Entry information : GzLDS03
Entry ID 5346
Creation 2007-05-14 (Marcel Zamocky)
Last sequence changes 2007-05-14 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: GzLDS03
Name GzLDS03
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS002]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Nectriaceae Gibberella
Organism Gibberella zeae (anamorph Fusarium graminearum)    [TaxId: 5518 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GzLDS03
start..stop
S start..stop
NcLDS02 1353 0 32..1358 21..1317
GmoLDS03 1237 0 31..1391 17..1419
AflLDS02 404 1e-118 428..1317 433..1233
AflLDS02 231 9e-62 90..314 207..425
AorLDS02 392 1e-114 428..1317 433..1223
AorLDS02 231 8e-62 90..314 207..425
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 269644..269814 171 N° 2 269480..269596 117 N° 3 268297..269431 1135 N° 4 267862..268248 387
N° 5 266836..267808 973 N° 6 266345..266786 442 N° 7 266010..266300 291 N° 8 265553..265958 406
N° 9 265205..265503 299  
complement(join(265205..265503,265553..265958,266010..266300,266345..266786,2668 36..267808,267862..268248,268297..269431,269480..269596,269644..269814))


exon

Literature and cross-references GzLDS03
Literature Birren B.W., et al. Fusarium graminearum genome sequence. Submitted (FEB-2004) to the EMBL/GenBank/DDBJ databases.
Protein ref. UniProtKB_Uniparc:   Q4HV62
DNA ref. JGI genome:   Supercontig_3.8 (269814..265205)
Protein sequence: GzLDS03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1406
PWM (Da):   %s   159740.3  
PI (pH):   %s   6.69
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSQSQQSLLNGNTNGYANGHANGRTSGPEWDAKIQKLNGELREAKYLAGFHGDALIGDITRPGVKWWTDLRSILTFQHLPAIKNVLVHYIKTKTLDKTNLAELVGSISNDSLLRAKFIETEVKNKYERMLHPPITYLGDAFKYRTPDGKFNSAMHPHLGEAGAPYAKTVPSKTHPLGALPDPADLFDRLMAREDPGPDGKGRPSTSGLSSMLIYHATIIIHDIFRTNDADKNISDSSSYLDLSPLYGFTEEMQRKIRDDKYKLGLLKPDTFAEDRLLRQPPGVCIYLVMYNRYHNYVATQLRRINENGRFSVPSKYTLSPLASAAKEFVKDADEAFTDDIWKYHNEWKRRRSAGIDDDDDEDEDFDDLADTLRQRILAGIEEGLRKESERQKALCVQVTGKEHSDDADEKSKSISPEGVLQQFLKAHEAAWDKLDEDLFQTARLITCGMYIQISIHDYLRGLMGFMNFDTNFTLDPRVDMKNHKNVSRGLGNQVTVEFNLLYRFHCAISMKDESYAEDFMAELFEKDEQWDPKSMGLPQFMQEMGKMKAKEGLKKPLEPWQQEFGLRKDGNPRFKPFKRNEYTGLFDDEAMVNELTSAMDDPIANFGPLNVPRCLRAVEILGIMQARKWEIGTLNDFRDFFQMKRHETFESITPNEQVQNALRDLYEHPDKVELYPGIFCETNQANGQLNADPGPSDLDSALWAAIFSDAITLVRSDRFYTVDWNTNSLTNWGMKEVTPDNDVCKSSMFHRLIQRAFPEWYPYDSIRFFHPFYTGEKLAELAKAQGYDKEFCVKTTPLKKAKKNSRGEMTNFDFELTKSNPQRPSKTVYLTHSDDIKRILEDTSDILVHPARTRISDLPPEIHDVLKPGQNNDPEKNGVSLAAAAEHSTVDHEHIQSYLVEIARNIIKREVVTTDKTKGIYQLDIVRDFAIPIVTRFVADFLGFGHLLRSDTNSHAPYSENEIYQHINNCQVFLSYNTDETKLLKRRKAFRDSMSFLLKLAQEGNICEAGKWRTTRWVQGFFGAIASFGHDKPNFMTALGYRVAGEVLQREKNTTKAATILLLTGLDSAYNVVLAFTSVMESFFQNLYAEKPNARGEEIRAAWLEIQKLAFEDDAKSNERIQALVLKVQRWSVRLPIVRKASQSTTIQAYNWETKKHEQIALAKGTVVVCDINKAEKRNTSESADERHELNYCSSFAEAFSEYHPKHVAATGLVTMVKVLAQLKNLRRGHDTQGVSKKVSIDASSVGYANYMAPMRLKEIELKVKEAREKKELTEEQLEAIFPSEIRKPATATYLTTEWDEMVPFPTWKLRFDGYGVSDYSKNNYEVLKVFKIPDDIQPFYQPNGPSKIGGSFATPVCVCHNSWKKGDKSKGHEGHEHEAGAHEVLSACGHAHAPMPATSGCKIG

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 8 introns). Strain="PH-1/NRRL 31084"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCAGTCCCAGCAATCCCTCCTCAATGGCAACACCAACGGCTATGCCAACGGTCATGCCAATGGTCGCACATCTGGGCCTGAGTGGGATGCCAAGATCCAGAAACTCAACGGGGAA
TTGAGAGAAGCCAAGTATCTTGCTGGCTTCCATGGAGATGCTCTCATCGGA
GTAAGCCATCATGGTATGGCTGACACGCATACGCTAACACTCAATAGGATATAACTCGACCTGGAGTCA
AGTGGTGGACTGATTTACGCAGTATCCTCACCTTTCAACATCTTCCTGCTATCAAGAATGTTTTGGTTCACTACATCAAAACCAAAACTCTCGAC
GTAAGTAACAATCAACTACTGACAC
TAACCAATGCTGACGGCTTCAAGAAAACAAACTTGGCAGAGTTGGTTGGATCCATCTCCAATGACAGCCTTCTTCGTGCCAAGTTCATCGAGACTGAAGTCAAGAACAAGTACGAGCGCA
TGCTTCATCCACCCATCACATACCTCGGCGATGCCTTCAAATACCGCACCCCCGACGGTAAGTTTAACAGTGCCATGCACCCCCATCTCGGAGAAGCAGGTGCCCCGTATGCCAAAACAG
TCCCATCGAAGACTCATCCCCTCGGCGCTTTGCCCGATCCTGCTGATCTTTTCGATCGTCTCATGGCTCGAGAAGACCCTGGTCCAGACGGCAAGGGTCGACCGTCCACCTCTGGTTTGT
CGTCCATGCTGATTTACCACGCTACTATCATCATTCACGACATCTTCAGAACCAATGATGCCGACAAGAACATCTCTGATTCGTCTTCTTACCTTGACCTTTCTCCTCTTTACGGCTTCA
CGGAGGAGATGCAGCGCAAGATCCGTGATGACAAGTACAAGCTTGGACTTCTAAAGCCTGACACCTTCGCCGAAGACAGACTTCTACGACAGCCTCCTGGAGTTTGCATCTACCTGGTTA
