Entry information : CgAPx-CcP02 (CgHyBpox2)
Entry ID 5357
Creation 2007-05-16 (Marcel Zamocky)
Last sequence changes 2007-05-16 (Marcel Zamocky)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2015-03-04 (Marcel Zamocky)
Peroxidase information: CgAPx-CcP02 (CgHyBpox2)
Name (synonym) CgAPx-CcP02 (CgHyBpox2)
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Chaetomiaceae Chaetomium
Organism Chaetomium globosum    [TaxId: 38033 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CgAPx-CcP02
start..stop
S start..stop
StheAPx-CcP01 1597 0 1..1051 1..1052
CtheAPx-CcP01 1325 0 1..1049 1..1023
CtheAPx-CcP01 339 2e-100 583..927 691..1027
CtheAPx-CcP01 202 2e-53 569..797 793..1027
CtheAPx-CcP01 106 1e-23 942..1050 574..673
PanAPx-CcP01 1287 0 20..1049 24..1035
PanAPx-CcP01 320 8e-94 585..924 702..1036
PanAPx-CcP01 288 2e-82 697..1051 585..930
TterAPx-CcP1 1143 0 1..754 1..753
TterAPx-CcP1 179 4e-47 698..884 584..753
TterAPx-CcP1 149 2e-37 832..1010 588..753
TterAPx-CcP1 101 5e-22 962..1049 591..678
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1233202..1233425 224 N° 2 1232139..1233051 913 N° 3 1231893..1232087 195 N° 4 1230914..1231841 928
N° 5 1230692..1230853 162 N° 6 1229874..1230613 740  
complement(join(1229874..1230613,1230692..1230853,1230914..1231841,1231893..1232 087,1232139..1233051,1233202..1233425))


exon

Literature and cross-references CgAPx-CcP02 (CgHyBpox2)
Literature Birren B.W., et al. Annotation of the Chaetomium globosum CBS 148.51 genome. Submitted (MAR-2005) to the EMBL/GenBank/DDBJ databases.
Protein ref. GenPept:   88183115 UniProtKB:   Q2HB86
DNA ref. JGI genome:   scaffold_2 (1233425..1229874)
Protein sequence: CgAPx-CcP02 (CgHyBpox2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1053 (1032)
PWM (Da):   %s   109614.2 (107472.0)  
PI (pH):   %s   4.14 (4.09) Peptide Signal:   %s   cut: 22 range:22-1053
