Entry information : HjAPx-CcP01
Entry ID 5386
Creation 2007-05-17 (Marcel Zamocky)
Last sequence changes 2007-05-17 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: HjAPx-CcP01
Name HjAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Hypocrea
Organism Hypocrea jecorina (Trichoderma reesei)    [TaxId: 51453 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HjAPx-CcP01
start..stop
S start..stop
TviAPx-CcP01 1582 0 1..923 1..909
TaspAPx-CcP01 1553 0 1..923 1..912
TharAPx-CcP02 1547 0 1..924 1..932
TatAPx-CcP01 1542 0 1..923 1..922
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 114993..116970 1978 N° 2 117041..117846 806  
join(114993..116970,117041..117846)


exon

Literature and cross-references HjAPx-CcP01
Literature Martinez,D., Rokhsar,D., Putnam,N., Grigoriev,I., Salamov,A., Bristow,J., Rubin,E., Lucas,S., Hammon,N., Israni,S., Glavina,T., Detter,C. and Richardson,P. The Genome of Trichoderma reesei QM6a.
DNA ref. JGI genome:   scaffold_1 (114993..117846)
Cluster/Prediction ref. JGI gene:   73523
Protein sequence: HjAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   927 (908)
PWM (Da):   %s   97319.28 (95504.3)  
PI (pH):   %s   4.13 (4.11) Peptide Signal:   %s   cut: 20 range:20-927
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKSTAALVGLLSLTSSALADPTWPNAIDEIEEIMTQLQSFRARKFADTVSPCSNEASGPGRQNAAEWLRVGFHDMSTANTYFGIGGLDGSLQYELDNGENTGPGHRTTLEFMAPYVSPRSTLADLIALGVYTSVRSCGGPAVPIRVGRIDATGKGAPGVPQPQNSVATFKQQFDRMGFSVEEMIQVTACGHTLGGVHNTEFPDIVPAGTGLDGESGLDTSDAVFDNLVVTEYLSGETKNPLVVGPSIKIDKNSDFKVFNADGNQTMEALADAETFKSVCKTVLQKMIDVVPPSVKLTDPIVPYKVKPVNLQLTLINGGSTLQLTGFIRVKTTGLAQGSISSVSITYKNRRGTTDCGLSTCVVTSTVQGASQGFDDTFAFYPISANILASSGISSFTVTINNADGTKDIYDNNGNEYPVQDAIIFQSPQSCVLGSSGALTAVAAVRNDRLSQGAQVKVWYKTPQTNSPVPLLQSTTLDLKKGQCAGPYTLFNVDYTIEGGLAYEGYVDVINGDQSDSFKALTSVGGTCRAFANPAACVGGEDEGSGGTTAVTSVPTTTEALPTTTEPPVTTGPVTDPPVTSPPVTEPPTTTEPATTTTTPPPVPSHRPAVDGYVLVSCWTEGDGVRALAGNAYANDSMTLETCRDFCSNYVYWGTEYGRECYCGNTLAKSSGEAPLDECNMVCAGDASEYCGAGNRLELYSTTVTQPPTPTGTLTHEPTVGPYTLVGCWTEGSGDRALGQKATIDPDMTNEACAEFCSDFRYFGTEYGDECYCGSFLAGSSATAPLADCNMPCAGNEFEYCGASNRLELYINPNVTGGNPEQPAAAGDFVFVGCQTEGNGTRALTGAATATGTMTVEACAEFCADFTYFGTEYGSECYCGNTLAPSSLKAPAADCNMLCSGNELEYCGAGNRLSLYTKKPEELTEEDE

