Entry information : BdeAPx-CcP01
Entry ID 5367
Creation 2007-05-16 (Marcel Zamocky)
Last sequence changes 2014-04-08 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-04-08 (Christophe Dunand)
Peroxidase information: BdeAPx-CcP01
Name BdeAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Chytridiomycota Chytridiomycetes Batrachochytrium
Organism Batrachochytrium dendrobatidis    [TaxId: 109871 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdeAPx-CcP01
start..stop
S start..stop
NhyAPx03 131 3e-36 44..280 8..243
NhyAPx06 129 1e-35 62..280 27..243
AhalAPx03 123 5e-33 52..297 16..252
MeAPx08 123 6e-33 63..280 28..241
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 575525..576126 602 N° 2 575295..575468 174 N° 3 574861..575218 358  
complement(join(574861..575218,575295..575468,575525..576126))


exon

Literature and cross-references BdeAPx-CcP01
Literature unpublished
DNA ref. JGI genome:   scaffold_15 (576126..573146)
Protein sequence: BdeAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   377 (357)
PWM (Da):   %s   39874.09 (37632.8) Transmb domain:   %s   o354-376i (o334-356i)
PI (pH):   %s   6.41 (6.22) Peptide Signal:   %s   cut: 21 range:21-377
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSLIKFFLTTLFLNTITVSAQGIGIAGSPQAAQAGVEQFQFFLQAPGNCLISHTDLPIDAPSKNLAALWIRAVFHDAGTWDPNAVAPALYGGANAGIRSFANVSENAGLFASLAPRFQQNTAVNMSAADTIALAGLTSVTHCGGPHIPYSPGRIDTTTPQTPIGRIPEANERYLTVKPKLQRMGWTNEDIVVLVTGSHTMGGIHAANSPQLTNKSYIPFDTTPGVFDNDVFIRVLAGHCPVPVDCDIANDPELRPIVQRYAADQKAFFDQYAISFAKLSNQVTGVTLNPAMSISIAVHANLLEEGTTDLDGKILSGPNAGMLGNGMSITGSNTTHVNKATPSQQSNSSIMYSSGFILRGFMLCVVWISTCGILSFVN

Retrieve as FASTA  
Remarks Complete from genomic, (6 introns). No EST available. .Strain="JEL423". No prediction from JGI. Very short intergenic region (113 nt) between the heme peroxidase domain and DnaJ domain protein. Possibility of gene fusion but no evidence.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCATTGATAAAGTTCTTTTTAACAACACTGTTTTTAAATACTATAACTGTATCAGCTCAAGGAATTGGTATTGCAGGATCTCCACAAGCAGCTCAAGCAGGTGTAGAACAATTCCAA
TTCTTTCTACAAGCACCAGGAAACTGTCTTATTTCTCATACCGACTTGCCAATAGATGCTCCTTCCAAAAACCTCGCTGCGTTGTGGATTAGAGCTGTATTTCATGATGCAGGAACATGG
GATCCCAATGCTGTTGCTCCAGCACTTTATGGCGGAGCCAATGCAGGAATTAGGTCGTTTGCTAATGTGAGCGAGAATGCAGGACTGTTTGCATCGCTTGCTCCAAGGTTTCAGCAGAAT
ACTGCTGTCAATATGTCGGCTGCTGACACAATTGCTCTTGCTGGATTGACATCAGTAACTCATTGTGGTGGTCCACATATTCCTTACTCCCCTGGAAGAATTGACACCACCACTCCCCAA
ACTCCCATAGGGAGGATCCCTGAAGCAAACGAACGATATCTTACTGTCAAACCCAAACTACAACGCATGGGATGGACAAACGAAGACATTGTTGTCTTGGTAACTGGAAGTCATACTATG
GG
GTAAGTCAAGTCACGTCTTATAAGAAAGCTTAACTGAATCTAACTTGATTGAATAGTGGAATTCATGCAGCCAACTCTCCTCAACTTACAAACAAGTCGTATATTCCGTTTGATACAA
CTCCAGGTGTATTTGATAATGATGTGTTTATTCGAGTGTTGGCTGGTCATTGTCCTGTTCCTGTAGATTGTGATATTGCCAATGATCCAGAGTTGCGTCCTATTGTTCAAAG
GTATACTT
GATTCATGATAAAAGTCTTGAATGGTTTAACATACAGTTTAATTAAATATTCGTATACTGTATGATAGATATGCTGCGGATCAAAAGGCTTTCTTTGACCAATATGCCATTTCATTTGCT
AAACTCTCCAATCAAGTTACTGGAGTAACACTCAATCCAGCCATGAGTATATCTATTGCAGTTCATGCTAATCTGTTGGAAGAAGGCACGACTGATTTGGATGGAAAGATTCTTAGTGGA
CCCAATGCAGGCATGTTAGGAAATGGAATGAGTATAACAGGATCGAATACAACACATGTTAACAAAGCGACACCTTCGCAACAATCCAATAGTTCAATCATGTATTCATCCGGATTCATT
CTAAGAGGATTTATGCTGTGTGTGGTTTGGATAAGCACTTGTGGAATTTTATCTTTTGTAAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCATTGATAAAGTTCTTTTTAACAACACTGTTTTTAAATACTATAACTGTATCAGCTCAAGGAATTGGTATTGCAGGATCTCCACAAGCAGCTCAAGCAGGTGTAGAACAATTCCAA
TTCTTTCTACAAGCACCAGGAAACTGTCTTATTTCTCATACCGACTTGCCAATAGATGCTCCTTCCAAAAACCTCGCTGCGTTGTGGATTAGAGCTGTATTTCATGATGCAGGAACATGG
GATCCCAATGCTGTTGCTCCAGCACTTTATGGCGGAGCCAATGCAGGAATTAGGTCGTTTGCTAATGTGAGCGAGAATGCAGGACTGTTTGCATCGCTTGCTCCAAGGTTTCAGCAGAAT
ACTGCTGTCAATATGTCGGCTGCTGACACAATTGCTCTTGCTGGATTGACATCAGTAACTCATTGTGGTGGTCCACATATTCCTTACTCCCCTGGAAGAATTGACACCACCACTCCCCAA
ACTCCCATAGGGAGGATCCCTGAAGCAAACGAACGATATCTTACTGTCAAACCCAAACTACAACGCATGGGATGGACAAACGAAGACATTGTTGTCTTGGTAACTGGAAGTCATACTATG
GG
TGGAATTCATGCAGCCAACTCTCCTCAACTTACAAACAAGTCGTATATTCCGTTTGATACAACTCCAGGTGTATTTGATAATGATGTGTTTATTCGAGTGTTGGCTGGTCATTGTCCT
GTTCCTGTAGATTGTGATATTGCCAATGATCCAGAGTTGCGTCCTATTGTTCAAAG
ATATGCTGCGGATCAAAAGGCTTTCTTTGACCAATATGCCATTTCATTTGCTAAACTCTCCAAT
CAAGTTACTGGAGTAACACTCAATCCAGCCATGAGTATATCTATTGCAGTTCATGCTAATCTGTTGGAAGAAGGCACGACTGATTTGGATGGAAAGATTCTTAGTGGACCCAATGCAGGC
ATGTTAGGAAATGGAATGAGTATAACAGGATCGAATACAACACATGTTAACAAAGCGACACCTTCGCAACAATCCAATAGTTCAATCATGTATTCATCCGGATTCATTCTAAGAGGATTT
ATGCTGTGTGTGGTTTGGATAAGCACTTGTGGAATTTTATCTTTTGTAAACTGA

Retrieve as FASTA