Entry information : PnoLDS02
Entry ID 5347
Creation 2007-05-14 (Marcel Zamocky)
Last sequence changes 2007-05-14 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PnoLDS02
Name PnoLDS02
Class Linoleate diol synthase (PGHS like)    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PnoLDS02
start..stop
S start..stop
FoLDS01 501 3e-160 4..1023 46..1092
GmoLDS01 500 1e-159 4..1023 46..1092
PindLDS01 497 4e-157 239..1023 419..1251
GzLDS01 488 3e-155 9..1023 53..1104
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1180898..1181354 457 N° 2 1180598..1180846 249 N° 3 1180406..1180499 94 N° 4 1180021..1180354 334
N° 5 1177929..1179983 2055  
complement(join(1177929..1179983,1180021..1180354,1180406..1180499,1180598..1180 846,1180898..1181354))


exon

Literature and cross-references PnoLDS02
Literature The Broad Institute Genome Sequencing Platform;
Birren B., Lander E., Galagan J., Devon K., Nusbaum C., Jaffe D., Butler J., Alvarez P., Gnerre S., Grabherr M., Kleber M., Mauceli E., Brockman W., Rounsley S., Young S., LaButti K., Pushparaj V., DeCaprio D., Crawford M., Koehrsen M., Engels R., Montgomery P., Pearson M., Howarth C., Kodira C., Zeng Q., Yandava C., Alvarado L., Oleary S., Oliver R.O., Solomon P.;
"Annotation of the Phaeosphaeria nodorum SN15 genome.";
Submitted (MAR-2005) to the EMBL/GenBank/DDBJ databases.
Protein ref. GenPept:   EAT89123 UniProtKB:   Q0UWE6
DNA ref. JGI genome:   scaffold_5 (1181354..1177929)
Protein sequence: PnoLDS02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1062
PWM (Da):   %s   117443.39  
PI (pH):   %s   7.31
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPSQLRSLLGTIRRKPTQASDGRTSEASSGLKNNEKTTIGHDLKNLGIKNARFAVEAITTLASGEPLDDKDNLLENGVQMLQGLPTNSGLSAKVSDGFIAMLWNDLPHPSPTTAGPTTRYRRHDGGGNNPHNPEMGKAGSPYARNVPPTKPKGPNLPDVEDVYEALLKRKGPFRSPFTQELNTPWFFSFANHRHSRSGFPNLEGPDPWINETLKLRGSEHAVWQPPKKEQVPRYRQITNHIAESLWSINEDGKYKPWDSLDDAGKKWQDNDIFQLTRNINVGFFAAVVLHDYVAAILNTPRANSEWSLDLGKEIKQGGTRVERGTGSHVSVEFAVLYHWHAALSAADDKWMEDILRSVHPNMRSVDDITVEMFHEVMEWTFGGLQRGPDGRFKDAELAELIKTCTEEPAHAFGAHGTPASLKVVDLMGQLQARDMFNVCTLNEFRRYLNLKPYETFEDWCVDKDTARAAELLYGHIENMELYPGLMAECTKPAMPGSGVCPGQTTGRGILDDAVALVRGDRYLSYDFNSNTLTQWGAALLSDTVPGAYGGVFPKLLFQGLPGGFTGTSPYVLLPFYTPEAAKGILKGNNVLEKYDLKRPPNDYDIVSVQTQEGCKKIFEDRDSFAVMYQAAIRHCTAGHDFMIGWDDAKKHDERSNALHKIFFEDGFEKNVNEFFSKTVSQLIQKNSLKGAKGRMSIDIVRDVTNIAPILWLAERFALPLKTQEQPRGVLSVHEAFTAFLVLFMYQSFNIMPANEWKLREGALKAAAPLRSIFEAHLKTQTGRLEGLVDWMAKGSAFEVGPQADRLYHALADTKLPLGDQVGDCIGMSAPVAGNMTQQASLLIDLFLSPGYEKYKERIVELAHMDPATSDRELQGFVYEGMRHVGVVPGLPRVATRDTTVNDGVRGPVQIKKGHTVLIATSKAAMDPVAYPNPEILNPHRPFKDYTLLGHGLHFCFGARLVGPSIAATLREVFKLKNVRRAPGKQGRFTVTEQKLAGVSMRHYLDANSKESPIPTSLRLHYDYETITNGLNGAAGLNGHAPNGYANANGNNSHGNAYTIAP*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 intron) and 2 short ESTs (EH397567 and EH397842). Strain="SN15". Contig position: 199169-195849. Regions 118-535 heme peroxidase domain; 597-1002 cytochrome P450 domain.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCAAGCCAGTTACGCTCATTGCTTGGGACCATCAGGAGGAAGCCTACCCAGGCCAGTGACGGAAGGACGTCGGAGGCTTCGAGTGGGCTGAAGAACAACGAGAAGACCACCATCGGC
CACGACCTCAAAAACCTGGGCATTAAGAATGCTAGATTCGCAGTCGAAGCCATCACCACGCTGGCCTCTGGCGAACCTCTTGATGACAAGGACAACCTCCTTGAGAATGGCGTTCAGATG
CTGCAAGGCCTACCGACCAACAGCGGACTGAGTGCAAAGGTCTCAGACGGCTTTATTGCCATGCTTTGGAATGACCTCCCACATCCGTCACCTACAACAGCCGGTCCAACTACACGCTAT
CGCCGACACGATGGTGGCGGCAACAACCCACACAATCCAGAAATGGGAAAAGCAGGTTCGCCGTATGCAAGAAACGTCCCACCTACAAAACCCAAAG
GTAAGCGTTGCGTCGCAGTTATG
TTGTAGGTGATTACTAATGGTGCACTAGGTCCCAATCTTCCTGATGTTGAGGATGTCTATGAAGCCTTGCTGAAGCGCAAAGGCCCTTTTCGTTCTCCATTCACTCAGGAGCTGAATACG
CCTTGGTTCTTCTCTTTCGCGAACCATCGTCATTCACGGAGTGGCTTTCCAAACCTCGAAGGACCAGACCCCTGGATCAACGAAACCCTCAAGCTACGTGGATCTGAGCACGCTGTATGG
CAACCACCGAAAAAAGAGCAAGTCCCGCGTTACAGAC
GTATCATAACAGCGAGATCTATGCAGACTCAAATTGCTTCGGAGAGAAATCATGATGATGCCACCAGGAGTAGTTGCTGTCCT
CCTCATGTTCTCAAGAAATCACAAACCACATCGCAGAGTCTTTGTGGTCCATCAACGAGGATGGCAAATACAAACCATGGGATAGTCTAGACGACGCTGGAAAGAAATGGTAAGCGACTT