TGTACAACCGTTACCACAATTACGTCGCCACTCAGCTACGTCGCATCAACGAGAACGGACGCTTCTCTGTGCCCAGCAAATACACACTCTCTCCTCTAGCATCTGCTGCCAAGGAATTCG
TCAAAGATGCAGACGAAGCCTTTACCGACGATATCTGGAAGTACCACAATGAGTGGAAGCGTCGTCGATCAGCTGGAATTGACGATGACGATGACGAGGATGAAGACTTCGATGACCTCG
CAGACACTTTGCGCCAGAGAATCCTTGCTGGTATCGAAGAGGGTCTCCGCAAGGAGAGTGAGCGCCAAAAGGCACTTTGTGTTCAAGTCACGGGGAAGGAGCACAGCGACGATGCTGATG
AGAAGTCAAAGAGTATCAGCCCCGAGGGTGTTCTACAGCAGTTTCTCAAGGCTCATGAGGCTGCTTGGGACAAGCTCGATGAAGATCTTTTCCAGACCGCGCGACTCATAACCTGCGGCA
TGTACATCCAGATTTCGATCCACGATTACCTTCGTGGGCTCATGGGATTCATGAACTTTGATACCAACTTCACTCTTG
GTTAGTATCCCCGACTTCAAGTATCACCTCCAGACTGACCTC
TCCCAGACCCTCGTGTGGACATGAAGAACCACAAGAACGTCTCCAGAGGCTTAGGCAATCAAGTCACAGTTGAGTTCAATCTCCTCTATCGTTTCCATTGCGCCATCTCAATGAAGGATG
AGAGCTATGCCGAGGATTTCATGGCCGAGCTCTTCGAGAAGGATGAGCAATGGGACCCCAAGTCGATGGGCCTCCCCCAGTTCATGCAGGAGATGGGTAAGATGAAAGCCAAGGAGGGTT
TGAAGAAACCTCTTGAGCCGTGGCAGCAGGAGTTTGGTCTCCGCAAGGATGGAAACCCGCGGTTCAAACCCTTCAAGAGGAATGAGTACACCGGTTTGTTCGATGACGAGGCTATGGTCA
ATGAGTTGACAAGTGCTATGGATGATCCCATCG
GTAAGTGGCCCACATCGATTTCTCATTGACATACGATGCTGACTCTTTCGCAGCCAACTTCGGTCCTCTCAATGTCCCTCGCTGCCT
CAGAGCCGTCGAGATTCTCGGCATCATGCAGGCTCGCAAGTGGGAGATCGGCACGCTCAACGACTTCAGAGACTTCTTCCAAATGAAGCGTCACGAGACTTTCGAGAGCATCACTCCCAA
CGAGCAGGTTCAGAACGCACTACGCGATCTATACGAACATCCTGACAAGGTTGAGTTGTACCCGGGCATCTTCTGCGAGACCAATCAGGCGAACGGTCAATTGAACGCCGACCCTGGTCC
TTCAGATTTGGACTCTGCGCTATGGGCGGCCATTTTTTCCGACGCCATCACCCTCGTCCGATCGGATCGCTTCTATACCGTCGACTGGAATACGAACTCTTTGACCAATTGGGGTATGAA
GGAGGTCACCCCAGACAACGATGTTTGCAAGAGCTCCATGTTCCACCGACTCATCCAGCGCGCATTCCCCGAATGGTATCCTTACGACTCCATCCGGTTCTTCCACCCATTCTACACTGG
TGAGAAGCTTGCGGAACTTGCCAAAGCGCAAGGTTACGACAAGGAATTCTGTGTTAAGACTACCCCGTTGAAGAAGGCCAAGAAGAACTCCCGCGGCGAGATGACCAACTTCGACTTTGA
GCTCACAAAGTCCAATCCTCAACGGCCAAGTAAGACGGTTTACTTGACTCACAGCGATGACATCAAGCGCATTCTCGAGGACACCTCTGACATCTTGGTTCATCCTGCTCGTACCAGGAT
TTCTGATCTTCCACCCGAGATCCACGATGTTCTGAAGCCTGGCCAGAACAACGACCCCGAGAAGAATGGCGTGTCTCTCGCTGCCGCGGCGGAGCACTCGACTGTTGATCATGAGCATAT
