Entry information : NcAPx-CcP01
Entry ID 5358
Creation 2007-05-16 (Marcel Zamocky)
Last sequence changes 2007-05-16 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-04-10 (Christophe Dunand)
Peroxidase information: NcAPx-CcP01
Name NcAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Sordariaceae Neurospora
Organism Neurospora crassa    [TaxId: 5141 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value NcAPx-CcP01
start..stop
S start..stop
NdisAPx-CcP01 1487 0 1..828 1..813
NtetAPx-CcP1 1449 0 31..830 1..802
SmaAPx-CcP01 1424 0 1..852 1..843
StheAPx-CcP01 1045 0 1..837 1..811
StheAPx-CcP01 204 7e-55 608..829 706..931
StheAPx-CcP01 192 8e-51 607..835 833..1057
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1944501..1944721 221 N° 2 1943380..1944289 910 N° 3 1943130..1943324 195 N° 4 1942032..1943070 1039
N° 5 1941713..1941906 194  
complement(join(1941713..1941906,1942032..1943070,1943130..1943324,1943380..1944 289,1944501..1944721))


exon

Literature and cross-references NcAPx-CcP01
Literature Schulte U., Aign V., Hoheisel J., Brandt P., Fartmann B., Holland R., Nyakatura G., Mewes H.W., Mannhaupt G. Submitted (DEC-2000) to the EMBL/GenBank/DDBJ databases.
Protein ref. UniProtKB:   Q9HE44
DNA ref. JGI genome:   supercont10.5 (1944721..1941713)
Protein sequence: NcAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   852 (832)
PWM (Da):   %s   87967.88 (85916.8)  
PI (pH):   %s   4.97 (4.81) Peptide Signal:   %s   cut: 21 range:21-852
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRYAHPTLAGLLSLAARTGADPTWPAATDEMEEIVYQLQGFKGRVFNDVITPCNNEAAGPGRVTASEWLRVGFHDMATHNRVFGTGGLDASLQFELTNGENTGPGHNTTLRFLANYYSSQSSMADLIAAGVYASVRSCGGPVVPLRLGRKDATSSGSTGVPQPQNSAETFRQQFDRMGFSTEEMIQVTACGHTLGGVHSEEFPEIVPSGTGTNGQKQLDTTDATFDNKVVTEYISGTTQNPLVVGPAVAVNRHSDFKVFNIDGNATMNGLTSATTFRDVCKTVLQKMIDTVPSGVTLTDPIAPYAVKPVDMQLTLNSGGSTFLLSGYIRVRTTNRASGAIKNIKMTWKDRNGGCASGSCSYTATVQGAGTGFDDTFFFPISTNIPTSSGISSFTVTVNLNDGTSESYDNNGNSYPLSDAIILQKPQSCLLQSSGALTVSALVRNDITATPSLGISYLTPRGVVRNGNPVPILSSTTVAMTKGDCAGPYTFYSASYTIAGGLSYAAKLSVTAGSNSDSFNKASDLSGSCAAFSGTASCTTPGGGGGGGGGGGGNEPDASSTIASSSAAGPSSTSSVVEVTSSSHITSSTTIAPSSTTSSTTPTATGPARKPTVAGYTRLRCATEGSGVRALTGASFAYDTMTLESCAANCTAAGNFAYFGVEYARECYCGNSLAASSSEAPDSECNMLCAGDATEYCGAGNRLELYAKHDAGTGTTATSTTASAAQPTATLGRKDTVGDYVFVGCQTEATEGGRALEGKAWADDGMTLEGCAEACSGWEYFGVEYGRECYCGNTLRGGSAPAPLADCSFTCAGTPYEYCGAGNRLELYRLASASSSSSSKTRRSRLERGRRL

