Entry information : MgrAPx-CcP02 (MagHyBpox2)
Entry ID 5356
Creation 2007-05-15 (Marcel Zamocky)
Last sequence changes 2007-05-15 (Marcel Zamocky)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2016-12-20 (Marcel Zamocky)
Peroxidase information: MgrAPx-CcP02 (MagHyBpox2)
Name (synonym) MgrAPx-CcP02 (MagHyBpox2)
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Magnaporthaceae Magnaporthe
Organism Magnaporthe grisea (Pyricularia grisea)    [TaxId: 148305 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MgrAPx-CcP02
start..stop
S start..stop
MgrAPx-CcP2_DS0505 1404 0 1..803 1..811
GgrAPx-CcP2 1059 0 11..799 7..796
GgrAPx-CcP2 234 2e-65 576..801 696..944
GgrAPx-CcP2 101 3e-22 545..678 828..944
GgrAPx-CcP2 96 1e-20 699..800 571..667
MpoaAPx-CcP02 1014 0 11..760 8..755
MpoaAPx-CcP02 100 5e-22 699..800 572..668
CtheAPx-CcP01 871 0 1..799 1..786
CtheAPx-CcP01 204 4e-55 578..801 688..903
CtheAPx-CcP01 200 1e-53 570..800 792..1024
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 560535..560712 178 N° 2 558223..560459 2237  
complement(join(558223..560459,560535..560712))


exon

Literature and cross-references MgrAPx-CcP02 (MagHyBpox2)
Literature REFERENCE#1 Dean R.A., et al. (2005) The genome sequence of the rice blast fungus Magnaporthe grisea. Nature 434:980-986.
REFERENCE#2 Zamocky M., et al. (2014) Turning points in the evolution of peroxidase-catalase superfamily - molecular phylogeny of hybrid heme peroxidases. Cell. Mol. Life Sci. 71:4681-4696.
Protein ref. GenPept:   EDK03687 UniProtKB_Uniparc:   A4RHB6
DNA ref. JGI genome:   Supercontig_6.29 (560712..558223)
EST ref. GenBank:   DC977217
Protein sequence: MgrAPx-CcP02 (MagHyBpox2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   804 (782)
PWM (Da):   %s   83989.34 (81789.1)  
PI (pH):   %s   4.53 (4.47) Peptide Signal:   %s   cut: 23 range:23-804
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRSRSFQSGALVAVLLAATVAADPTWPNPQIDELEEIMFQTSGFKARLFTDNIRQCANEASGPGRKTAAEWLRTSFHDMSTHNKYFGTGGLDGSLQYELNSGENTGPGLRTTLSFLGGFVSSRSSLSDLIAMGAHASVRSCGGPDIPVRVGRVDATSAGAIGVPQVQNPVATFQNQFDRMGFNQAEMIQLVACGHTLGGVHSVDFPDLVTPGSGGPNGVVGMDSTQASFDNSVVTEYLDGTTQNPLVVGPSVQLRKNSDGRIFAADGNATVNAMRDPAVYQSMCRSILQRMIDTVPSGVTLSDEPITPYTVKPVDMQLTLGSQGSTLQLNGHIRIRTTTIPLNTVRNVVVTYKDRHGGNECGTCAVTSTVQGTGAGLEDTWAFFPVSASLSATSGISSFTVTINRVDGTSTVFDNNGAHYPISDAVLLQKPQSCLLQGSGALTVSAVVRNDHAALPINLGVTYQTAQTNSPVPALNHESIPMVKGDCVGAYTFYSATFSIPGGRSFAARLDIVSGAGETAVSDAFNLAADLAGTCQPFAGSQACADVTVTTAIPSSTNPPTSTSATTTPPVVTPTPTGVPEHIQNLGDYELVSCWTEGVGVRALAGATFVYDGMTLETCMGNCTGFAYFGTEYGRECYCGNSLHPSSGPADLADCNMQCSGNLLQYCGAGDRIELYKNAAIPTTTISLPPIPTATATPSHQPTVTAVDGGVWSFQECRTEATEGRALTGNAYFDDAMTLEACASACTAFTFFGVEYGRECYCGDSFGEGSVEAAETDCSFPCPGDGAQLCGAGVRLSTYRRVEA