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRTKAPVFASLLSLAAQTGKADPTWPATTDHMEEIIYQLQGVQGSLFNDIITPCNNEAAGPGRVTASEWLRVGFQSDMAPHNKYFGTGGVDGSLQFELNNGENTGPGHRTTLQFYANYLTSQSSLADLIAAGVYASVRSCGGPVVPLRLGRKDATSAGSAGVPQPQNSIVSFRQQFDRMGFTATEMIQLVACGHTLGSVHSTEFPQIVPESVGQVPFDTTNAQFDNKVATEYVAGNTKNALVVGASIAVGRNSDFKVYNSDGNATISTLTDATVFRNTCQAMLQKMIEVVPEGVTLTEPIAPYAVKPVDMQLTLNTGGTSFRLTGFIRVRTTEVPASSIENVVLTWKDRNGGNSCGSSATCSTTATLQGVSTGFDDTFFFPIEATIPTAAGISSFTIVVNYDDGSSEEYDNNGNSYPMSDAIVLQKPQSCLLQGPGDLTVSALVRNDHKDLPVNLGVSYLTPRNTADGNPVPALNEATVEMVEGDCVGQYTFFSASLNIPGGLSFNSRISVTAGSGATAYTDDFNKASDLGGTCGTFTGGATCADVTTPPTPSSTSVPVSSSTSVPVTTTSSSSSTAAPTPAIKPTVGGYVFVDCWTEGTGARALGGAAFAYDEMTLESCMTNCTGFDYWATEYGRECYCGNSLHSSSTEAPVEECNMVCGGDPTEFCGAGNRLELYSTTATRTTSATPTPTGSLAVKPTVGDYTFVGCQTEATGSRALSGKDVYADDAMTLELCATYCAGYTYFGTEYGRECYCGNSLNSGSVSAPVTECNMVCGGDPYEYCGAGDRLELYRLSSVSTTGSPSSEVSLSQAATTTTSSAPTTTLSRTPTVSPYTHIGCWTEGTGARALGAKTYASGDGMTLENCAAFCAGYRYFGTEYAAECYCGNVLHASSTNASLADCAMPCSGNPAQYCGGPDRLELYENDAAPTTTTTTNPDPPAPTPTQPTTISAVEGEGEGNQWEFHGCVTEAMGVRALGAAALASDELTLEACAEFCAAYQFFGAEYGRECYCGDQLAETAADAPATECSMACAGDVGVLCGSGNRLSVYAKVV

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns). No EST available. Peroxidase domain fused to 3 WSC domains (putative carbohydrate binding domain). Strain="ATCC 6205 / CBS 148.51 / DSM 1962 / IFO 6347 / NRRL 1970". Peroxidase domain fused to 4 WSC domains (putative carbohydrate binding domain).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAACAAAAGCGCCTGTCTTTGCCAGTCTGCTGTCCCTCGCGGCCCAGACTGGCAAGGCGGATCCGACATGGCCCGCCACCACCGACCACATGGAGGAGATTATCTACCAGCTCCAG
GGCGTTCAGGGCAGTCTGTTTAACGACATCATCACGCCTTGCAACAACGAAGCTGCCGGCCCCGGGCGCGTAACCGCCAGCGAATGGCTGCGCGTGGGTTTTCA
GTACGTGATGTTCACT
TGTAGGAAATCAGGAGGTGGATAGGACCGAAATACCGGGAGCCCCTGGGTGTGACATAGAGCCCGCGGACAAGTGAGATATTGGGGCGTTAGGCAATGGTTTAGTCGTTGATTCCATGGG
AATGCTAACTGAAGAAGTGACATGGCACCACACAACAAATACTTCGGCACCGGTGGAGTTGACGGCTCGCTGCAGTTCGAGCTGAACAATGGCGAAAATACCGGACCCGGCCACCGAACA
ACACTGCAGTTTTACGCCAACTACTTGACATCGCAGTCCTCTCTGGCCGACCTGATCGCCGCTGGAGTGTACGCTTCTGTCCGCTCCTGCGGTGGTCCCGTCGTCCCCCTCAGACTCGGG
CGGAAGGACGCGACCTCAGCCGGCAGCGCCGGCGTCCCGCAGCCCCAGAACTCCATTGTCTCTTTTAGACAACAGTTTGACCGCATGGGCTTCACCGCCACCGAGATGATCCAATTGGTC