CCAATCATACTTGGTCGAAATTGCTCGGAATATCATCAAGCGTGAAGTTGTCACCACCGATAAGACCAAGGGCATCTATCAGCTTGATATCGTGCGAGA
GTAAGTCTTTCATCCAACGTT
TCCGCATTCATCATCTAACGTCGTACAGTTTCGCCATTCCCATCGTGACCCGCTTCGTTGCCGATTTCCTCGGATTCGGCCATCTGCTTCGCTCCGACACCAATTCTCACGCGCCGTACT
CGGAGAACGAGATCTACCAGCATATCAACAACTGCCAGGTCTTCCTCTCATATAACACCGATGAGACAAAGCTTCTGAAACGCCGCAAGGCGTTCCGAGACTCTATGAGCTTCCTCCTCA
AGCTGGCCCAAGAAGGCAACATCTGCGAGGCCGGCAAGTGGCGCACCACGCGATGGGTGCAGGGTTTCTTTGGCGCTATAGCCTCTTTTGGTCATGATAAGCCTAACTTTATGACGGCCT
TGGGATACAGGGTCGCTGGCGAGGTATTGCAGAGGGAGAAGAACACCACCAAGGCGGCTACTATCCTTCTTTTGACTGGCCTGGACAGTGCATACAATGTGGTCCTTGCG
GTAAGTAACT
TGCAAGTTTGAAGAATTCTTCTGACGCATCATAGTTCACCTCAGTTATGGAATCATTCTTCCAGAATCTCTATGCTGAAAAGCCCAACGCCAGAGGTGAGGAGATCAGGGCAGCTTGGCT
TGAGATCCAGAAGCTCGCGTTTGAGGACGATGCCAAGTCCAATGAGCGCATTCAGGCTCTTGTTCTCAAGGTCCAGAGATGGAGTGTCCGTCTGCCTATCGTTCGTAAGGCATCTCAAAG
CACTACCATTCAAGCTTACAACTGGGAAACGAAGAAGCATGAGCAAATAGCTCTTGCCAAGGGCACGGTTGTTGTGTGCGATATC
GTAAGTCTGGATGCGATCATATAATGATACCACTG
GCTAACCGTTTTACAGAACAAGGCGGAGAAACGGAACACCAGCGAGTCAGCCGATGAGCGACACGAACTGAACTACTGTTCCAGTTTCGCCGAGGCGTTCAGCGAGTACCACCCCAAGCA
CGTCGCCGCCACTGGCCTGGTCACCATGGTCAAGGTCCTAGCACAGCTCAAGAACCTTCGTCGCGGACATGACACTCAGGGTGTTTCCAAGAAGGTCTCGATTGATGCGTCTAGCGTTGG
CTATGCCAACTACATGGCGCCCATGCGACTCAAGGAGATTGAGCTCAAGGTCAAGGAGGCACGTGAAAAGAAGGAGCTGACCGAAGAGCAACTAGAGGCTATTTTCCCATCTGAGATCAG
GAAGCCTGCGACTGCTACTTATCTGACCACCGAGTGGGACGAGATGGTTCCTTTCCCAACGA
GTAAGTTTTTCACATGTGAGTGTAAATAGCATATGCTAACGGATAACAGCTTGGAAGC
TACGCTTCGATGGCTATGGTGTCTCGGACTATAGCAAGAACAACTATGAGGTTCTCAAGGTGTTCAAGATACCCGATGACATTCAGCCATTCTATCAGCCCAATGGGCCAAGTAAGATTG
GAGGGTCGTTCGCTACTCCTGTTTGTGTTTGCCACAACTCATGGAAGAAGGGTGACAAGAGCAAGGGTCATGAGGGTCATGAGCATGAGGCCGGTGCTCACGAGGTGCTCTCAGCTTGTG
GACATGCCCATGCACCTATGCCTGCTACATCGGGATGCAAGATTGGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCAGTCCCAGCAATCCCTCCTCAATGGCAACACCAACGGCTATGCCAACGGTCATGCCAATGGTCGCACATCTGGGCCTGAGTGGGATGCCAAGATCCAGAAACTCAACGGGGAA
TTGAGAGAAGCCAAGTATCTTGCTGGCTTCCATGGAGATGCTCTCATCGGA
GATATAACTCGACCTGGAGTCAAGTGGTGGACTGATTTACGCAGTATCCTCACCTTTCAACATCTTCCT