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron), no EST. Strain="70-15/FGSC 8958". Peroxidase domain fused to 2 WSC domains (putative carbohydrate binding domain). Strain=VdLs.17.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGGTCACGATCGTTTCAATCCGGAGCGCTTGTTGCCGTCCTGTTGGCGGCAACCGTAGCAGCAGACCCAACATGGCCAAATCCGCAAATCGATGAGTTGGAAGAAATCATGTTTCAA
ACCAGTGGCTTCAAGGCACGGCTGTTTACGGATAATATCAGGCAGTGCGCCAATGAAG
GTAGGAATGACTGACCACGGCACCGCATTCCAAGAAAAAGAAATATCAAATGCTAACAGACT
AACTGAATTGCAGCCTCTGGCCCGGGAAGAAAAACCGCGGCAGAATGGCTGAGGACATCGTTCCACGATATGAGTACGCACAACAAGTACTTCGGCACCGGCGGCTTGGATGGCTCGCTG
CAGTACGAGCTCAACAGTGGTGAAAACACTGGCCCTGGCCTGCGGACGACACTTAGCTTCCTCGGCGGTTTCGTGTCCAGCCGGAGTTCGCTGTCTGATCTGATAGCCATGGGGGCGCAT
GCCTCAGTCCGCTCCTGTGGTGGCCCTGATATACCTGTCAGGGTAGGCAGAGTCGATGCAACATCAGCTGGTGCGATCGGCGTGCCGCAGGTCCAAAACCCAGTTGCTACATTCCAGAAT
CAGTTCGACCGTATGGGGTTCAACCAGGCCGAGATGATCCAGCTGGTAGCTTGTGGACACACCTTGGGAGGAGTCCACTCAGTCGATTTTCCTGATCTTGTTACGCCCGGATCCGGTGGC
CCCAATGGGGTTGTGGGCATGGACTCGACACAGGCCAGCTTCGACAACAGCGTCGTCACCGAGTATCTGGATGGCACGACACAGAACCCTCTCGTTGTCGGGCCTTCGGTCCAGTTGAGG
AAGAATTCCGACGGTAGAATCTTTGCGGCGGATGGAAACGCAACCGTCAACGCAATGAGGGATCCGGCCGTGTATCAATCCATGTGCAGAAGTATCCTCCAACGAATGATAGACACTGTC
CCATCAGGGGTCACTCTCTCAGACGAGCCGATTACCCCGTACACCGTCAAGCCAGTCGACATGCAACTCACACTAGGGTCGCAAGGGTCTACGTTGCAATTGAATGGTCACATACGCATA
AGGACGACGACCATTCCGCTGAACACGGTCCGTAACGTGGTCGTCACTTACAAAGACCGCCACGGAGGAAACGAATGTGGAACCTGCGCTGTCACTTCGACGGTGCAAGGAACTGGTGCA
GGACTTGAAGACACTTGGGCTTTCTTCCCCGTATCTGCTTCCTTGAGTGCCACTTCAGGTATCTCGTCCTTCACTGTTACGATTAATAGGGTCGATGGCACCTCGACCGTTTTCGACAAC
AACGGCGCTCATTACCCCATATCCGACGCTGTCTTGCTGCAAAAGCCCCAGAGCTGTCTCCTTCAGGGGTCTGGTGCTCTCACGGTATCGGCCGTTGTTCGTAATGACCATGCAGCACTG
CCAATAAACCTGGGAGTCACATATCAGACGGCACAGACTAACAGCCCAGTTCCAGCCCTGAACCACGAGTCAATCCCGATGGTCAAGGGAGACTGCGTAGGCGCCTACACCTTTTACTCG
GCAACATTTTCAATCCCAGGCGGGAGAAGTTTCGCAGCCAGGTTGGACATTGTCAGCGGCGCCGGTGAGACGGCAGTCAGTGACGCCTTTAACCTGGCTGCCGACTTGGCTGGGACATGC
CAGCCATTTGCGGGCAGCCAGGCATGTGCGGACGTTACTGTCACCACAGCTATCCCGAGCTCGACGAACCCTCCTACCTCTACGAGTGCCACCACTACTCCTCCAGTAGTAACACCAACA
CCAACGGGGGTTCCCGAGCACATCCAAAACTTGGGCGACTACGAGTTGGTTTCTTGCTGGACTGAGGGCGTAGGTGTCCGCGCCCTGGCAGGGGCCACATTTGTCTATGATGGGATGACA
TTGGAAACCTGCATGGGCAACTGCACAGGGTTTGCATACTTTGGGACAGAATATGGGAGAGAATGCTATTGCGGGAATTCCCTACACCCATCCAGCGGCCCTGCGGACCTGGCAGACTGC
AACATGCAGTGCTCGGGCAATCTCTTGCAGTACTGTGGCGCGGGCGATAGAATTGAGCTGTACAAAAACGCCGCCATTCCAACGACGACTATTAGTCTACCTCCAATCCCCACAGCTACA
GCCACTCCCTCACACCAGCCCACAGTCACCGCGGTGGATGGTGGCGTCTGGAGCTTCCAGGAGTGTCGGACCGAAGCGACCGAGGGCCGGGCTCTGACCGGAAATGCCTACTTTGACGAC
