Entry information : FoAPx-CcP01
Entry ID 5364
Creation 2007-05-16 (Marcel Zamocky)
Last sequence changes 2007-05-16 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: FoAPx-CcP01
Name FoAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Fusarium
Organism Fusarium oxysporum    [TaxId: 5507 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value FoAPx-CcP01
start..stop
S start..stop
GmoAPx-CcP01 986 0 1..530 1..530
GzAPx-CcP01 763 0 1..526 1..526
FpsAPx-CcP1 749 0 1..526 1..526
CorbiAPx-CcP1 528 0 1..530 1..539
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 605980..606118 139 N° 2 606167..607620 1454  
join(605980..606118,606167..607620)


exon

Literature and cross-references FoAPx-CcP01
Literature unpublished
DNA ref. JGI genome:   Supercontig_2.20 (605980..607620)
Protein sequence: FoAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   530 (507)
PWM (Da):   %s   57107.76 (54692.5)  
PI (pH):   %s   9.22 (9.07) Peptide Signal:   %s   cut: 24 range:24-530
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKGSATLAFALTHFSAASQLVWPSKWDEVEDLLYMQGGFNKRGFADALRTCEFGSNVPGTQNTAEWLRTAFHDAITHDAKAGTGGLDASIYWESSRPENPGKAFNNTFGFFSGFHNPRATASDLTALGTVLAVGACNGPRIPFRAGRIDAYKAGPAGVPEPSTNLKDTFAAFTKAGFTKEEMTAMVACGHAIGGVHSVDFPEIVGIKADPNNDTNVPFQKDVSSFHNGIVTEYLAGTSKNPLVASKNATFHSDKRIFDNDKATMKKLSTKAGFNSMCADILTRMIDTVPKSVQLTPVLEAYDVRPYITELSLNNKNKIHFTGSVRVRITNNIRDNNDLAINLICVGRDGKKVTVPTQQVTFQGGTSSGAGEVFANFEFDTTMDAKNGITKFFIQEVKPSTKATVTHDNQKTGGYKVDDTVLYQLQQSCAVLEKLPNAPLVVTAMVRDARAKDALTLRVAHKKPVKGSIVPRFQTAITNFKATGKKSSGYTGFQAKTMFEEQSTYFDIVLGGSPASGVQFLSSQAMPAQCS

