Entry information : PanAPx-CcP01
Entry ID 5372
Creation 2007-05-16 (Marcel Zamocky)
Last sequence changes 2013-05-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Christophe Dunand)
Peroxidase information: PanAPx-CcP01
Name PanAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Lasiosphaeriaceae Podospora
Organism Podospora anserina    [TaxId: 5145 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PanAPx-CcP01
start..stop
S start..stop
StheAPx-CcP01 1318 0 1..1038 1..1053
StheAPx-CcP01 300 1e-86 585..938 706..1057
CgAPx-CcP02 1281 0 1..1035 1..1049
CgAPx-CcP02 309 8e-90 702..1036 585..924
CgAPx-CcP02 285 2e-81 585..930 697..1051
CtheAPx-CcP01 1249 0 1..1036 1..1024
CtheAPx-CcP01 213 4e-57 837..1038 581..789
CtheAPx-CcP01 100 1e-21 593..685 936..1027
AalcAPx-CcP 1032 0 25..1035 20..1038
AalcAPx-CcP 302 3e-87 702..1036 581..926
AalcAPx-CcP 283 1e-80 583..932 694..1042
AalcAPx-CcP 192 1e-50 837..1037 583..793
AalcAPx-CcP 91 1e-18 582..682 935..1039
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3281607..3281842 236 N° 2 3281989..3284018 2030 N° 3 3284072..3284239 168 N° 4 3284299..3284981 683
join(3281607..3281842,3281989..3284018,3284072..3284239,3284299..3284981)


exon

Literature and cross-references PanAPx-CcP01
Literature Podospora anserina genome project Université de Paris-Sud XI, Institut de Génetique et Microbiologie
Protein ref. UniProtKB:   B2B6Z5
DNA ref. GenBank:   CU640366.1 (3281607..3284981)
mRNA ref. GenBank:   XM_001911710.1
Protein sequence: PanAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1038 (1013)
PWM (Da):   %s   108136.52 (105726.2)  
PI (pH):   %s   4.37 (4.28) Peptide Signal:   %s   cut: 26 range:26-1038
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRTRTSKGSILAGLLLAAGAGTGRADPTWPAPTDQMEEIVFQLQGMDGSLFSDNITPCDNEAAGPGRVTASEWLRVAFHDMATHNRFFDRGGLDGSLQFELRSSENTGPGHNTTLQFYATYLSSRSSLADLIAAGAYAAVRACGGPVIPLRLGRKDALTAGSSGVPQPENSVGSFVSQFDRMGFSQAEMIQVVACGHTLGGVHRTEFPNIIPAGVSNIPFDTSKATFDNRIATEYVSGNTTNPLVVGPAIAINRHSDFKVFNSDGNATINTMTSPSAFQSICQTVLQKMIDVVPSTVTLTPPIAPYTVKPQDMQLTLQSGGASFLLTGKIRVRTTEIPGSTITNLVLTWKDRNGGNSCGSLSSCSTTATLQGIANGFDDTFAFFPIEATIPTSTGISSFTITINRNDGSSQTFDNNGNTYPLSDAVVLQKTQSCLLQTSGQLTVAAVVRNDVVGVPVNLDIEYQTPRTGNSGNPVPAINTATVQMTEGDCVGPYTFYSASYTIPGGRSYNARISITAGEHTDDFNKASIFGGTCGSFTGTLACGNITEPVSTTSSSATASSTSTSVSSSVVTTTTTGSTGVPTPSIRPSVGGYSFVDCWTEGAGGIRALGGASFAYDEMTLESCAANCTGFDLWGTEYGRECYCGNSLHSSSSEAPEAECNMPCGGDPSAFCGAGNRIQLYSTTATRSTSATPTPTATLSTKPTVGAYVRVGCQTEASAGRALSGNSYASDDMTLESCAAFCSGFTYFGTQYSRCFCGNTINGNSASAPDADCSMTCAGDPFSYCGAGNRLELYILETASTSTTGAPPVEVTTTATATATSTTSAAPTGTLSRVPTVSPYSYAGCYTEGTGSRALTGKSTYDSEMTLEFCASYCSGYKYMATQYSAECFCGNTLHSTATEAAQGDCSMTCAGNEFQYCGGPNRLELYVQEDIEAPAAPSQPEAVGNWTFYQCRTEGSPGRALAAETYAADTMTLESCADFCAGYTYFGTEYARECFCGNSFGVGSIEAPAAECFMTCAGNGSQFCGAGNRLSIYQAA

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 3 introns). Peroxidase domain fused to 4 WSC domains (putative carbohydrate binding domain). Strain="VdLs.17".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAACCAGAACCAGCAAGGGCTCTATCCTTGCCGGCCTGCTCCTGGCAGCGGGAGCGGGAACCGGCAGGGCGGATCCGACATGGCCCGCACCTACCGATCAGATGGAGGAGATTGTT
TTCCAGCTTCAGGGCATGGACGGGAGTTTGTTCAGTGATAACATCACGCCTTGTGATAATGAGGCCGCTGGGCCGGGGAGGGTGACAGCTAGCGAGTGGCTGCGCGTTGCTTTTCA
GTAT
GTGACTTTTTTCTTTGCGAGGACGGTCTTTGAAAAGGGCAAGAGAAGGGTTTATTGAGATTGAAGATGGAGGGGGTGGTTTTTGGAGAACTGGAAATGGGATGAGCATCCAACTTGAGAA
CAAATGCTGATGCAGACGACAGTGACATGGCTACCCACAACAGGTTTTTTGACCGGGGCGGTCTTGACGGCTCGTTGCAATTCGAGCTTAGAAGCTCTGAAAACACGGGCCCAGGACACA
ACACCACACTCCAGTTCTACGCGACATATTTGTCCAGCCGGTCAAGTCTCGCAGATCTGATCGCGGCCGGAGCGTATGCCGCCGTTCGCGCCTGCGGAGGACCAGTCATTCCACTGAGAT
TGGGACGCAAGGATGCGCTGACGGCCGGCTCCTCTGGTGTTCCCCAACCAGAGAACTCAGTTGGCAGTTTCGTATCGCAGTTCGACCGCATGGGCTTCTCCCAGGCTGAGATGATTCAAG
TCGTGGCCTGCGGTCATACGCTCGGAGGAGTTCACAGGACCGAGTTCCCCAACATCATTCCCGCCGGCGTGTCCAATATTCCCTTTGATACGTCCAAGGCCACCTTTGACAACAGGATTG
CCACCGAGTATGTGTCTGGTAACACCACCAACCCCCTCGTAGTTGGTCCAGCAATTGCTATCAACCGCCATTCCGATTTCAAGGTCTTCAACAGTGACGGAAACGCCACTATCAACACCA
TGACATCGCCCAGTGCTTTCCAGAGCATCTGCCAGACTGTTTTGCAGAAGATGATCGATGTGGTACCGTCCACTGTGACTTTGACTCCACCTATCGCTCCGTACACCGTCAAGCCGCAGG
ATATGCAGCTCACTCTTCAGTCCGGTGGCGCCAGCTTCCTCCTTACCGGAAAGATCCGTGTCCGGACTACCGAGATTCCCGGTAGCACCATCACCAACTTGGTTTTGACTTGGAAAGACA
GGAACGGTGGTAACAGCTGTGGCTCTTTGTCATCCTGCTCCACGACCGCTACTCTTCAGGGTATTGCCAACGGTTTCGATGACACCTTTGCCTTCTTCCCGATTGAGGCTACCATCCCTA
CATCGACCGGCATCTCCTCTTTCACAATCACCATCAACCGCAACGATGGCTCGAGCCAGACATTCGACAACAATGGAAACACCTACCCCTTGTCGGACGCCGTTGTCTTGCAAAAGACCC
AGAGCTGCCTGTTGCAGACATCAGGCCAACTCACTGTTGCGGCCGTTGTTCGCAACGATGTCGTCGGTGTTCCAGTGAACCTCGATATCGAGTATCAGACGCCCCGTACCGGTAACAGCG
GCAACCCAGTCCCTGCCATCAACACAGCTACTGTTCAAATGACTGAAGGTGACTGTGTCGGTCCCTACACTTTCTACTCGGCCAGCTACACCATCCCCGGCGGCCGCAGCTACAACGCCA
GAATCAGCATCACTGCTGGCGAGCACACCGATGACTTCAACAAGGCCAGCATCTTTGGCGGTACATGTGGCAGCTTTACAGGCACCCTTGCCTGCGGCAACATTACTGAGCCCGTTAGCA