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns)and 1 EST (BG278614). Strain="OR74A". Peroxidase domain fused to 2 WSC domains (putative carbohydrate binding domain)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGATACGCACATCCCACCCTGGCTGGCCTGCTCTCGCTGGCGGCCAGGACTGGAGCCGACCCAACATGGCCCGCCGCCACCGACGAGATGGAGGAGATTGTCTATCAACTCCAGGGG
TTTAAGGGCAGGGTCTTTAATGATGTCATTACGCCTTGTAACAACGAGGCTGCCGGGCCTGGGAGGGTAACGGCCTCGGAGTGGCTGCGGGTGGGATTCCA
GTATGTGTTTTGAATCCTT
CTTTTTTTTTCCTGGCTTTCAGTGATGAGGGTAGAAAATAGGGTAGGTCAAAATGGCGGATGACGATAAACAAAAAAGAAAAAAAAAGTCAAGGGAATGGAATGACACCTCATGGGAAAT
TATATGGAAATGAATACATGTTGTAGTTGGACGAATGAATATAGTCCGCACAAATTGCTAACTTCCGACCAGCGACATGGCCACCCACAACCGCGTCTTCGGCACCGGCGGGCTCGACGC
CTCACTCCAATTCGAGCTCACAAACGGTGAGAACACCGGGCCAGGCCACAACACCACCCTCAGGTTCTTGGCCAATTACTACTCATCCCAATCGAGCATGGCCGACCTGATTGCCGCCGG
CGTCTACGCCTCCGTCCGATCTTGCGGAGGCCCCGTCGTTCCCCTTCGCCTCGGGAGGAAAGACGCAACGTCCAGCGGCAGCACCGGCGTACCACAGCCCCAGAACTCGGCCGAAACGTT
TAGGCAACAGTTCGACCGTATGGGGTTCAGTACCGAGGAGATGATCCAGGTGACGGCTTGCGGACATACTCTCGGTGGTGTCCACTCGGAAGAGTTTCCCGAGATTGTGCCCTCCGGTAC
GGGAACGAACGGTCAGAAGCAGCTTGATACCACCGATGCTACGTTCGATAACAAGGTGGTCACTGAGTACATCTCGGGGACAACGCAGAATCCGCTAGTGGTTGGGCCAGCTGTTGCGGT
GAACAGACACTCGGATTTTAAGGTGTTTAACATTGATGGCAATGCCACGATGAACGGGTTAACGTCGGCGACGACTTTCAGGGACGTTTGCAAGACTGTTCTTCAGAAGATGATTGATAC
TGTGCCCTCGGGGGTGACGTTGACGGACCCAATTGCCCCGTATGCGGTTAAGCCTGTTGATATGCAATTGACCTTGAATTCGGGAGGTAGCACTTTTCTTCTGAGTGGGTATATCAGAGT
TCGCACAACAAACCGGGCTTCTGGCGCCATCAAGAACATCAAGATGACTTGGAAAGATAGGAACGGGGGTTGCGCTTCGGGGTCGTGCTCATATACCGCCACCGTACAAGGAGCTGGTAC
CGGGTTTGATGATACTTTTGAG
GTATGCTCCTTTGGCACTCGAGCGCTTAACTCTTCACAACTGACCAGGCACATAGTTTTTCCCTATCTCAACCAACATTCCCACTTCCTCAGGCATTT
CTTCCTTCACAGTCACCGTCAATCTCAACGACGGCACCAGCGAGTCGTACGACAACAACGGAAACTCCTACCCTTTGTCAGATGCCATTATCCTTCAAAAACCTCAGAGCTGTCTTCTTC
