Entry information : PgrCcP02
Entry ID 5375
Creation 2007-06-01 (Laure Collomb)
Last sequence changes 2007-06-01 (Laure Collomb)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-05-04 (Christophe Dunand)
Peroxidase information: PgrCcP02
Name PgrCcP02
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Fungi/Metazoa; Fungi; Basidiomycota; Basidiomycota
Organism Puccinia graminis f. sp. tritici    [TaxId: 56615 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PgrCcP02
start..stop
S start..stop
PUtriCcP02 716 0 2..387 3..388
CqueCcP02 551 0 10..383 3..372
MlpCcP02 545 0 71..382 62..375
HrufCcP01 421 1e-147 47..383 32..369
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 208153..208632 480 N° 2 207771..208055 285 N° 3 207447..207700 254 N° 4 207209..207356 148
complement(join(207209..207356,207447..207700,207771..208055,208153..208632))


exon

Literature and cross-references PgrCcP02
Literature Birren B. et al. unpublished since 2007
DNA ref. JGI genome:   supercontig_2_73 (208632..207209)
Cluster/Prediction ref. JGI gene:   37108
Protein sequence: PgrCcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   388
PWM (Da):   %s   42661.25  
PI (pH):   %s   8.64
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASARSINLLRSSAKQFLPIQRLPRATHGLRSSFYYSTAPAGANPSSSSSQAPPPPQGEPKSSKTPLIAGLALGGVGLAYYFYALDSDSDLQKRYTTPKAANSNLNFQAVYNDIAAILEDSSYDDGSYAPVLVRLAWHASGTYDKESKTGGSNGATMRFAPESNHGANAGLGVAREKLEPIYKKYARSGLTYSDLWTLAGVAAIQEIGGPKIPWRPGRQDGVGPDNCPPDGRLPDGDKDQDHVRKIFYRMGFNDQEIVALLGAHALGRCHTDRSGFEGPWTFSPTTFSNDYYRLLFDEKWQPRKWSGPPQYEDKKTKSLMMLTTDMCIVMDKSFRNWAKKYATDEKVFFDDFSKAFSKLIELGVPEENFSGKAPMTLKTLDEQGIQVD