CTACGAGCTCCTCGGCCACCGCCTCCAGCACCTCGACCTCGGTCTCGAGCAGCGTGGTCACAACCACGACTACCGGCAGCACCGGTGTTCCCACCCCTAGCATCAGACCCAGCGTTGGTG
GCTACAGCTTTGTTGACTGCTGGACCGAAGGTGCTGGTGGCATCCGCGCTCTTGGCGGTGCGTCTTTTGCCTACGATGAGATGACTCTTGAATCCTGCGCCGCCAACTGCACTGGTTTCG
ATCTCTGGGGTACTGAGTATGGCCGTGAGTGCTACTGCGGAAACAGCCTTCACTCCAGCAGCTCCGAGGCTCCTGAAGCCGAGTGCAACATGCCCTGCGGTGGTGATCCGAGTGCCTTCT
GCGGTGCTGGCAACAGAATCCAGCTCTATTCTACCACGGCCACACGCAGCACGTCTGCTACTCCCACGCCAACTGCTACCTTGAGCACCAAGCCTACTGTTGGTGCTTATGTGCGTGTTG
GATGCCAGACTGAGGCCTCTGCCGGTCGCGCCTTGTCGGGGAACAGCTATGCTTCTGATGACATGACTCTTGAGTCTTGTGCTGCTTTCTGCAGCGGCTTCACGTATTTCGGCACTCAGT
ACTCTCGTGAAT
GTCAGTTCTCCAGACGAGATTAATTTATAGGGATATCACTGACATAACAACAGGCTTCTGCGGAAACACCATCAATGGTAACAGCGCTTCTGCTCCCGATGCGGATTG
CAGCATGACCTGCGCCGGCGACCCCTTCTCCTACTGCGGTGCTGGCAACAGATTGGAGCTCTACATCCTGGAGACTGCGTCCACCTCAACCACCGGTGCCCCTCCTGTCGAAG
GTTAGAC
AGATCGCCTTTTTCCGAATCTTGGACCGACAATTTCCTAACATCTTATCTAGTTACGACCACGGCTACTGCCACTGCCACGTCTACCACTTCTGCTGCCCCCACAGGAACACTTTCCCGC
GTGCCTACCGTTTCTCCCTATAGTTACGCCGGCTGCTACACCGAGGGCACTGGCTCCCGCGCCCTCACCGGAAAGAGCACTTATGACTCCGAGATGACCCTCGAGTTCTGTGCCAGCTAT
TGCTCTGGTTACAAGTACATGGCCACCCAGTACAGCGCCGAGTGCTTCTGTGGGAACACGCTTCACTCAACTGCCACTGAAGCCGCCCAGGGCGACTGCTCCATGACCTGCGCCGGCAAC
GAGTTCCAGTATTGCGGAGGACCCAACAGACTCGAGCTGTACGTCCAGGAGGACATCGAGGCCCCAGCTGCCCCTTCCCAGCCAGAGGCCGTTGGCAACTGGACCTTCTACCAGTGCAGA
ACAGAGGGAAGCCCAGGACGTGCCTTGGCTGCCGAGACATACGCCGCTGACACCATGACTCTCGAGTCTTGCGCCGACTTTTGCGCTGGCTACACTTACTTTGGTACCGAGTACGCTAGG
GAGTGCTTCTGCGGTAACTCTTTTGGTGTTGGCTCGATCGAGGCGCCTGCGGCAGAGTGCTTCATGACTTGCGCGGGTAACGGATCGCAGTTCTGCGGTGCTGGTAATCGTCTGAGTATT
TACCAAGCTGCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAACCAGAACCAGCAAGGGCTCTATCCTTGCCGGCCTGCTCCTGGCAGCGGGAGCGGGAACCGGCAGGGCGGATCCGACATGGCCCGCACCTACCGATCAGATGGAGGAGATTGTT
TTCCAGCTTCAGGGCATGGACGGGAGTTTGTTCAGTGATAACATCACGCCTTGTGATAATGAGGCCGCTGGGCCGGGGAGGGTGACAGCTAGCGAGTGGCTGCGCGTTGCTTTTCA
TGAC
ATGGCTACCCACAACAGGTTTTTTGACCGGGGCGGTCTTGACGGCTCGTTGCAATTCGAGCTTAGAAGCTCTGAAAACACGGGCCCAGGACACAACACCACACTCCAGTTCTACGCGACA
TATTTGTCCAGCCGGTCAAGTCTCGCAGATCTGATCGCGGCCGGAGCGTATGCCGCCGTTCGCGCCTGCGGAGGACCAGTCATTCCACTGAGATTGGGACGCAAGGATGCGCTGACGGCC
GGCTCCTCTGGTGTTCCCCAACCAGAGAACTCAGTTGGCAGTTTCGTATCGCAGTTCGACCGCATGGGCTTCTCCCAGGCTGAGATGATTCAAGTCGTGGCCTGCGGTCATACGCTCGGA
GGAGTTCACAGGACCGAGTTCCCCAACATCATTCCCGCCGGCGTGTCCAATATTCCCTTTGATACGTCCAAGGCCACCTTTGACAACAGGATTGCCACCGAGTATGTGTCTGGTAACACC
