTTGCTGGGTCATTTGGCGCGCGGAATGTGCCCACCTCGATGCGCGCCATCGAGATCCTG
GGTATCATCCAAGGCCGGAAGTGGAACGTCGCTGGTCTTAACGAGTTCAGGAAGCACTTCGGCCTCAAGCCGTACGAGTCGTTCGAGGACATCAACTCCGACCCTGGCGTTTCGGATGCG
CTCCGCCGTCTGTACGACCACCCGGATTTCGTGGAGCTGTACCCTGGCTTGGTTGCCGAGGAGCACAAGGCGCCCATGGTGCCCGGCGTGGGGATTGCTCCGACGTACACCATCTCGCGC
GTGGTTCTGTCCGATGCCGTCTGCCTCGTTCGCGGTGACCGCCATTACACTGTTGACTACAGCTCCCGTAACCTCACCAACTGGGGTTACCAGGACGCGCAGTACGACCTGAACATCAAC
CACGGTTGCGTCTTCTACAAGCTGTTCATCCGGGCGTTCCCGCATCACTTCAAGCACAACTCGGTCTACGCGCATTACCCCATGGTGGTGCCCTCGGAGAACGAGAAGATTCTGAAGGAC
CTCAAGCGTGATCATCTCTTCGACTTCACGCGACCCACTCGTATCTCCCGCGAGACAGAGTGTGGTTCGTTTGAGGGAGCCCAGCGGGTGTTCGCTAACCCTGACAAGTACAAGTCGTCA
TGGCACGCCAACCTCAATGCCCTCGCCCCCAACGGCAAGACTAGGGTCTCGGCCGACTCGACTCACCAGGACCGCCACCGTCATGAGGTCAACCAGCCGCTGGCTACAGCCGATCTCGTG
GCCCAGGTCAAGTCATTTTACCGCATCGCGACGGAGCAGCTGCTTGGACATGAGAGCTACCACCTCGGTGGCCACAAAATGGTTGATGTCGTGCGCGATGTGGCCAACGTAGCGCCGACC
CGCTTTGTTTCCGCTCTCTTCGGCCTTCCCCTGAGGGGCAAGAACTTCAAGGGTATCTACACGGACCATGAGCTGTATGCCGTGCTTTCGACTATCGCCGAGGCCGTCTTCACGAACCCC
GACCCTGTCAGGAAATTCCCCTTGTTCGAGGCAGCCAAGACGGTCGCCGCCCAGTTAGCCTCCTCGATCGAGCGCCAAGTCAAGAGCCCCAAGCCGGGAAAGAATGACCCGCTGAAGGCG
TACGGCATGAACCTCATCAAGGGTCTGGCCAAGGTCGGGTTGAACATCCACGACATTACCTGGGGCCACGTCCTCGTAACTTGCGCTGCCATCGTTCCGTACCAAGCCAAGCTT
TTCGCC
GAGGCCGCCGATTTCTACCTCTCCCCCAAGGGCGAGGCCCATCTCGAAGCAATCCGGTCGCTTGCCGCGCAGCCCGCGTCGGAGCAGTCTGACGCCCTGCTCCTGGGCTACGCGCTCGAA
GGCGTCCGCCTTTCGGGCTCCACGAAGCTTCACTACGAGGCCACGGCAGCCGACGAGCTCACCGCCGCGGACGGAAGCACCATCCAAGTTCAGGCCGGCGACCGCATCGCCGTCACCTCG
TCCGCCGGCTCCGACACCGTCGACCCGTCCCGTCCGCGCGAGAGCTACTTGCACATCACGGCGCTGCCCAACGCGTCCTTCCTGGGCCCCGCGGCACGCGACATGTCCGAGGCGGCGCTG
ACCGAGATGTTCCGCGCGCTCTTCAAGCGGCCCAACCTGCGCCGCGCGCCGGGCCCCCAGGGCGAGCTGAAGCGCGTCGTGGGCGTCAGCGGCGTCGAGGGCGCGGTCGAGTATCTCCGC
GAGGATTGGGGCTCGAAGGGCCAGTGGCCGGTTACGATGAAGGTGATGTGGGATGAATGA

Retrieve as FASTA