GGGAATCATTGCTTTTGCGAATATGCTGACAATCAGAAAGGCAGGATAATGACATCTTCCAACTTACGCGCAACATCAACGTCGGATTTTTTGCCGCGGTCGTTCTACACGATTACGTGG
CAGCCATCCTAAATACTCCCCGTGCCAATTCCGAATGGTCGCTCGATCTAGGCAAGGAGATCAAACAGGGCGGGACACGTGTGGAACGAGGTACTGGAAGTCATGTCTCTGTGGAGTTTG
CAGTCCTCTACCATTGGCATGCTGCGTTAAGCGCTGCGGACGACAAATGGATGGAAGACATACTTCGCTCTGTCCATCCCAATATGCGGTCTGTCGATGACATTACAGTCGAAATGTTTC
ATGAAGTCATGAAG
GTACACGGACACGATCTCATGAATTAACCGGCCAAAGGAGTGGACGTTTGGTGGGCTTCAGCGAGGCCCCGATGGACGCTTCAAAGACGCTGAGCTAGCTGAGCTT
ATCAAAACTTGTACCGAAGAACCGGCCCACGCATTTGGTGCCCATGGCACGCCCGCGTCGCTGAAAGTCGTCGACCTTATGGGTCAGTTGCAAGCACGTGATATGTTCAACGTCTGCACC
TTGAACGAGTTCCGTAGGTATCTCAACTTGAAGCCTTACGAGACCTTCGAAGACTGGTGTGTAGACAAAGACACTGCAAGGGCTGCGGAGCTCCTGTACGGGCACATTGAGAACATGGAG
CTCTATCCCGGTTTAATGGCCGAATGCACCAAGCCAGCGATGCCGGGATCCGGGGTGTGTCCCGGCCAGACCACAGGACGAGGAATATTGGACGACGCTGTTGCACTTGTCCGTGGCGAT
CGTTACCTCAGTTACGATTTCAATAGCAATACTCTGACCCAGTGGGGCGCTGCTCTACTATCAGACACCGTTCCTGGAGCTTATGGTGGCGTCTTTCCAAAGCTACTTTTCCAAGGTCTC
CCTGGCGGATTCACAGGCACGTCACCGTACGTTCTGTTGCCATTCTACACACCCGAAGCTGCCAAGGGCATTCTGAAGGGGAACAATGTTCTCGAGAAATACGATCTCAAACGACCGCCA
AATGATTACGACATTGTCAGCGTGCAGACGCAAGAGGGCTGTAAGAAGATATTTGAGGACCGCGACAGTTTTGCTGTCATGTACCAGGCTGCCATTAGGCATTGTACTGCCGGACACGAC
TTCATGATCGGGTGGGACGATGCAAAGAAGCACGACGAGCGCTCCAATGCCCTTCACAAGATATTCTTCGAGGATGGGTTCGAGAAGAACGTCAACGAATTCTTCAGCAAAACAGTCAGT
CAACTCATTCAGAAGAACTCGTTGAAAGGCGCCAAGGGCAGGATGTCGATCGATATTGTGCGCGACGTCACCAACATTGCGCCTATCCTGTGGCTAGCCGAGCGTTTTGCATTACCTCTA
AAAACCCAGGAACAGCCTCGCGGAGTTCTTTCGGTCCACGAAGCTTTCACTGCGTTCCTCGTCCTGTTCATGTACCAGAGCTTCAACATCATGCCAGCTAATGAGTGGAAGCTAAGAGAA
GGCGCTTTGAAAGCCGCGGCACCTCTACGATCCATCTTCGAGGCTCATTTGAAGACACAAACTGGTAGACTGGAGGGCCTTGTCGACTGGATGGCTAAGGGCAGTGCATTTGAAGTGGGC
CCACAAGCTGACCGCCTCTACCATGCCTTGGCGGATACGAAATTGCCCCTTGGAGATCAGGTTGGAGATTGTATTGGAATGAGCGCACCAGTTGCTGGCAATATGACACAGCAAGCATCG
CTTTTGATTGACCTATTCCTCAGTCCTGGTTATGAAAAGTACAAGGAGCGCATTGTCGAATTGGCACACATGGATCCCGCAACATCCGATCGCGAACTCCAAGGCTTTGTATATGAAGGC