GCCTGCGGCCATACTCTCGGCTCTGTTCACAGCACTGAGTTCCCCCAGATCGTCCCCGAGTCTGTTGGACAGGTTCCTTTTGATACGACCAACGCCCAGTTTGACAACAAGGTGGCCACT
GAATATGTCGCCGGGAACACGAAAAATGCACTTGTCGTTGGTGCCTCTATCGCCGTTGGCCGAAACTCGGATTTCAAGGTCTATAACTCGGACGGGAACGCTACCATCAGCACGTTGACC
GACGCCACTGTCTTCCGTAACACTTGCCAGGCCATGCTTCAGAAAATGATCGAGGTTGTTCCCGAGGGCGTCACCCTTACCGAGCCCATCGCCCCCTATGCCGTCAAGCCGGTCGATATG
CAATTGACCCTGAACACGGGCGGCACCAGCTTCCGTTTGACCGGTTTCATTAGAGTTAGGACCACCGAGGTTCCGGCGAGCTCCATTGAGAACGTTGTTCTTACTTGGAAGGACCGGAAC
GGCGGGAACAGCTGCGGATCGTCTGCCACCTGCTCCACCACGGCTACGCTACAGGGTGTGTCAACTGGCTTCGACGATACCTTTGGC
GTACGTACCAGCCCCGCCCATATCCCCTGATAG
TGACGCTGACAACACCAGTTCTTTCCGATCGAAGCCACGATTCCGACCGCCGCCGGCATCTCATCGTTCACCATTGTGGTGAACTATGACGACGGGTCAAGCGAGGAGTACGATAACAAC
GGCAATTCTTACCCCATGTCTGATGCCATTGTCCTGCAGAAGCCGCAGAGCTGCCTGCTCCAAGGGCCCGGCGATCTCACTGTTTCTGCCCTG
GTATGTTTCGCCCAGGAACGATAGTTG
GCCCCGGTATTAACCAAGGTATAGGTTCGCAATGACCACAAGGACCTCCCGGTGAACCTCGGTGTTTCGTATTTGACGCCTCGTAACACAGCGGACGGCAACCCGGTTCCGGCCCTGAAC
GAGGCCACCGTCGAGATGGTGGAGGGCGACTGTGTTGGCCAGTACACGTTCTTTTCGGCTAGTCTTAACATCCCCGGCGGTCTTAGCTTTAACTCCAGAATCAGTGTAACTGCCGGCTCG
GGAGCCACCGCTTACACGGACGACTTCAACAAGGCCAGCGACCTGGGCGGTACTTGCGGTACCTTCACTGGGGGCGCCACCTGCGCTGATGTTACCACCCCACCCACCCCTTCGTCGACA
TCCGTTCCTGTCTCAAGCTCGACCAGCGTTCCCGTCACCACCACTAGCTCCAGCAGCTCCACCGCCGCGCCGACGCCCGCCATCAAGCCTACTGTTGGTGGTTATGTATTCGTCGACTGC
TGGACCGAAGGAACTGGCGCGCGGGCCCTCGGCGGTGCCGCGTTCGCCTACGACGAGATGACGCTCGAGTCCTGCATGACCAACTGCACTGGCTTCGATTACTGGGCCACCGAGTACGGC
CGAGAATGCTACTGCGGCAACAGTCTCCACTCCAGCAGCACCGAAGCACCTGTCGAGGAGTGCAACATGGTCTGCGGTGGTGACCCGACCGAGTTCTGCGGCGCCGGAAACCGCCTTGAG
CTGTACTCGACGACCGCGACCCGGACCACGTCTGCCACCCCCACTCCGACGGGAAGCCTGGCTGTCAAGCCGACCGTGGGCGACTACACGTTTGTTGGATGCCAAACGGAGGCGACTGGG
AGCAGGGCGCTTTCCGGCAAGGATGTGTATGCGGACGATGCCATGACTCTGGAACTGTGCGCGACGTACTGCGCTGGGTACACCTACTTTGGCACTGAGTACGGCCGCGAAT
GTGAGTGA
TACTATTGAACCGTACCCCCCCTTGAAACGTAGTGACTAACTTGTATGCTAGGCTACTGTGGAAACAGCCTCAATTCCGGGAGCGTCTCGGCCCCTGTGACGGAGTGCAACATGGTTTGC
GGCGGCGACCCGTACGAATACTGCGGCGCAGGCGACCGTCTGGAACTCTACAGACTATCGAGCGTTTCCACCACGGGAAGCCCGTCCTCAGAAG
