Entry information : GzCP01 (GzkatG3 / GzKatG1)
Entry ID 5354
Creation 2007-05-15 (Marcel Zamocky)
Last sequence changes 2011-05-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: GzCP01 (GzkatG3 / GzKatG1)
Name (synonym) GzCP01 (GzkatG3 / GzKatG1)
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Nectriaceae Gibberella
Organism Gibberella zeae (anamorph Fusarium graminearum)    [TaxId: 5518 ]
Cellular localisation N/D
Tissue type Mycelium
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GzCP01
start..stop
S start..stop
GmoCP01 1417 0 1..801 1..800
FoCP01 1415 0 1..801 1..801
NhaeCP01 1257 0 42..801 1..760
TatCP01 1128 0 46..789 6..749
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4893280..4893735 456 N° 2 4893787..4894183 397 N° 3 4894235..4895787 1553  
join(4893280..4893735,4893787..4894183,4894235..4895787)


exon

Literature and cross-references GzCP01 (GzkatG3 / GzKatG1)
Literature REFERENCE 1 Birren B.W. et al. Fusarium gramineariun genome sequence Broad Institute, unpublished.
REFERENCE 2 Zamocky M. et al. Catalase-peroxidase from phytopathogenic fungi" (13th ICBIC conference Vienna 2007)
Protein ref. UniProtKB_Uniparc:   Q4III4
DNA ref. JGI genome:   Supercontig_3.2 (4893280..4895787)
EST ref. GenBank:   BU065388 [3' end]   BI750328 [Fragment]
Protein sequence: GzCP01 (GzkatG3 / GzKatG1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   801
PWM (Da):   %s   88372.49  
PI (pH):   %s   6.89
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPRFLLPKSSSRILLLSIARRTWTLNKTLHTPRFLSTTPHNMSESKCPVAHKIPNVAGHGVTHQKWWPESLKTNILRQHSNVTNPYGENFSYAEAFKSLDYNALKEDLRKLMTDSQDWWPADFGHYGGLMVRLSWHSVGTYRVFDGRGGGRQGQQRFAPLNSWPDNVSLDKARRLLWPVKQKYGNKISWADLIVLAGNVALEDMGFKTLGFAGGREDTWEADEATYYGGEDTWLGNDVRYSNGNKGTTKPGATDSDQTEHKDIHNRDLEKPLAAAHHGLIYVNPEGPDGNPDPVAAAHDIRETFGRMAMNDEETVALIAGGHTVGKTHGAGSTDHVGPEPEAADLAQQGLGWSNSYKSGKGPDTTTSGIEVTWTSTPVKWSHDYLKYLFQFEWELTKSPAGAHQWVAKDAEATVPHAYDSSKKQRPSMLTTDLSLRFDPAYEKISRRFLENPQEFNDAFAKAWFKLTHRDMGPRDRYLGPEVPKEIFSWQDPVPERDYKVVDDGDISAIKNEILKSGIDVSKLVSTAWASASTFRGSDLRGGANGARLRLEPQKNWEVNNPSQLGQVLNGLEKIQKNFNDSQSNGKAISLADVIVLAGSAAVEKAAKDAGVNVTVPFTPGRTDATQDQTDVQSVAHLEPAADGFRNYGASTDRVKLEHMLIDRAQLLTLSVPEITALVGGLRALNANWDGSSHGILTKRPGVLSNDFFVNLLDISTEWKPVGNGDLFEGIDRKSGNKKWTGTRVDLVFGSHAELRATAETYAEAGGSEKLVRDFVAAWTKVMNLDRFDVKNGKAPNVSPRL

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 2 introns) and ESTs (3' end: BU065388, BU062488, BU062489, CD457487, CD459390). Strain="PH-1/NRRL 31084". Prediction: Signal peptide with probability: 0.634 Most likely cleavage site between pos. 24 and 25.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCGGTTTCTCCTCCCCAAGTCTTCTTCTCGTATTTTGTTATTGTCAATAGCGAGGAGGACCTGGACTTTGAACAAAACACTACACACACCCAGATTCTTGTCAACAACACCACAC