ATGAGACATGTCGGAGTGGTTCCTGGGCTTCCACGTGTTGCTACTCGAGATACCACAGTTAATGACGGTGTGCGTGGTCCTGTTCAGATCAAGAAAGGCCATACTGTCCTCATCGCCACC
TCCAAGGCAGCTATGGATCCCGTCGCGTATCCAAATCCCGAGATTCTGAATCCACATCGACCATTCAAAGACTACACTCTCCTCGGTCATGGCTTGCACTTTTGCTTCGGCGCTCGTCTC
GTAGGGCCCTCGATTGCTGCTACATTACGCGAAGTCTTCAAGCTGAAAAACGTACGACGCGCGCCAGGTAAACAGGGTCGCTTCACCGTTACCGAGCAAAAGCTGGCCGGCGTTTCTATG
AGACACTATCTTGATGCCAATTCAAAGGAGAGTCCTATCCCGACGAGTCTGAGACTACACTACGACTATGAGACAATCACGAACGGTCTCAACGGCGCAGCTGGCTTGAATGGGCATGCA
CCTAATGGATATGCGAACGCAAACGGTAACAACTCGCACGGTAACGCGTACACAATCGCTCCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCAAGCCAGTTACGCTCATTGCTTGGGACCATCAGGAGGAAGCCTACCCAGGCCAGTGACGGAAGGACGTCGGAGGCTTCGAGTGGGCTGAAGAACAACGAGAAGACCACCATCGGC
CACGACCTCAAAAACCTGGGCATTAAGAATGCTAGATTCGCAGTCGAAGCCATCACCACGCTGGCCTCTGGCGAACCTCTTGATGACAAGGACAACCTCCTTGAGAATGGCGTTCAGATG
CTGCAAGGCCTACCGACCAACAGCGGACTGAGTGCAAAGGTCTCAGACGGCTTTATTGCCATGCTTTGGAATGACCTCCCACATCCGTCACCTACAACAGCCGGTCCAACTACACGCTAT
CGCCGACACGATGGTGGCGGCAACAACCCACACAATCCAGAAATGGGAAAAGCAGGTTCGCCGTATGCAAGAAACGTCCCACCTACAAAACCCAAAG
GTCCCAATCTTCCTGATGTTGAG
GATGTCTATGAAGCCTTGCTGAAGCGCAAAGGCCCTTTTCGTTCTCCATTCACTCAGGAGCTGAATACGCCTTGGTTCTTCTCTTTCGCGAACCATCGTCATTCACGGAGTGGCTTTCCA
AACCTCGAAGGACCAGACCCCTGGATCAACGAAACCCTCAAGCTACGTGGATCTGAGCACGCTGTATGGCAACCACCGAAAAAAGAGCAAGTCCCGCGTTACAGAC
AAATCACAAACCAC
ATCGCAGAGTCTTTGTGGTCCATCAACGAGGATGGCAAATACAAACCATGGGATAGTCTAGACGACGCTGGAAAGAAATG
GCAGGATAATGACATCTTCCAACTTACGCGCAACATCAAC
GTCGGATTTTTTGCCGCGGTCGTTCTACACGATTACGTGGCAGCCATCCTAAATACTCCCCGTGCCAATTCCGAATGGTCGCTCGATCTAGGCAAGGAGATCAAACAGGGCGGGACACGT
GTGGAACGAGGTACTGGAAGTCATGTCTCTGTGGAGTTTGCAGTCCTCTACCATTGGCATGCTGCGTTAAGCGCTGCGGACGACAAATGGATGGAAGACATACTTCGCTCTGTCCATCCC
AATATGCGGTCTGTCGATGACATTACAGTCGAAATGTTTCATGAAGTCATGAAG
GAGTGGACGTTTGGTGGGCTTCAGCGAGGCCCCGATGGACGCTTCAAAGACGCTGAGCTAGCTGAG
CTTATCAAAACTTGTACCGAAGAACCGGCCCACGCATTTGGTGCCCATGGCACGCCCGCGTCGCTGAAAGTCGTCGACCTTATGGGTCAGTTGCAAGCACGTGATATGTTCAACGTCTGC
