Entry information : GmoCP02
Entry ID 5355
Creation 2007-05-15 (Marcel Zamocky)
Last sequence changes 2011-05-20 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-05-20 (Christophe Dunand)
Peroxidase information: GmoCP02
Name GmoCP02
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Nectriaceae Gibberella
Organism Gibberella moniliformis (Fusarium verticillioides)    [TaxId: 117187 ]
Cellular localisation N/D
Tissue type Mycelium
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmoCP02
start..stop
S start..stop
FoCP04 1543 0 1..777 1..777
FoCP03 1523 0 1..777 1..777
FoCP02-1 1517 0 1..777 1..777
GzCP02 1327 0 21..777 20..777
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 108442..108727 286 N° 2 108781..108935 155 N° 3 108988..109060 73 N° 4 109109..109676 568
N° 5 109726..110977 1252  
join(108442..108727,108781..108935,108988..109060,109109..109676,109726..110977)


exon

Literature and cross-references GmoCP02
Literature Birren B., Ma L., Lander E. The genome assembly team. The genome sequence of Gibberella moniliformis (Fusarium verticillioides) 7600 Unpublished.
DNA ref. GenBank:   AAIM02000170 (108442..110979)
Cluster/Prediction ref. UniGene:   Gmo.1341
Protein sequence: GmoCP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   777 (759)
PWM (Da):   %s   85110.11 (83322.1)  
PI (pH):   %s   7.05 (7.01) Peptide Signal:   %s   cut: 19 range:19-777
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHVQSLLLASGLVPLAASQGCPFAKRATDTNLVPPREIPEDFGICRVASNQAGGGTRSRDFWPCALRWDVLRQFSPQYNQLGAGFDYTEAFKDLDFAALKKDLNALLTDSQDWWPADHGNYGGLFIRMSWHSAGTYRAMDGRGGAGMGQQRFAPLDSWPDNQNLDKARRLLWPIKQKYGSKISWADLIVLAGNVALEHSGFETLGFAGGRADTWEADESIYWGAESTFVPKGNDVRYNGSTDIYERADKLEKPLGATHFGLIYVNPEGPDGSSDPKASALDIRTAFGRMGMDDEETAALIIGGHTLGKTHGAVPAKNIGPEPMAADLGEMGLGWHNSVNEGNGPDQMTSGLEVIWSTTPTKWSNHFLKSLLGNNWTLVESPAGHKQWEALNGKLEYPDPFVKGKFRRPTMLTSDLALINDPSYLKICKRWHDNPKEMNAAFARAWYKLLHRDLGPVSRYLGPEVAKEKFIWQDPLPERKGDIIGEAEISSLKSTILSTDGLDVSKLVSTAWNSASTFRGTDKRGGANGARIALEPQINWASNNPKQLKQVLSALKKVQKDFNAKSGSKKVSLADLIVLGGVAAIEKAAQAAGFKDVEVPFTPGRVDATQNQTDLVQFGYLEPLADGFRNYGHGTARARTEEILVDRAALLTLTPPEMTVLVGGLRALNANYDGSSNGILTEKKGQLTNDFFVNLLSPAYSWAKKDDRGELWTGTDRSTKSVKWTATRADLVFGSHAELRAISEVYGSADAKEKFVKDFISAWTKVMNLDRFDVKVEK

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 11, 3 introns) and 3 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACGTGCAATCACTCCTGCTGGCTTCTGGCCTTGTGCCTCTGGCCGCTAGCCAGGGCTGCCCTTTTGCCAAGCGCGCCACGGACACTAACCTCGTCCCGCCGCGAGAAATCCCCGAG