GTGAGAGACGGCGTAGATTGGCTTAA
CAAAACCAAAAAAAAATATTACCACCCACCCGCAACGATTTCCTAACGTCAGTCTCTCTCTCTCAAGCCGCCACGACGACCACCAGCTCCGCCCCCACCACCACGCTCTCCCGCACCCCC
ACCGTCTCTCCCTACACCCACATCGGCTGCTGGACCGAGGGCACGGGCGCGCGCGCGCTCGGAGCCAAAACCTACGCTTCCGGCGACGGCATGACCCTCGAGAACTGCGCCGCCTTCTGC
GCCGGCTACCGCTACTTCGGCACCGAGTACGCCGCCGAGTGCTACTGCGGCAACGTGCTGCACGCCTCCTCCACCAACGCCTCCCTCGCCGACTGCGCCATGCCCTGCTCCGGCAACCCG
GCCCAATACTGCGGCGGGCCCGACCGCCTCGAGCTCTACGAGAACGATGCCGCCCCCACCACCACCACCACCACCAACCCCGACCCCCCCGCGCCGACACCAACCCAACCCACCACTATC
TCAGCCGTCGAGGGCGAGGGCGAGGGGAACCAGTGGGAATTCCACGGGTGCGTGACCGAGGCGATGGGCGTCCGGGCCCTGGGCGCCGCGGCCCTCGCGTCGGATGAGCTGACGCTCGAG
GCGTGTGCCGAGTTCTGTGCGGCGTACCAGTTCTTTGGCGCCGAGTACGGCCGCGAGTGCTACTGCGGTGACCAGTTGGCTGAGACCGCGGCTGACGCGCCCGCGACGGAGTGCTCGATG
GCGTGCGCTGGGGATGTGGGGGTGTTGTGTGGGAGTGGGAATCGGTTGAGTGTGTATGCGAAGGTAGTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAACAAAAGCGCCTGTCTTTGCCAGTCTGCTGTCCCTCGCGGCCCAGACTGGCAAGGCGGATCCGACATGGCCCGCCACCACCGACCACATGGAGGAGATTATCTACCAGCTCCAG
GGCGTTCAGGGCAGTCTGTTTAACGACATCATCACGCCTTGCAACAACGAAGCTGCCGGCCCCGGGCGCGTAACCGCCAGCGAATGGCTGCGCGTGGGTTTTCA
AAGTGACATGGCACCA
CACAACAAATACTTCGGCACCGGTGGAGTTGACGGCTCGCTGCAGTTCGAGCTGAACAATGGCGAAAATACCGGACCCGGCCACCGAACAACACTGCAGTTTTACGCCAACTACTTGACA
TCGCAGTCCTCTCTGGCCGACCTGATCGCCGCTGGAGTGTACGCTTCTGTCCGCTCCTGCGGTGGTCCCGTCGTCCCCCTCAGACTCGGGCGGAAGGACGCGACCTCAGCCGGCAGCGCC
GGCGTCCCGCAGCCCCAGAACTCCATTGTCTCTTTTAGACAACAGTTTGACCGCATGGGCTTCACCGCCACCGAGATGATCCAATTGGTCGCCTGCGGCCATACTCTCGGCTCTGTTCAC
AGCACTGAGTTCCCCCAGATCGTCCCCGAGTCTGTTGGACAGGTTCCTTTTGATACGACCAACGCCCAGTTTGACAACAAGGTGGCCACTGAATATGTCGCCGGGAACACGAAAAATGCA
CTTGTCGTTGGTGCCTCTATCGCCGTTGGCCGAAACTCGGATTTCAAGGTCTATAACTCGGACGGGAACGCTACCATCAGCACGTTGACCGACGCCACTGTCTTCCGTAACACTTGCCAG
GCCATGCTTCAGAAAATGATCGAGGTTGTTCCCGAGGGCGTCACCCTTACCGAGCCCATCGCCCCCTATGCCGTCAAGCCGGTCGATATGCAATTGACCCTGAACACGGGCGGCACCAGC
TTCCGTTTGACCGGTTTCATTAGAGTTAGGACCACCGAGGTTCCGGCGAGCTCCATTGAGAACGTTGTTCTTACTTGGAAGGACCGGAACGGCGGGAACAGCTGCGGATCGTCTGCCACC
TGCTCCACCACGGCTACGCTACAGGGTGTGTCAACTGGCTTCGACGATACCTTTGGC