ACCTTGAACGAGTTCCGTAGGTATCTCAACTTGAAGCCTTACGAGACCTTCGAAGACTGGTGTGTAGACAAAGACACTGCAAGGGCTGCGGAGCTCCTGTACGGGCACATTGAGAACATG
GAGCTCTATCCCGGTTTAATGGCCGAATGCACCAAGCCAGCGATGCCGGGATCCGGGGTGTGTCCCGGCCAGACCACAGGACGAGGAATATTGGACGACGCTGTTGCACTTGTCCGTGGC
GATCGTTACCTCAGTTACGATTTCAATAGCAATACTCTGACCCAGTGGGGCGCTGCTCTACTATCAGACACCGTTCCTGGAGCTTATGGTGGCGTCTTTCCAAAGCTACTTTTCCAAGGT
CTCCCTGGCGGATTCACAGGCACGTCACCGTACGTTCTGTTGCCATTCTACACACCCGAAGCTGCCAAGGGCATTCTGAAGGGGAACAATGTTCTCGAGAAATACGATCTCAAACGACCG
CCAAATGATTACGACATTGTCAGCGTGCAGACGCAAGAGGGCTGTAAGAAGATATTTGAGGACCGCGACAGTTTTGCTGTCATGTACCAGGCTGCCATTAGGCATTGTACTGCCGGACAC
GACTTCATGATCGGGTGGGACGATGCAAAGAAGCACGACGAGCGCTCCAATGCCCTTCACAAGATATTCTTCGAGGATGGGTTCGAGAAGAACGTCAACGAATTCTTCAGCAAAACAGTC
AGTCAACTCATTCAGAAGAACTCGTTGAAAGGCGCCAAGGGCAGGATGTCGATCGATATTGTGCGCGACGTCACCAACATTGCGCCTATCCTGTGGCTAGCCGAGCGTTTTGCATTACCT
CTAAAAACCCAGGAACAGCCTCGCGGAGTTCTTTCGGTCCACGAAGCTTTCACTGCGTTCCTCGTCCTGTTCATGTACCAGAGCTTCAACATCATGCCAGCTAATGAGTGGAAGCTAAGA
GAAGGCGCTTTGAAAGCCGCGGCACCTCTACGATCCATCTTCGAGGCTCATTTGAAGACACAAACTGGTAGACTGGAGGGCCTTGTCGACTGGATGGCTAAGGGCAGTGCATTTGAAGTG
GGCCCACAAGCTGACCGCCTCTACCATGCCTTGGCGGATACGAAATTGCCCCTTGGAGATCAGGTTGGAGATTGTATTGGAATGAGCGCACCAGTTGCTGGCAATATGACACAGCAAGCA
TCGCTTTTGATTGACCTATTCCTCAGTCCTGGTTATGAAAAGTACAAGGAGCGCATTGTCGAATTGGCACACATGGATCCCGCAACATCCGATCGCGAACTCCAAGGCTTTGTATATGAA
GGCATGAGACATGTCGGAGTGGTTCCTGGGCTTCCACGTGTTGCTACTCGAGATACCACAGTTAATGACGGTGTGCGTGGTCCTGTTCAGATCAAGAAAGGCCATACTGTCCTCATCGCC
ACCTCCAAGGCAGCTATGGATCCCGTCGCGTATCCAAATCCCGAGATTCTGAATCCACATCGACCATTCAAAGACTACACTCTCCTCGGTCATGGCTTGCACTTTTGCTTCGGCGCTCGT
CTCGTAGGGCCCTCGATTGCTGCTACATTACGCGAAGTCTTCAAGCTGAAAAACGTACGACGCGCGCCAGGTAAACAGGGTCGCTTCACCGTTACCGAGCAAAAGCTGGCCGGCGTTTCT
ATGAGACACTATCTTGATGCCAATTCAAAGGAGAGTCCTATCCCGACGAGTCTGAGACTACACTACGACTATGAGACAATCACGAACGGTCTCAACGGCGCAGCTGGCTTGAATGGGCAT
GCACCTAATGGATATGCGAACGCAAACGGTAACAACTCGCACGGTAACGCGTACACAATCGCTCCTTAG

Retrieve as FASTA