AACATGTCTGAGAGCAAGTGCCCCGTCGCGCACAAGATCCCCAACGTCGCTGGACACGGCGTCACTCACCAGAAGTGGTGGCCCGAGTCGCTCAAGACCAACATTCTGCGCCAGCACAGC
AACGTCACCAACCCTTACGGCGAGAACTTTAGCTATGCTGAGGCTTTCAAGTCGCTCGACTACAATGCCCTCAAGGAGGACCTGCGCAAGTTGATGACCGATTCGCAGGACTGGTGGCCT
GCTGACTTTGGCCACTACGGTGGTCTCATGGTGCGATTGTCATGGCACAGCGTTGGAACATACCGTGTCTTTGACGGTCGTGGTGGTGGCCGACAG
GCAAGTACTCAACATCGCCTCAAT
TGCATTCATCTCTAACCATTTCCACAGGGTCAACAGCGATTCGCCCCCCTCAACTCGTGGCCCGACAACGTCTCCCTCGACAAGGCTCGCCGCCTTCTCTGGCCCGTCAAGCAAAAGTAC
GGAAACAAGATCTCATGGGCCGACCTCATCGTCCTCGCTGGCAACGTCGCCCTCGAGGACATGGGCTTCAAGACCCTTGGCTTCGCCGGTGGCCGAGAGGATACCTGGGAGGCCGACGAG
GCCACCTACTACGGTGGTGAGGATACCTGGCTCGGAAACGACGTCCGTTACTCCAACGGGAACAAGGGAACCACTAAGCCTGGGGCCACCGACTCGGACCAGACCGAGCACAAGGATATC
CACAACCGAGATCTCGAGAAGCCTTTGGCTGCTGCCCACCACGGTCTCATCTATGTTAACCCTG
GTATGTTTCTTTCCCTTACCGATTGACCTGATCATCGCTGACAATAAGCAGAGGGC
CCTGATGGCAACCCCGACCCCGTCGCCGCCGCCCATGACATCCGCGAGACCTTCGGCCGCATGGCCATGAACGACGAAGAGACCGTTGCCCTGATCGCTGGTGGCCACACCGTCGGCAAG
ACCCACGGAGCTGGCTCAACCGACCACGTCGGCCCCGAGCCCGAGGCCGCCGACCTTGCCCAGCAGGGTCTCGGCTGGTCCAACAGCTACAAGAGTGGCAAGGGCCCCGACACAACCACC
TCTGGTATCGAAGTCACATGGACAAGCACTCCCGTCAAGTGGAGCCACGACTACCTCAAGTACCTCTTCCAGTTCGAGTGGGAGCTCACAAAGAGCCCTGCTGGCGCCCACCAGTGGGTT
GCCAAGGATGCCGAGGCTACCGTCCCCCATGCCTACGACTCCAGCAAGAAGCAGCGACCTAGCATGTTGACCACCGACTTGTCGCTTCGCTTCGACCCCGCGTACGAGAAGATCTCTCGT
CGCTTCCTCGAGAACCCCCAAGAGTTCAACGATGCCTTTGCCAAGGCTTGGTTCAAGCTCACCCACCGTGACATGGGTCCCCGCGACCGCTACCTCGGCCCCGAGGTCCCCAAGGAGATC
TTCAGCTGGCAGGACCCCGTCCCTGAGCGCGACTACAAGGTCGTCGATGACGGTGACATCTCCGCCATCAAGAACGAGATCCTCAAGTCTGGCATTGACGTCTCCAAGCTCGTCTCTACT
GCTTGGGCTTCTGCTTCTACTTTCCGAGGCAGTGATCTCCGTGGTGGTGCCAACGGTGCCCGTCTCCGTCTCGAGCCCCAGAAGAACTGGGAGGTCAACAACCCCTCTCAGCTGGGCCAG
GTTCTCAACGGTCTTGAGAAGATCCAGAAGAACTTCAACGACTCTCAGTCCAACGGCAAGGCCATCTCTCTTGCTGACGTGATCGTCCTTGCTGGTTCTGCTGCCGTCGAGAAGGCCGCC
AAGGATGCCGGTGTTAACGTCACCGTGCCCTTCACTCCTGGCCGTACCGATGCCACCCAGGACCAGACCGACGTCCAGTCTGTCGCTCACCTCGAGCCCGCCGCCGACGGTTTCCGAAAT
TACGGCGCTTCCACAGACCGTGTCAAGCTCGAGCACATGCTCATCGACCGCGCCCAGCTTCTCACTCTCAGCGTCCCCGAGATCACCGCTCTGGTCGGTGGTCTTCGTGCGCTCAACGCC
AACTGGGACGGATCATCCCACGGTATCCTCACCAAGCGCCCTGGTGTTCTGTCCAACGACTTCTTCGTCAACCTCCTCGACATCAGCACCGAGTGGAAGCCCGTCGGCAACGGCGACCTG
TTCGAGGGTATTGACCGCAAGAGCGGCAACAAGAAGTGGACTGGTACCCGTGTCGATCTCGTCTTTGGATCACACGCTGAGCTCCGCGCGACAGCTGAGACATATGCTGAAGCTGGCGGT