AGAGCTCAGGTGCACTCACCGTTTCTGCGCTT
GTAGGCTCTTCCTCCTCCTTCCCATCTTCCCGGCATGCCTCCGCTGACTGACAAAATAGGTCCGCAACGACATCACCGCAACTCCCTC
GCTGGGCATCTCTTACCTTACTCCCCGCGGCGTCGTCCGCAACGGCAACCCTGTCCCTATCCTCAGCAGCACCACCGTAGCCATGACAAAAGGCGACTGTGCGGGTCCCTATACCTTCTA
CTCCGCCAGCTACACCATCGCAGGTGGTCTGAGTTACGCCGCCAAACTCAGCGTCACCGCAGGCTCCAACTCCGATAGCTTCAACAAGGCCAGCGATCTATCAGGCAGCTGCGCTGCCTT
TTCTGGAACTGCATCCTGCACCACGCCTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTAACGAGCCAGACGCTTCTTCCACGATTGCCAGCTCTTCCGCAGCTGGGCCATCATC
AACCAGTAGCGTAGTTGAGGTCACCAGCTCCAGCCATATCACAAGCAGCACCACCATCGCCCCCTCCAGCACCACCTCCTCCACTACTCCCACCGCCACCGGCCCCGCCAGGAAACCCAC
AGTCGCCGGCTACACCCGCCTCCGCTGCGCAACCGAAGGATCCGGCGTGCGCGCCCTAACCGGCGCTTCCTTTGCCTACGACACCATGACGCTCGAGTCGTGCGCGGCCAACTGCACCGC
CGCAGGCAACTTTGCCTACTTCGGCGTCGAATACGCTCGCGAGTGTTACTGCGGCAACTCCTTGGCAGCTAGCAGCTCCGAGGCGCCCGATAGCGAGTGTAACATGTTGTGCGCTGGTGA
TGCGACCGAGTATTGCGGAGCGGGGAATCGGCTGGAGTTGTACGCGAAGCACGATGCTGGGACGGGAACAACAGCAACAAGTACTACTGCTAGCGCAGCACAGCCAACGGCTACCCTGGG
AAGAAAGGACACGGTGGGCGATTACGTCTTTGTCGGATGCCAGACTGAAGCTACTGAAGGCGGTAGGGCGCTGGAGGGCAAGGCCTGGGCTGATGACGGGATGACGCTGGAGGGATGTGC
GGAGGCTTGTAGTGGGTGGGAGTATTTTGGGGTGGAGTATGGGAGGGAGT
GTAAGTCTTTTTTTTTTTTTTTCTTTTTCCCTATTTCCTTCTATTTTCTTTTTCTTTGTCCCCTGTGCTT
TTTCTAATAAAGCTCTCATGAGACTGGGAAACACTAACCTGACCTTGTAACATAGGCTATTGCGGCAACACCCTCCGCGGCGGCTCCGCTCCCGCTCCGCTGGCTGATTGCAGCTTCACT
TGTGCCGGTACTCCTTACGAGTACTGCGGCGCCGGAAACCGACTTGAGCTTTATCGGTTGGCAAGTGCTAGTTCGTCTTCGTCATCAAAGACAAGGAGGTCTCGTTTGGAGAGAGGACGG
AGGCTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGATACGCACATCCCACCCTGGCTGGCCTGCTCTCGCTGGCGGCCAGGACTGGAGCCGACCCAACATGGCCCGCCGCCACCGACGAGATGGAGGAGATTGTCTATCAACTCCAGGGG
TTTAAGGGCAGGGTCTTTAATGATGTCATTACGCCTTGTAACAACGAGGCTGCCGGGCCTGGGAGGGTAACGGCCTCGGAGTGGCTGCGGGTGGGATTCCA
CGACATGGCCACCCACAAC
CGCGTCTTCGGCACCGGCGGGCTCGACGCCTCACTCCAATTCGAGCTCACAAACGGTGAGAACACCGGGCCAGGCCACAACACCACCCTCAGGTTCTTGGCCAATTACTACTCATCCCAA
TCGAGCATGGCCGACCTGATTGCCGCCGGCGTCTACGCCTCCGTCCGATCTTGCGGAGGCCCCGTCGTTCCCCTTCGCCTCGGGAGGAAAGACGCAACGTCCAGCGGCAGCACCGGCGTA