Retrieve as FASTA  
Remarks Complete from genomic (1 intron). No EST available. Strain="4286".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAGGCTCAGCCACTCTCGCTTTTGCGCTCACTCACTTCAGTGCTGCTTCGCAGCTCGTTTGGCCCTCAAAATGGGATGAGGTCGAAGATCTTCTGTACATGCAAGGAGGATTCAAC
AAGAGAGGTTTCGCTGATG
GTAAGCAATAAACCTTTCTATGCCATAAAATCCATCAACAATTTGCAGCTTTAAGAACTTGCGAGTTTGGAAGCAATGTCCCCGGAACCCAGAACACGGCC
GAATGGCTCCGAACAGCTTTCCACGATGCCATTACACACGATGCCAAAGCGGGAACAGGTGGTTTGGACGCGTCCATCTACTGGGAGTCTTCACGACCCGAAAACCCCGGAAAAGCCTTC
AACAATACCTTCGGGTTCTTCAGCGGCTTCCACAACCCCCGCGCTACTGCTTCCGATCTCACAGCCCTGGGAACTGTTCTCGCCGTTGGAGCTTGTAATGGCCCCAGGATTCCCTTCCGA
GCTGGCCGTATCGATGCATACAAGGCTGGCCCAGCTGGTGTTCCCGAGCCTTCGACAAACCTAAAGGATACCTTTGCTGCTTTCACAAAGGCTGGTTTTACTAAGGAGGAGATGACTGCT
ATGGTTGCTTGTGGTCATGCTATTGGCGGCGTGCATAGCGTTGACTTTCCTGAGATTGTTGGCATCAAGGCTGATCCCAACAACGATACCAACGTGCCTTTCCAGAAGGATGTTTCTTCT
TTCCATAACGGCATCGTCACAGAGTACTTGGCCGGCACGTCCAAGAATCCTCTTGTCGCTTCAAAGAACGCCACCTTCCACTCTGATAAGCGAATATTCGATAATGACAAGGCTACTATG
AAGAAGCTCTCCACCAAGGCTGGTTTCAACAGCATGTGTGCTGACATCCTCACCCGCATGATCGATACCGTGCCCAAGAGCGTGCAGCTCACTCCCGTCCTCGAGGCTTACGATGTCCGC
CCTTACATCACCGAGCTGTCTCTTAATAACAAAAACAAGATACATTTCACGGGCTCGGTTCGAGTCAGAATCACAAACAACATTCGTGATAACAATGACCTTGCTATCAACCTCATCTGC
GTTGGCCGAGACGGCAAGAAGGTCACTGTGCCTACACAGCAGGTGACCTTCCAGGGCGGTACATCTTCCGGTGCTGGAGAAGTCTTTGCCAACTTCGAGTTCGACACCACCATGGACGCT
AAGAACGGTATCACGAAGTTCTTCATCCAGGAGGTCAAGCCCTCCACCAAGGCAACCGTCACCCACGACAACCAGAAGACCGGCGGCTACAAGGTTGATGATACCGTCCTTTACCAGCTT
CAGCAATCCTGTGCCGTGCTTGAGAAGCTTCCTAACGCTCCTCTCGTCGTCACAGCCATGGTTCGAGATGCCCGCGCCAAGGACGCCCTGACCCTTCGCGTCGCTCACAAGAAACCCGTC
AAGGGTTCTATCGTCCCCAGGTTCCAGACGGCGATCACCAACTTCAAGGCTACTGGCAAGAAGTCCAGCGGATACACTGGATTCCAGGCGAAGACCATGTTCGAGGAGCAGAGCACTTAC
TTTGACATTGTCTTGGGTGGAAGTCCCGCTTCAGGTGTCCAGTTCCTTTCTTCTCAGGCTATGCCTGCTCAGTGTTCATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAGGCTCAGCCACTCTCGCTTTTGCGCTCACTCACTTCAGTGCTGCTTCGCAGCTCGTTTGGCCCTCAAAATGGGATGAGGTCGAAGATCTTCTGTACATGCAAGGAGGATTCAAC
AAGAGAGGTTTCGCTGATG
CTTTAAGAACTTGCGAGTTTGGAAGCAATGTCCCCGGAACCCAGAACACGGCCGAATGGCTCCGAACAGCTTTCCACGATGCCATTACACACGATGCCAAA
GCGGGAACAGGTGGTTTGGACGCGTCCATCTACTGGGAGTCTTCACGACCCGAAAACCCCGGAAAAGCCTTCAACAATACCTTCGGGTTCTTCAGCGGCTTCCACAACCCCCGCGCTACT
GCTTCCGATCTCACAGCCCTGGGAACTGTTCTCGCCGTTGGAGCTTGTAATGGCCCCAGGATTCCCTTCCGAGCTGGCCGTATCGATGCATACAAGGCTGGCCCAGCTGGTGTTCCCGAG
CCTTCGACAAACCTAAAGGATACCTTTGCTGCTTTCACAAAGGCTGGTTTTACTAAGGAGGAGATGACTGCTATGGTTGCTTGTGGTCATGCTATTGGCGGCGTGCATAGCGTTGACTTT
CCTGAGATTGTTGGCATCAAGGCTGATCCCAACAACGATACCAACGTGCCTTTCCAGAAGGATGTTTCTTCTTTCCATAACGGCATCGTCACAGAGTACTTGGCCGGCACGTCCAAGAAT
CCTCTTGTCGCTTCAAAGAACGCCACCTTCCACTCTGATAAGCGAATATTCGATAATGACAAGGCTACTATGAAGAAGCTCTCCACCAAGGCTGGTTTCAACAGCATGTGTGCTGACATC
CTCACCCGCATGATCGATACCGTGCCCAAGAGCGTGCAGCTCACTCCCGTCCTCGAGGCTTACGATGTCCGCCCTTACATCACCGAGCTGTCTCTTAATAACAAAAACAAGATACATTTC
ACGGGCTCGGTTCGAGTCAGAATCACAAACAACATTCGTGATAACAATGACCTTGCTATCAACCTCATCTGCGTTGGCCGAGACGGCAAGAAGGTCACTGTGCCTACACAGCAGGTGACC
TTCCAGGGCGGTACATCTTCCGGTGCTGGAGAAGTCTTTGCCAACTTCGAGTTCGACACCACCATGGACGCTAAGAACGGTATCACGAAGTTCTTCATCCAGGAGGTCAAGCCCTCCACC
AAGGCAACCGTCACCCACGACAACCAGAAGACCGGCGGCTACAAGGTTGATGATACCGTCCTTTACCAGCTTCAGCAATCCTGTGCCGTGCTTGAGAAGCTTCCTAACGCTCCTCTCGTC
GTCACAGCCATGGTTCGAGATGCCCGCGCCAAGGACGCCCTGACCCTTCGCGTCGCTCACAAGAAACCCGTCAAGGGTTCTATCGTCCCCAGGTTCCAGACGGCGATCACCAACTTCAAG
GCTACTGGCAAGAAGTCCAGCGGATACACTGGATTCCAGGCGAAGACCATGTTCGAGGAGCAGAGCACTTACTTTGACATTGTCTTGGGTGGAAGTCCCGCTTCAGGTGTCCAGTTCCTT
TCTTCTCAGGCTATGCCTGCTCAGTGTTCATAA

Retrieve as FASTA