GCTATCAAGAATGTTTTGGTTCACTACATCAAAACCAAAACTCTCGAC
AAAACAAACTTGGCAGAGTTGGTTGGATCCATCTCCAATGACAGCCTTCTTCGTGCCAAGTTCATCGAGACT
GAAGTCAAGAACAAGTACGAGCGCATGCTTCATCCACCCATCACATACCTCGGCGATGCCTTCAAATACCGCACCCCCGACGGTAAGTTTAACAGTGCCATGCACCCCCATCTCGGAGAA
GCAGGTGCCCCGTATGCCAAAACAGTCCCATCGAAGACTCATCCCCTCGGCGCTTTGCCCGATCCTGCTGATCTTTTCGATCGTCTCATGGCTCGAGAAGACCCTGGTCCAGACGGCAAG
GGTCGACCGTCCACCTCTGGTTTGTCGTCCATGCTGATTTACCACGCTACTATCATCATTCACGACATCTTCAGAACCAATGATGCCGACAAGAACATCTCTGATTCGTCTTCTTACCTT
GACCTTTCTCCTCTTTACGGCTTCACGGAGGAGATGCAGCGCAAGATCCGTGATGACAAGTACAAGCTTGGACTTCTAAAGCCTGACACCTTCGCCGAAGACAGACTTCTACGACAGCCT
CCTGGAGTTTGCATCTACCTGGTTATGTACAACCGTTACCACAATTACGTCGCCACTCAGCTACGTCGCATCAACGAGAACGGACGCTTCTCTGTGCCCAGCAAATACACACTCTCTCCT
CTAGCATCTGCTGCCAAGGAATTCGTCAAAGATGCAGACGAAGCCTTTACCGACGATATCTGGAAGTACCACAATGAGTGGAAGCGTCGTCGATCAGCTGGAATTGACGATGACGATGAC
GAGGATGAAGACTTCGATGACCTCGCAGACACTTTGCGCCAGAGAATCCTTGCTGGTATCGAAGAGGGTCTCCGCAAGGAGAGTGAGCGCCAAAAGGCACTTTGTGTTCAAGTCACGGGG
AAGGAGCACAGCGACGATGCTGATGAGAAGTCAAAGAGTATCAGCCCCGAGGGTGTTCTACAGCAGTTTCTCAAGGCTCATGAGGCTGCTTGGGACAAGCTCGATGAAGATCTTTTCCAG
ACCGCGCGACTCATAACCTGCGGCATGTACATCCAGATTTCGATCCACGATTACCTTCGTGGGCTCATGGGATTCATGAACTTTGATACCAACTTCACTCTTG
ACCCTCGTGTGGACATG
AAGAACCACAAGAACGTCTCCAGAGGCTTAGGCAATCAAGTCACAGTTGAGTTCAATCTCCTCTATCGTTTCCATTGCGCCATCTCAATGAAGGATGAGAGCTATGCCGAGGATTTCATG
GCCGAGCTCTTCGAGAAGGATGAGCAATGGGACCCCAAGTCGATGGGCCTCCCCCAGTTCATGCAGGAGATGGGTAAGATGAAAGCCAAGGAGGGTTTGAAGAAACCTCTTGAGCCGTGG
CAGCAGGAGTTTGGTCTCCGCAAGGATGGAAACCCGCGGTTCAAACCCTTCAAGAGGAATGAGTACACCGGTTTGTTCGATGACGAGGCTATGGTCAATGAGTTGACAAGTGCTATGGAT
GATCCCATCG
CCAACTTCGGTCCTCTCAATGTCCCTCGCTGCCTCAGAGCCGTCGAGATTCTCGGCATCATGCAGGCTCGCAAGTGGGAGATCGGCACGCTCAACGACTTCAGAGACTTC
TTCCAAATGAAGCGTCACGAGACTTTCGAGAGCATCACTCCCAACGAGCAGGTTCAGAACGCACTACGCGATCTATACGAACATCCTGACAAGGTTGAGTTGTACCCGGGCATCTTCTGC
GAGACCAATCAGGCGAACGGTCAATTGAACGCCGACCCTGGTCCTTCAGATTTGGACTCTGCGCTATGGGCGGCCATTTTTTCCGACGCCATCACCCTCGTCCGATCGGATCGCTTCTAT
ACCGTCGACTGGAATACGAACTCTTTGACCAATTGGGGTATGAAGGAGGTCACCCCAGACAACGATGTTTGCAAGAGCTCCATGTTCCACCGACTCATCCAGCGCGCATTCCCCGAATGG