AGCGAGAAGCTGGTTCGCGACTTTGTCGCTGCCTGGACCAAGGTGATGAACCTTGACCGATTTGATGTTAAGAATGGTAAAGCGCCTAATGTCTCTCCTCGACTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCGGTTTCTCCTCCCCAAGTCTTCTTCTCGTATTTTGTTATTGTCAATAGCGAGGAGGACCTGGACTTTGAACAAAACACTACACACACCCAGATTCTTGTCAACAACACCACAC
AACATGTCTGAGAGCAAGTGCCCCGTCGCGCACAAGATCCCCAACGTCGCTGGACACGGCGTCACTCACCAGAAGTGGTGGCCCGAGTCGCTCAAGACCAACATTCTGCGCCAGCACAGC
AACGTCACCAACCCTTACGGCGAGAACTTTAGCTATGCTGAGGCTTTCAAGTCGCTCGACTACAATGCCCTCAAGGAGGACCTGCGCAAGTTGATGACCGATTCGCAGGACTGGTGGCCT
GCTGACTTTGGCCACTACGGTGGTCTCATGGTGCGATTGTCATGGCACAGCGTTGGAACATACCGTGTCTTTGACGGTCGTGGTGGTGGCCGACAG
GGTCAACAGCGATTCGCCCCCCTC
AACTCGTGGCCCGACAACGTCTCCCTCGACAAGGCTCGCCGCCTTCTCTGGCCCGTCAAGCAAAAGTACGGAAACAAGATCTCATGGGCCGACCTCATCGTCCTCGCTGGCAACGTCGCC
CTCGAGGACATGGGCTTCAAGACCCTTGGCTTCGCCGGTGGCCGAGAGGATACCTGGGAGGCCGACGAGGCCACCTACTACGGTGGTGAGGATACCTGGCTCGGAAACGACGTCCGTTAC
TCCAACGGGAACAAGGGAACCACTAAGCCTGGGGCCACCGACTCGGACCAGACCGAGCACAAGGATATCCACAACCGAGATCTCGAGAAGCCTTTGGCTGCTGCCCACCACGGTCTCATC
TATGTTAACCCTG
AGGGCCCTGATGGCAACCCCGACCCCGTCGCCGCCGCCCATGACATCCGCGAGACCTTCGGCCGCATGGCCATGAACGACGAAGAGACCGTTGCCCTGATCGCTGGT
GGCCACACCGTCGGCAAGACCCACGGAGCTGGCTCAACCGACCACGTCGGCCCCGAGCCCGAGGCCGCCGACCTTGCCCAGCAGGGTCTCGGCTGGTCCAACAGCTACAAGAGTGGCAAG
GGCCCCGACACAACCACCTCTGGTATCGAAGTCACATGGACAAGCACTCCCGTCAAGTGGAGCCACGACTACCTCAAGTACCTCTTCCAGTTCGAGTGGGAGCTCACAAAGAGCCCTGCT
GGCGCCCACCAGTGGGTTGCCAAGGATGCCGAGGCTACCGTCCCCCATGCCTACGACTCCAGCAAGAAGCAGCGACCTAGCATGTTGACCACCGACTTGTCGCTTCGCTTCGACCCCGCG
TACGAGAAGATCTCTCGTCGCTTCCTCGAGAACCCCCAAGAGTTCAACGATGCCTTTGCCAAGGCTTGGTTCAAGCTCACCCACCGTGACATGGGTCCCCGCGACCGCTACCTCGGCCCC
GAGGTCCCCAAGGAGATCTTCAGCTGGCAGGACCCCGTCCCTGAGCGCGACTACAAGGTCGTCGATGACGGTGACATCTCCGCCATCAAGAACGAGATCCTCAAGTCTGGCATTGACGTC
TCCAAGCTCGTCTCTACTGCTTGGGCTTCTGCTTCTACTTTCCGAGGCAGTGATCTCCGTGGTGGTGCCAACGGTGCCCGTCTCCGTCTCGAGCCCCAGAAGAACTGGGAGGTCAACAAC
CCCTCTCAGCTGGGCCAGGTTCTCAACGGTCTTGAGAAGATCCAGAAGAACTTCAACGACTCTCAGTCCAACGGCAAGGCCATCTCTCTTGCTGACGTGATCGTCCTTGCTGGTTCTGCT
GCCGTCGAGAAGGCCGCCAAGGATGCCGGTGTTAACGTCACCGTGCCCTTCACTCCTGGCCGTACCGATGCCACCCAGGACCAGACCGACGTCCAGTCTGTCGCTCACCTCGAGCCCGCC
GCCGACGGTTTCCGAAATTACGGCGCTTCCACAGACCGTGTCAAGCTCGAGCACATGCTCATCGACCGCGCCCAGCTTCTCACTCTCAGCGTCCCCGAGATCACCGCTCTGGTCGGTGGT
CTTCGTGCGCTCAACGCCAACTGGGACGGATCATCCCACGGTATCCTCACCAAGCGCCCTGGTGTTCTGTCCAACGACTTCTTCGTCAACCTCCTCGACATCAGCACCGAGTGGAAGCCC
GTCGGCAACGGCGACCTGTTCGAGGGTATTGACCGCAAGAGCGGCAACAAGAAGTGGACTGGTACCCGTGTCGATCTCGTCTTTGGATCACACGCTGAGCTCCGCGCGACAGCTGAGACA
TATGCTGAAGCTGGCGGTAGCGAGAAGCTGGTTCGCGACTTTGTCGCTGCCTGGACCAAGGTGATGAACCTTGACCGATTTGATGTTAAGAATGGTAAAGCGCCTAATGTCTCTCCTCGA
CTGTAA

Retrieve as FASTA