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 intron FGENESH predicted), no EST available. Forma="specialis". Strain="CRL 75-36-700-3".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAGCTCGATCGATCAACCTCTTGCGATCCTCAGCAAAGCAATTTCTGCCCATACAACGACTCCCCCGGGCTACTCATGGGCTCCGATCATCCTTCTACTACTCCACCGCCCCG
GCCGGAGCGAACCCCTCATCATCATCCTCACAAGCACCACCCCCTCCGCAAGGGGAACCGAAGTCGTCCAAGACCCCGTTGATTGCCGGCCTCGCGCTCGGTGGAGTCGGACTGGCCTAT
TACTTCTACGCCCTCGACTCGGACTCGGATCTCCAGAAGAGATACACCACCCCCAAGGCCGCTAACAGTAACCTTAACTTCCAGGCCGTCTATAACGATATCGCCGCCATCCTCGAGGAT
AGTAGCTACGACGACGGATCCTATGCGCCCGTCCTCGTCCGTCTCGCTTGGCATGCCTCCGGCACTTACGATAAAGAGTCCAAGACGGGCGGCAGTAACGGAGCCACGATGCGATTTGCG
GTGGGCAATCTCTCCTTCTCCTTTTGAGGGAAATCATCGACTGATCAAAGATCCATTGTTTTTTTGTTTTCGATCGAAAAAAAAAAAAAAATTGTAGCCTGAAAGTAACCATGGAGCCAA
TGCAGGTCTGGGGGTAGCCCGAGAGAAGCTCGAGCCGATCTACAAGAAGTATGCGCGCTCGGGGCTGACGTATTCGGATCTCTGGACACTTGCGGGGGTGGCGGCGATCCAGGAGATCGG
CGGGCCCAAGATCCCGTGGCGTCCGGGACGACAGGACGGGGTTGGGCCCGACAACTGTCCGCCGGATGGACGATTGCCCGATGGTGATAAGGACCAGGACCATGTGCGAAAGATCTTCTA
CCGCATGGGGTTCAATGACCAG
GTCAGTCTGATCATTCCATCTCTCATCCCTCTTATTATTATTAACACTTGATATTTGAAATTTTCTTTAGGAAATCGTCGCCCTCCTCGGCGCCCATG
CCCTCGGCAGATGTCACACAGACCGCTCCGGCTTCGAAGGCCCCTGGACATTCTCCCCCACCACGTTCTCCAACGACTACTATCGACTGCTCTTTGACGAGAAATGGCAGCCTCGTAAAT
GGTCCGGGCCGCCCCAATACGAGGACAAGAAGACTAAGAGTCTCATGATGTTGACCACGGACATGTGCATCGTCATGGACAAGAGCTTCCGCAATTGGGCCAAAAA
GTTCGTCCCTTTCT
CTTCCAAAAAACAAAAAAAAACATTGGGTTGAAGTCGGACGTTTCTGATTTTGGTCGGGCTATCAAAATTATTTAGATATGCTACCGATGAGAAAGTCTTCTTCGACGACTTCTCCAAAG
CGTTCTCTAAACTGATCGAGCTCGGAGTTCCTGAAGAAAACTTCTCTGGCAAAGCGCCGATGACGTTGAAGACTTTGGATGAACAAGGCATCCAAGTCGATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAGCTCGATCGATCAACCTCTTGCGATCCTCAGCAAAGCAATTTCTGCCCATACAACGACTCCCCCGGGCTACTCATGGGCTCCGATCATCCTTCTACTACTCCACCGCCCCG
GCCGGAGCGAACCCCTCATCATCATCCTCACAAGCACCACCCCCTCCGCAAGGGGAACCGAAGTCGTCCAAGACCCCGTTGATTGCCGGCCTCGCGCTCGGTGGAGTCGGACTGGCCTAT
TACTTCTACGCCCTCGACTCGGACTCGGATCTCCAGAAGAGATACACCACCCCCAAGGCCGCTAACAGTAACCTTAACTTCCAGGCCGTCTATAACGATATCGCCGCCATCCTCGAGGAT
AGTAGCTACGACGACGGATCCTATGCGCCCGTCCTCGTCCGTCTCGCTTGGCATGCCTCCGGCACTTACGATAAAGAGTCCAAGACGGGCGGCAGTAACGGAGCCACGATGCGATTTGCG
CCTGAAAGTAACCATGGAGCCAATGCAGGTCTGGGGGTAGCCCGAGAGAAGCTCGAGCCGATCTACAAGAAGTATGCGCGCTCGGGGCTGACGTATTCGGATCTCTGGACACTTGCGGGG
GTGGCGGCGATCCAGGAGATCGGCGGGCCCAAGATCCCGTGGCGTCCGGGACGACAGGACGGGGTTGGGCCCGACAACTGTCCGCCGGATGGACGATTGCCCGATGGTGATAAGGACCAG
GACCATGTGCGAAAGATCTTCTACCGCATGGGGTTCAATGACCAG
GAAATCGTCGCCCTCCTCGGCGCCCATGCCCTCGGCAGATGTCACACAGACCGCTCCGGCTTCGAAGGCCCCTGG
ACATTCTCCCCCACCACGTTCTCCAACGACTACTATCGACTGCTCTTTGACGAGAAATGGCAGCCTCGTAAATGGTCCGGGCCGCCCCAATACGAGGACAAGAAGACTAAGAGTCTCATG
ATGTTGACCACGGACATGTGCATCGTCATGGACAAGAGCTTCCGCAATTGGGCCAAAAA
ATATGCTACCGATGAGAAAGTCTTCTTCGACGACTTCTCCAAAGCGTTCTCTAAACTGATC
GAGCTCGGAGTTCCTGAAGAAAACTTCTCTGGCAAAGCGCCGATGACGTTGAAGACTTTGGATGAACAAGGCATCCAAGTCGATTGA

Retrieve as FASTA