CCACAGCCCCAGAACTCGGCCGAAACGTTTAGGCAACAGTTCGACCGTATGGGGTTCAGTACCGAGGAGATGATCCAGGTGACGGCTTGCGGACATACTCTCGGTGGTGTCCACTCGGAA
GAGTTTCCCGAGATTGTGCCCTCCGGTACGGGAACGAACGGTCAGAAGCAGCTTGATACCACCGATGCTACGTTCGATAACAAGGTGGTCACTGAGTACATCTCGGGGACAACGCAGAAT
CCGCTAGTGGTTGGGCCAGCTGTTGCGGTGAACAGACACTCGGATTTTAAGGTGTTTAACATTGATGGCAATGCCACGATGAACGGGTTAACGTCGGCGACGACTTTCAGGGACGTTTGC
AAGACTGTTCTTCAGAAGATGATTGATACTGTGCCCTCGGGGGTGACGTTGACGGACCCAATTGCCCCGTATGCGGTTAAGCCTGTTGATATGCAATTGACCTTGAATTCGGGAGGTAGC
ACTTTTCTTCTGAGTGGGTATATCAGAGTTCGCACAACAAACCGGGCTTCTGGCGCCATCAAGAACATCAAGATGACTTGGAAAGATAGGAACGGGGGTTGCGCTTCGGGGTCGTGCTCA
TATACCGCCACCGTACAAGGAGCTGGTACCGGGTTTGATGATACTTTTGAG
TTTTTCCCTATCTCAACCAACATTCCCACTTCCTCAGGCATTTCTTCCTTCACAGTCACCGTCAATCTC
AACGACGGCACCAGCGAGTCGTACGACAACAACGGAAACTCCTACCCTTTGTCAGATGCCATTATCCTTCAAAAACCTCAGAGCTGTCTTCTTCAGAGCTCAGGTGCACTCACCGTTTCT
GCGCTT
GTCCGCAACGACATCACCGCAACTCCCTCGCTGGGCATCTCTTACCTTACTCCCCGCGGCGTCGTCCGCAACGGCAACCCTGTCCCTATCCTCAGCAGCACCACCGTAGCCATG
ACAAAAGGCGACTGTGCGGGTCCCTATACCTTCTACTCCGCCAGCTACACCATCGCAGGTGGTCTGAGTTACGCCGCCAAACTCAGCGTCACCGCAGGCTCCAACTCCGATAGCTTCAAC
AAGGCCAGCGATCTATCAGGCAGCTGCGCTGCCTTTTCTGGAACTGCATCCTGCACCACGCCTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTAACGAGCCAGACGCTTCTTCC
ACGATTGCCAGCTCTTCCGCAGCTGGGCCATCATCAACCAGTAGCGTAGTTGAGGTCACCAGCTCCAGCCATATCACAAGCAGCACCACCATCGCCCCCTCCAGCACCACCTCCTCCACT
ACTCCCACCGCCACCGGCCCCGCCAGGAAACCCACAGTCGCCGGCTACACCCGCCTCCGCTGCGCAACCGAAGGATCCGGCGTGCGCGCCCTAACCGGCGCTTCCTTTGCCTACGACACC
ATGACGCTCGAGTCGTGCGCGGCCAACTGCACCGCCGCAGGCAACTTTGCCTACTTCGGCGTCGAATACGCTCGCGAGTGTTACTGCGGCAACTCCTTGGCAGCTAGCAGCTCCGAGGCG
CCCGATAGCGAGTGTAACATGTTGTGCGCTGGTGATGCGACCGAGTATTGCGGAGCGGGGAATCGGCTGGAGTTGTACGCGAAGCACGATGCTGGGACGGGAACAACAGCAACAAGTACT
ACTGCTAGCGCAGCACAGCCAACGGCTACCCTGGGAAGAAAGGACACGGTGGGCGATTACGTCTTTGTCGGATGCCAGACTGAAGCTACTGAAGGCGGTAGGGCGCTGGAGGGCAAGGCC
TGGGCTGATGACGGGATGACGCTGGAGGGATGTGCGGAGGCTTGTAGTGGGTGGGAGTATTTTGGGGTGGAGTATGGGAGGGAGT
GCTATTGCGGCAACACCCTCCGCGGCGGCTCCGCT
CCCGCTCCGCTGGCTGATTGCAGCTTCACTTGTGCCGGTACTCCTTACGAGTACTGCGGCGCCGGAAACCGACTTGAGCTTTATCGGTTGGCAAGTGCTAGTTCGTCTTCGTCATCAAAG
ACAAGGAGGTCTCGTTTGGAGAGAGGACGGAGGCTTTAA

Retrieve as FASTA