GCCATGACACTCGAGGCTTGCGCCTCGGCATGCACAGCATTCACCTTCTTTGGAGTCGAATATGGCCGAGAGTGCTACTGCGGAGACAGCTTTGGCGAGGGTTCAGTCGAGGCGGCGGAG
ACGGACTGTAGCTTTCCCTGCCCCGGAGACGGGGCACAGCTCTGCGGCGCCGGTGTGCGACTTAGCACATACCGTCGGGTAGAAGCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGGTCACGATCGTTTCAATCCGGAGCGCTTGTTGCCGTCCTGTTGGCGGCAACCGTAGCAGCAGACCCAACATGGCCAAATCCGCAAATCGATGAGTTGGAAGAAATCATGTTTCAA
ACCAGTGGCTTCAAGGCACGGCTGTTTACGGATAATATCAGGCAGTGCGCCAATGAAG
CCTCTGGCCCGGGAAGAAAAACCGCGGCAGAATGGCTGAGGACATCGTTCCACGATATGAGT
ACGCACAACAAGTACTTCGGCACCGGCGGCTTGGATGGCTCGCTGCAGTACGAGCTCAACAGTGGTGAAAACACTGGCCCTGGCCTGCGGACGACACTTAGCTTCCTCGGCGGTTTCGTG
TCCAGCCGGAGTTCGCTGTCTGATCTGATAGCCATGGGGGCGCATGCCTCAGTCCGCTCCTGTGGTGGCCCTGATATACCTGTCAGGGTAGGCAGAGTCGATGCAACATCAGCTGGTGCG
ATCGGCGTGCCGCAGGTCCAAAACCCAGTTGCTACATTCCAGAATCAGTTCGACCGTATGGGGTTCAACCAGGCCGAGATGATCCAGCTGGTAGCTTGTGGACACACCTTGGGAGGAGTC
CACTCAGTCGATTTTCCTGATCTTGTTACGCCCGGATCCGGTGGCCCCAATGGGGTTGTGGGCATGGACTCGACACAGGCCAGCTTCGACAACAGCGTCGTCACCGAGTATCTGGATGGC
ACGACACAGAACCCTCTCGTTGTCGGGCCTTCGGTCCAGTTGAGGAAGAATTCCGACGGTAGAATCTTTGCGGCGGATGGAAACGCAACCGTCAACGCAATGAGGGATCCGGCCGTGTAT
CAATCCATGTGCAGAAGTATCCTCCAACGAATGATAGACACTGTCCCATCAGGGGTCACTCTCTCAGACGAGCCGATTACCCCGTACACCGTCAAGCCAGTCGACATGCAACTCACACTA
GGGTCGCAAGGGTCTACGTTGCAATTGAATGGTCACATACGCATAAGGACGACGACCATTCCGCTGAACACGGTCCGTAACGTGGTCGTCACTTACAAAGACCGCCACGGAGGAAACGAA
TGTGGAACCTGCGCTGTCACTTCGACGGTGCAAGGAACTGGTGCAGGACTTGAAGACACTTGGGCTTTCTTCCCCGTATCTGCTTCCTTGAGTGCCACTTCAGGTATCTCGTCCTTCACT
GTTACGATTAATAGGGTCGATGGCACCTCGACCGTTTTCGACAACAACGGCGCTCATTACCCCATATCCGACGCTGTCTTGCTGCAAAAGCCCCAGAGCTGTCTCCTTCAGGGGTCTGGT
GCTCTCACGGTATCGGCCGTTGTTCGTAATGACCATGCAGCACTGCCAATAAACCTGGGAGTCACATATCAGACGGCACAGACTAACAGCCCAGTTCCAGCCCTGAACCACGAGTCAATC
CCGATGGTCAAGGGAGACTGCGTAGGCGCCTACACCTTTTACTCGGCAACATTTTCAATCCCAGGCGGGAGAAGTTTCGCAGCCAGGTTGGACATTGTCAGCGGCGCCGGTGAGACGGCA
GTCAGTGACGCCTTTAACCTGGCTGCCGACTTGGCTGGGACATGCCAGCCATTTGCGGGCAGCCAGGCATGTGCGGACGTTACTGTCACCACAGCTATCCCGAGCTCGACGAACCCTCCT
ACCTCTACGAGTGCCACCACTACTCCTCCAGTAGTAACACCAACACCAACGGGGGTTCCCGAGCACATCCAAAACTTGGGCGACTACGAGTTGGTTTCTTGCTGGACTGAGGGCGTAGGT
GTCCGCGCCCTGGCAGGGGCCACATTTGTCTATGATGGGATGACATTGGAAACCTGCATGGGCAACTGCACAGGGTTTGCATACTTTGGGACAGAATATGGGAGAGAATGCTATTGCGGG
AATTCCCTACACCCATCCAGCGGCCCTGCGGACCTGGCAGACTGCAACATGCAGTGCTCGGGCAATCTCTTGCAGTACTGTGGCGCGGGCGATAGAATTGAGCTGTACAAAAACGCCGCC
ATTCCAACGACGACTATTAGTCTACCTCCAATCCCCACAGCTACAGCCACTCCCTCACACCAGCCCACAGTCACCGCGGTGGATGGTGGCGTCTGGAGCTTCCAGGAGTGTCGGACCGAA
GCGACCGAGGGCCGGGCTCTGACCGGAAATGCCTACTTTGACGACGCCATGACACTCGAGGCTTGCGCCTCGGCATGCACAGCATTCACCTTCTTTGGAGTCGAATATGGCCGAGAGTGC
TACTGCGGAGACAGCTTTGGCGAGGGTTCAGTCGAGGCGGCGGAGACGGACTGTAGCTTTCCCTGCCCCGGAGACGGGGCACAGCTCTGCGGCGCCGGTGTGCGACTTAGCACATACCGT
CGGGTAGAAGCCTGA

Retrieve as FASTA