TTCTTTCCGATCGAAGCCACGATTCCGACCGCCGCCGGCATCTCATCGTTCACCATTGTGGTG
AACTATGACGACGGGTCAAGCGAGGAGTACGATAACAACGGCAATTCTTACCCCATGTCTGATGCCATTGTCCTGCAGAAGCCGCAGAGCTGCCTGCTCCAAGGGCCCGGCGATCTCACT
GTTTCTGCCCTG
GTTCGCAATGACCACAAGGACCTCCCGGTGAACCTCGGTGTTTCGTATTTGACGCCTCGTAACACAGCGGACGGCAACCCGGTTCCGGCCCTGAACGAGGCCACCGTC
GAGATGGTGGAGGGCGACTGTGTTGGCCAGTACACGTTCTTTTCGGCTAGTCTTAACATCCCCGGCGGTCTTAGCTTTAACTCCAGAATCAGTGTAACTGCCGGCTCGGGAGCCACCGCT
TACACGGACGACTTCAACAAGGCCAGCGACCTGGGCGGTACTTGCGGTACCTTCACTGGGGGCGCCACCTGCGCTGATGTTACCACCCCACCCACCCCTTCGTCGACATCCGTTCCTGTC
TCAAGCTCGACCAGCGTTCCCGTCACCACCACTAGCTCCAGCAGCTCCACCGCCGCGCCGACGCCCGCCATCAAGCCTACTGTTGGTGGTTATGTATTCGTCGACTGCTGGACCGAAGGA
ACTGGCGCGCGGGCCCTCGGCGGTGCCGCGTTCGCCTACGACGAGATGACGCTCGAGTCCTGCATGACCAACTGCACTGGCTTCGATTACTGGGCCACCGAGTACGGCCGAGAATGCTAC
TGCGGCAACAGTCTCCACTCCAGCAGCACCGAAGCACCTGTCGAGGAGTGCAACATGGTCTGCGGTGGTGACCCGACCGAGTTCTGCGGCGCCGGAAACCGCCTTGAGCTGTACTCGACG
ACCGCGACCCGGACCACGTCTGCCACCCCCACTCCGACGGGAAGCCTGGCTGTCAAGCCGACCGTGGGCGACTACACGTTTGTTGGATGCCAAACGGAGGCGACTGGGAGCAGGGCGCTT
TCCGGCAAGGATGTGTATGCGGACGATGCCATGACTCTGGAACTGTGCGCGACGTACTGCGCTGGGTACACCTACTTTGGCACTGAGTACGGCCGCGAAT
GCTACTGTGGAAACAGCCTC
AATTCCGGGAGCGTCTCGGCCCCTGTGACGGAGTGCAACATGGTTTGCGGCGGCGACCCGTACGAATACTGCGGCGCAGGCGACCGTCTGGAACTCTACAGACTATCGAGCGTTTCCACC
ACGGGAAGCCCGTCCTCAGAAG
TCTCTCTCTCTCAAGCCGCCACGACGACCACCAGCTCCGCCCCCACCACCACGCTCTCCCGCACCCCCACCGTCTCTCCCTACACCCACATCGGCTGC
TGGACCGAGGGCACGGGCGCGCGCGCGCTCGGAGCCAAAACCTACGCTTCCGGCGACGGCATGACCCTCGAGAACTGCGCCGCCTTCTGCGCCGGCTACCGCTACTTCGGCACCGAGTAC
GCCGCCGAGTGCTACTGCGGCAACGTGCTGCACGCCTCCTCCACCAACGCCTCCCTCGCCGACTGCGCCATGCCCTGCTCCGGCAACCCGGCCCAATACTGCGGCGGGCCCGACCGCCTC
GAGCTCTACGAGAACGATGCCGCCCCCACCACCACCACCACCACCAACCCCGACCCCCCCGCGCCGACACCAACCCAACCCACCACTATCTCAGCCGTCGAGGGCGAGGGCGAGGGGAAC
CAGTGGGAATTCCACGGGTGCGTGACCGAGGCGATGGGCGTCCGGGCCCTGGGCGCCGCGGCCCTCGCGTCGGATGAGCTGACGCTCGAGGCGTGTGCCGAGTTCTGTGCGGCGTACCAG
TTCTTTGGCGCCGAGTACGGCCGCGAGTGCTACTGCGGTGACCAGTTGGCTGAGACCGCGGCTGACGCGCCCGCGACGGAGTGCTCGATGGCGTGCGCTGGGGATGTGGGGGTGTTGTGT
GGGAGTGGGAATCGGTTGAGTGTGTATGCGAAGGTAGTGTAA

Retrieve as FASTA