GACTTTGGCATCTGCCGCGTCGCTAGCAATCAGGCTGGTGGCGGTACTCGATCCAGGGACTTTTGGCCTTGTGCTCTGCGGTGGGATGTCTTGAGGCAGTTTTCACCCCAGTATAACCAA
TTGGGTGCTGGATTCGACTACACCGAAGCTTTCAAGTCTTTGGACT
GTGGGGTCCACTGAATCTGGGGATGGACGACTATTTACTGATTTATTTTGCAGTTGCTGCTCTGAAGAAGGACC
TCAACGCGCTTCTCACGGATTCTCAAGATTGGTGGCCTGCTGACCATGGAAACTATGGTGGTCTCTTCATTCGTATGTCATGGCACAGCGCTGGTACATACCGCGCAATGGACGGCCGAG
GTGGCGCCGGAATG
GTGAGTAATGACCTCAGTATCCTATTCTCGAGTGTTTTGCTAACGGACACAGGGTCAACAAAGATTCGCACCTCTCGACAGCTGGCCCGACAACCAGAACTTGGAC
AAAGCCCGTCGTCTGCTCT
GTACGTTACACAGCCGTCACACAAACCGCAAGATCTAACAAATCGCAGGGCCCATCAAGCAAAAGTACGGCAGCAAGATCTCATGGGCTGACTTGATCGTT
CTCGCCGGCAACGTCGCCCTCGAGCACAGCGGCTTCGAGACCCTCGGTTTCGCCGGTGGTCGCGCTGACACCTGGGAGGCCGATGAGTCCATCTACTGGGGTGCCGAGTCCACCTTTGTC
CCCAAGGGTAACGACGTTCGCTACAACGGTAGCACAGACATTTACGAGCGTGCCGACAAGCTCGAGAAGCCCCTTGGTGCAACGCACTTTGGTCTCATCTACGTCAACCCTGAGGGTCCT
GATGGAAGCTCTGACCCCAAGGCTTCTGCTCTTGATATCCGTACTGCTTTCGGTCGTATGGGTATGGACGATGAGGAGACTGCTGCTCTCATCATTGGTGGTCACACCCTGGGCAAGACT
CACGGTGCTGTTCCTGCTAAGAACATTGGCCCTGAGCCCATGGCTGCTGACCTTGGAGAGATGGGTCTTGGATGGCACAACAGCGTCAACGAGGGTAACGGTCCTGACCAGATGACCAGC
GGTCTCGAGGTTATCTGGTCCACCACTCCCACCAA
GTACGTCCCCTCTCTGCATCTGAGTCTCACCCGTACTAACAAATCATAGGTGGAGCAACCACTTCCTCAAGTCTCTTCTCGGCAA
CAACTGGACCCTCGTCGAGAGCCCCGCTGGCCACAAGCAATGGGAGGCTCTCAACGGCAAGCTTGAGTACCCCGACCCCTTCGTCAAGGGCAAGTTCCGCCGCCCCACCATGCTCACTAG
CGATCTCGCCCTCATCAACGACCCCTCGTACCTCAAGATCTGCAAGCGCTGGCATGACAACCCCAAGGAGATGAACGCTGCTTTCGCTCGTGCATGGTACAAGCTCCTCCACCGTGATCT
CGGCCCTGTTTCTCGCTACCTTGGTCCCGAGGTCGCTAAGGAGAAGTTCATCTGGCAGGATCCTCTCCCTGAGCGAAAGGGTGATATCATTGGCGAGGCTGAGATCTCGAGCCTCAAGTC
CACTATCCTGTCTACTGATGGTCTTGATGTTTCTAAGCTTGTTTCTACTGCTTGGAACTCTGCTTCTACTTTCCGTGGAACTGACAAGCGTGGTGGTGCCAACGGTGCTCGTATTGCTCT
TGAGCCTCAGATCAACTGGGCCAGCAACAACCCCAAGCAGCTCAAGCAGGTTCTCTCTGCACTGAAGAAGGTCCAGAAGGACTTCAACGCCAAGTCCGGCTCCAAGAAGGTCTCTCTCGC
TGATCTGATTGTTCTCGGTGGTGTTGCTGCTATCGAGAAGGCTGCCCAGGCTGCTGGCTTCAAGGACGTCGAGGTTCCTTTCACTCCTGGCCGTGTTGATGCTACCCAGAACCAGACCGA
TCTCGTTCAGTTCGGTTACCTTGAGCCCCTTGCTGATGGTTTCCGTAACTATGGACATGGTACTGCCCGTGCTCGCACTGAGGAGATCCTCGTTGACCGCGCTGCTCTTCTTACCCTTAC
TCCTCCCGAGATGACCGTCCTCGTCGGTGGTCTCCGTGCCTTGAACGCCAACTACGACGGTTCTTCCAACGGTATTCTCACTGAGAAGAAGGGCCAGCTGACCAACGACTTCTTCGTCAA
CCTTCTCTCTCCCGCCTACTCATGGGCCAAGAAGGATGACCGTGGTGAGCTCTGGACCGGCACTGACCGCTCCACCAAGTCCGTCAAGTGGACTGCTACCCGCGCTGATCTGGTCTTCGG
ATCTCATGCTGAGCTGCGTGCCATCTCTGAGGTCTACGGTAGCGCTGATGCGAAAGAGAAGTTTGTGAAGGATTTCATTTCTGCATGGACCAAGGTCATGAACCTGGACCGCTTTGATGT
CAAGGTTGAGAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACGTGCAATCACTCCTGCTGGCTTCTGGCCTTGTGCCTCTGGCCGCTAGCCAGGGCTGCCCTTTTGCCAAGCGCGCCACGGACACTAACCTCGTCCCGCCGCGAGAAATCCCCGAG
GACTTTGGCATCTGCCGCGTCGCTAGCAATCAGGCTGGTGGCGGTACTCGATCCAGGGACTTTTGGCCTTGTGCTCTGCGGTGGGATGTCTTGAGGCAGTTTTCACCCCAGTATAACCAA
TTGGGTGCTGGATTCGACTACACCGAAGCTTTCAAGTCTTTGGACT
TTGCTGCTCTGAAGAAGGACCTCAACGCGCTTCTCACGGATTCTCAAGATTGGTGGCCTGCTGACCATGGAAAC
TATGGTGGTCTCTTCATTCGTATGTCATGGCACAGCGCTGGTACATACCGCGCAATGGACGGCCGAGGTGGCGCCGGAATG
GGTCAACAAAGATTCGCACCTCTCGACAGCTGGCCCGAC
AACCAGAACTTGGACAAAGCCCGTCGTCTGCTCT
GGCCCATCAAGCAAAAGTACGGCAGCAAGATCTCATGGGCTGACTTGATCGTTCTCGCCGGCAACGTCGCCCTCGAGCACAGCGGC
TTCGAGACCCTCGGTTTCGCCGGTGGTCGCGCTGACACCTGGGAGGCCGATGAGTCCATCTACTGGGGTGCCGAGTCCACCTTTGTCCCCAAGGGTAACGACGTTCGCTACAACGGTAGC
ACAGACATTTACGAGCGTGCCGACAAGCTCGAGAAGCCCCTTGGTGCAACGCACTTTGGTCTCATCTACGTCAACCCTGAGGGTCCTGATGGAAGCTCTGACCCCAAGGCTTCTGCTCTT
GATATCCGTACTGCTTTCGGTCGTATGGGTATGGACGATGAGGAGACTGCTGCTCTCATCATTGGTGGTCACACCCTGGGCAAGACTCACGGTGCTGTTCCTGCTAAGAACATTGGCCCT
GAGCCCATGGCTGCTGACCTTGGAGAGATGGGTCTTGGATGGCACAACAGCGTCAACGAGGGTAACGGTCCTGACCAGATGACCAGCGGTCTCGAGGTTATCTGGTCCACCACTCCCACC
AA
GTGGAGCAACCACTTCCTCAAGTCTCTTCTCGGCAACAACTGGACCCTCGTCGAGAGCCCCGCTGGCCACAAGCAATGGGAGGCTCTCAACGGCAAGCTTGAGTACCCCGACCCCTTC
GTCAAGGGCAAGTTCCGCCGCCCCACCATGCTCACTAGCGATCTCGCCCTCATCAACGACCCCTCGTACCTCAAGATCTGCAAGCGCTGGCATGACAACCCCAAGGAGATGAACGCTGCT
TTCGCTCGTGCATGGTACAAGCTCCTCCACCGTGATCTCGGCCCTGTTTCTCGCTACCTTGGTCCCGAGGTCGCTAAGGAGAAGTTCATCTGGCAGGATCCTCTCCCTGAGCGAAAGGGT
GATATCATTGGCGAGGCTGAGATCTCGAGCCTCAAGTCCACTATCCTGTCTACTGATGGTCTTGATGTTTCTAAGCTTGTTTCTACTGCTTGGAACTCTGCTTCTACTTTCCGTGGAACT
GACAAGCGTGGTGGTGCCAACGGTGCTCGTATTGCTCTTGAGCCTCAGATCAACTGGGCCAGCAACAACCCCAAGCAGCTCAAGCAGGTTCTCTCTGCACTGAAGAAGGTCCAGAAGGAC
TTCAACGCCAAGTCCGGCTCCAAGAAGGTCTCTCTCGCTGATCTGATTGTTCTCGGTGGTGTTGCTGCTATCGAGAAGGCTGCCCAGGCTGCTGGCTTCAAGGACGTCGAGGTTCCTTTC
ACTCCTGGCCGTGTTGATGCTACCCAGAACCAGACCGATCTCGTTCAGTTCGGTTACCTTGAGCCCCTTGCTGATGGTTTCCGTAACTATGGACATGGTACTGCCCGTGCTCGCACTGAG
GAGATCCTCGTTGACCGCGCTGCTCTTCTTACCCTTACTCCTCCCGAGATGACCGTCCTCGTCGGTGGTCTCCGTGCCTTGAACGCCAACTACGACGGTTCTTCCAACGGTATTCTCACT
GAGAAGAAGGGCCAGCTGACCAACGACTTCTTCGTCAACCTTCTCTCTCCCGCCTACTCATGGGCCAAGAAGGATGACCGTGGTGAGCTCTGGACCGGCACTGACCGCTCCACCAAGTCC
GTCAAGTGGACTGCTACCCGCGCTGATCTGGTCTTCGGATCTCATGCTGAGCTGCGTGCCATCTCTGAGGTCTACGGTAGCGCTGATGCGAAAGAGAAGTTTGTGAAGGATTTCATTTCT
GCATGGACCAAGGTCATGAACCTGGACCGCTTTGATGTCAAGGTTGAGAAGTAG

Retrieve as FASTA