ACCAACCCCCTCGTAGTTGGTCCAGCAATTGCTATCAACCGCCATTCCGATTTCAAGGTCTTCAACAGTGACGGAAACGCCACTATCAACACCATGACATCGCCCAGTGCTTTCCAGAGC
ATCTGCCAGACTGTTTTGCAGAAGATGATCGATGTGGTACCGTCCACTGTGACTTTGACTCCACCTATCGCTCCGTACACCGTCAAGCCGCAGGATATGCAGCTCACTCTTCAGTCCGGT
GGCGCCAGCTTCCTCCTTACCGGAAAGATCCGTGTCCGGACTACCGAGATTCCCGGTAGCACCATCACCAACTTGGTTTTGACTTGGAAAGACAGGAACGGTGGTAACAGCTGTGGCTCT
TTGTCATCCTGCTCCACGACCGCTACTCTTCAGGGTATTGCCAACGGTTTCGATGACACCTTTGCCTTCTTCCCGATTGAGGCTACCATCCCTACATCGACCGGCATCTCCTCTTTCACA
ATCACCATCAACCGCAACGATGGCTCGAGCCAGACATTCGACAACAATGGAAACACCTACCCCTTGTCGGACGCCGTTGTCTTGCAAAAGACCCAGAGCTGCCTGTTGCAGACATCAGGC
CAACTCACTGTTGCGGCCGTTGTTCGCAACGATGTCGTCGGTGTTCCAGTGAACCTCGATATCGAGTATCAGACGCCCCGTACCGGTAACAGCGGCAACCCAGTCCCTGCCATCAACACA
GCTACTGTTCAAATGACTGAAGGTGACTGTGTCGGTCCCTACACTTTCTACTCGGCCAGCTACACCATCCCCGGCGGCCGCAGCTACAACGCCAGAATCAGCATCACTGCTGGCGAGCAC
ACCGATGACTTCAACAAGGCCAGCATCTTTGGCGGTACATGTGGCAGCTTTACAGGCACCCTTGCCTGCGGCAACATTACTGAGCCCGTTAGCACTACGAGCTCCTCGGCCACCGCCTCC
AGCACCTCGACCTCGGTCTCGAGCAGCGTGGTCACAACCACGACTACCGGCAGCACCGGTGTTCCCACCCCTAGCATCAGACCCAGCGTTGGTGGCTACAGCTTTGTTGACTGCTGGACC
GAAGGTGCTGGTGGCATCCGCGCTCTTGGCGGTGCGTCTTTTGCCTACGATGAGATGACTCTTGAATCCTGCGCCGCCAACTGCACTGGTTTCGATCTCTGGGGTACTGAGTATGGCCGT
GAGTGCTACTGCGGAAACAGCCTTCACTCCAGCAGCTCCGAGGCTCCTGAAGCCGAGTGCAACATGCCCTGCGGTGGTGATCCGAGTGCCTTCTGCGGTGCTGGCAACAGAATCCAGCTC
TATTCTACCACGGCCACACGCAGCACGTCTGCTACTCCCACGCCAACTGCTACCTTGAGCACCAAGCCTACTGTTGGTGCTTATGTGCGTGTTGGATGCCAGACTGAGGCCTCTGCCGGT
CGCGCCTTGTCGGGGAACAGCTATGCTTCTGATGACATGACTCTTGAGTCTTGTGCTGCTTTCTGCAGCGGCTTCACGTATTTCGGCACTCAGTACTCTCGTGAAT
GCTTCTGCGGAAAC
ACCATCAATGGTAACAGCGCTTCTGCTCCCGATGCGGATTGCAGCATGACCTGCGCCGGCGACCCCTTCTCCTACTGCGGTGCTGGCAACAGATTGGAGCTCTACATCCTGGAGACTGCG
TCCACCTCAACCACCGGTGCCCCTCCTGTCGAAG
TTACGACCACGGCTACTGCCACTGCCACGTCTACCACTTCTGCTGCCCCCACAGGAACACTTTCCCGCGTGCCTACCGTTTCTCCC
TATAGTTACGCCGGCTGCTACACCGAGGGCACTGGCTCCCGCGCCCTCACCGGAAAGAGCACTTATGACTCCGAGATGACCCTCGAGTTCTGTGCCAGCTATTGCTCTGGTTACAAGTAC
ATGGCCACCCAGTACAGCGCCGAGTGCTTCTGTGGGAACACGCTTCACTCAACTGCCACTGAAGCCGCCCAGGGCGACTGCTCCATGACCTGCGCCGGCAACGAGTTCCAGTATTGCGGA
GGACCCAACAGACTCGAGCTGTACGTCCAGGAGGACATCGAGGCCCCAGCTGCCCCTTCCCAGCCAGAGGCCGTTGGCAACTGGACCTTCTACCAGTGCAGAACAGAGGGAAGCCCAGGA
CGTGCCTTGGCTGCCGAGACATACGCCGCTGACACCATGACTCTCGAGTCTTGCGCCGACTTTTGCGCTGGCTACACTTACTTTGGTACCGAGTACGCTAGGGAGTGCTTCTGCGGTAAC
TCTTTTGGTGTTGGCTCGATCGAGGCGCCTGCGGCAGAGTGCTTCATGACTTGCGCGGGTAACGGATCGCAGTTCTGCGGTGCTGGTAATCGTCTGAGTATTTACCAAGCTGCTTAG

Retrieve as FASTA