TATCCTTACGACTCCATCCGGTTCTTCCACCCATTCTACACTGGTGAGAAGCTTGCGGAACTTGCCAAAGCGCAAGGTTACGACAAGGAATTCTGTGTTAAGACTACCCCGTTGAAGAAG
GCCAAGAAGAACTCCCGCGGCGAGATGACCAACTTCGACTTTGAGCTCACAAAGTCCAATCCTCAACGGCCAAGTAAGACGGTTTACTTGACTCACAGCGATGACATCAAGCGCATTCTC
GAGGACACCTCTGACATCTTGGTTCATCCTGCTCGTACCAGGATTTCTGATCTTCCACCCGAGATCCACGATGTTCTGAAGCCTGGCCAGAACAACGACCCCGAGAAGAATGGCGTGTCT
CTCGCTGCCGCGGCGGAGCACTCGACTGTTGATCATGAGCATATCCAATCATACTTGGTCGAAATTGCTCGGAATATCATCAAGCGTGAAGTTGTCACCACCGATAAGACCAAGGGCATC
TATCAGCTTGATATCGTGCGAGA
TTTCGCCATTCCCATCGTGACCCGCTTCGTTGCCGATTTCCTCGGATTCGGCCATCTGCTTCGCTCCGACACCAATTCTCACGCGCCGTACTCGGAG
AACGAGATCTACCAGCATATCAACAACTGCCAGGTCTTCCTCTCATATAACACCGATGAGACAAAGCTTCTGAAACGCCGCAAGGCGTTCCGAGACTCTATGAGCTTCCTCCTCAAGCTG
GCCCAAGAAGGCAACATCTGCGAGGCCGGCAAGTGGCGCACCACGCGATGGGTGCAGGGTTTCTTTGGCGCTATAGCCTCTTTTGGTCATGATAAGCCTAACTTTATGACGGCCTTGGGA
TACAGGGTCGCTGGCGAGGTATTGCAGAGGGAGAAGAACACCACCAAGGCGGCTACTATCCTTCTTTTGACTGGCCTGGACAGTGCATACAATGTGGTCCTTGCG
TTCACCTCAGTTATG
GAATCATTCTTCCAGAATCTCTATGCTGAAAAGCCCAACGCCAGAGGTGAGGAGATCAGGGCAGCTTGGCTTGAGATCCAGAAGCTCGCGTTTGAGGACGATGCCAAGTCCAATGAGCGC
ATTCAGGCTCTTGTTCTCAAGGTCCAGAGATGGAGTGTCCGTCTGCCTATCGTTCGTAAGGCATCTCAAAGCACTACCATTCAAGCTTACAACTGGGAAACGAAGAAGCATGAGCAAATA
GCTCTTGCCAAGGGCACGGTTGTTGTGTGCGATATC
AACAAGGCGGAGAAACGGAACACCAGCGAGTCAGCCGATGAGCGACACGAACTGAACTACTGTTCCAGTTTCGCCGAGGCGTTC
AGCGAGTACCACCCCAAGCACGTCGCCGCCACTGGCCTGGTCACCATGGTCAAGGTCCTAGCACAGCTCAAGAACCTTCGTCGCGGACATGACACTCAGGGTGTTTCCAAGAAGGTCTCG
ATTGATGCGTCTAGCGTTGGCTATGCCAACTACATGGCGCCCATGCGACTCAAGGAGATTGAGCTCAAGGTCAAGGAGGCACGTGAAAAGAAGGAGCTGACCGAAGAGCAACTAGAGGCT
ATTTTCCCATCTGAGATCAGGAAGCCTGCGACTGCTACTTATCTGACCACCGAGTGGGACGAGATGGTTCCTTTCCCAACGA
CTTGGAAGCTACGCTTCGATGGCTATGGTGTCTCGGAC
TATAGCAAGAACAACTATGAGGTTCTCAAGGTGTTCAAGATACCCGATGACATTCAGCCATTCTATCAGCCCAATGGGCCAAGTAAGATTGGAGGGTCGTTCGCTACTCCTGTTTGTGTT
TGCCACAACTCATGGAAGAAGGGTGACAAGAGCAAGGGTCATGAGGGTCATGAGCATGAGGCCGGTGCTCACGAGGTGCTCTCAGCTTGTGGACATGCCCATGCACCTATGCCTGCTACA
TCGGGATGCAAGATTGGTTAA

Retrieve as FASTA