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron) and 5 ESTs: 5' F880708 and 3'end: BM076386. Strain="QM6a", "QM9414 (ATCC26921)". Peroxidase domain fused to 3 WSC domains (putative carbohydrate binding domain)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTCGACAGCTGCCCTGGTGGGCCTCCTGAGCCTGACGAGCTCGGCCCTGGCTGATCCGACATGGCCCAATGCCATTGACGAGATCGAGGAGATCATGACCCAACTCCAGTCGTTC
CGCGCCCGCAAATTCGCCGACACGGTGAGCCCGTGCTCCAACGAAGCCTCCGGGCCCGGCCGCCAGAACGCCGCCGAGTGGCTCCGGGTCGGCTTCCACGACATGTCCACGGCCAACACG
TACTTTGGCATTGGAGGTCTCGATGGCTCGCTGCAGTACGAGCTGGACAATGGCGAGAATACCGGGCCCGGCCACAGGACGACGCTCGAGTTCATGGCCCCCTATGTCTCTCCTCGGTCG
ACCCTGGCCGACCTCATCGCCCTCGGCGTCTACACGTCTGTCCGCTCCTGCGGTGGCCCTGCCGTGCCGATTCGCGTCGGCCGTATCGATGCCACCGGCAAGGGAGCGCCAGGTGTCCCC
CAGCCGCAAAACTCCGTCGCCACGTTCAAGCAGCAGTTCGACCGCATGGGCTTCAGCGTCGAGGAGATGATCCAGGTCACGGCCTGTGGCCACACTCTGGGCGGCGTCCACAACACCGAG
TTCCCCGACATTGTGCCCGCCGGAACTGGCCTCGACGGGGAATCGGGTCTCGACACGAGCGATGCCGTCTTTGACAACCTCGTTGTCACCGAGTATCTCTCCGGCGAGACCAAGAACCCG
CTTGTCGTAGGCCCGTCGATCAAGATTGACAAGAACTCCGACTTCAAGGTCTTCAACGCCGACGGCAACCAGACCATGGAGGCCCTGGCTGATGCAGAGACCTTCAAGTCCGTCTGCAAG
ACTGTCCTGCAAAAGATGATTGACGTCGTGCCCCCGAGCGTCAAGTTGACCGACCCCATCGTCCCCTACAAGGTCAAGCCTGTCAACCTGCAGCTGACCCTGATCAACGGCGGCAGCACC
CTCCAGCTGACGGGCTTCATCCGCGTCAAGACCACCGGCCTCGCCCAGGGCAGCATATCCAGCGTGTCCATCACCTACAAGAACCGCAGGGGCACCACTGACTGCGGCCTGAGCACCTGT
GTCGTCACCAGCACTGTTCAGGGCGCCAGCCAGGGCTTTGACGATACCTTTGCCTTCTACCCCATCTCGGCCAACATCCTCGCCTCCTCGGGGATCTCGTCCTTCACCGTGACTATCAAC
AATGCTGACGGCACCAAGGACATCTACGACAACAATGGCAACGAGTATCCTGTCCAGGATGCCATCATCTTCCAGTCTCCCCAAAGCTGTGTCCTCGGCTCCTCGGGTGCTTTGACTGCC
GTGGCTGCTGTCCGCAACGACCGTCTCAGCCAGGGCGCGCAAGTCAAGGTCTGGTACAAGACGCCCCAGACAAACAGCCCCGTTCCTTTGCTGCAGAGCACGACCCTCGACCTCAAGAAG
GGGCAGTGCGCCGGACCGTACACTCTGTTCAACGTCGACTACACCATCGAAGGTGGCCTGGCGTACGAGGGATACGTCGACGTCATCAATGGTGACCAGTCCGACAGCTTCAAGGCCCTG
ACCAGCGTTGGCGGTACCTGCCGTGCCTTTGCGAACCCAGCTGCCTGCGTTGGCGGAGAGGATGAGGGATCCGGCGGCACAACGGCCGTCACAAGCGTTCCAACCACGACCGAGGCTCTC
CCTACTACTACGGAGCCTCCTGTCACTACTGGTCCTGTCACTGACCCCCCTGTTACTTCTCCTCCTGTCACGGAGCCTCCCACGACCACAGAGCCTGCGACGACGACGACGACGCCACCT
CCTGTTCCCAGTCACCGCCCTGCAGTCGACGGATATGTCCTGGTTTCTTGCTGGACCGAGGGTGACGGTGTGCGTGCTCTGGCTGGCAACGCCTATGCAAACGACTCGATGACTCTGGAG
ACCTGCAGAGACTTTTGCAGCAACTATGTCTACTGGGGCACAGAGTATGGCCGCGAAT
GTGAGTATTCAATCTTGTCTTGTTGACCTCGACCCCCGGAGACTTCCTCGCGCTAACAAAAC
ACCTATAGGCTACTGTGGCAACACCCTTGCCAAGAGCAGCGGAGAGGCTCCCCTTGATGAGTGCAACATGGTCTGCGCTGGTGATGCCAGCGAGTACTGTGGTGCTGGCAACCGGCTCGA
GCTGTACTCGACCACAGTCACCCAGCCTCCCACTCCCACTGGCACCCTGACCCACGAGCCCACTGTCGGCCCATACACACTGGTGGGCTGCTGGACGGAAGGCTCAGGCGATCGCGCCCT
GGGCCAGAAGGCTACCATTGACCCTGACATGACCAACGAGGCCTGTGCCGAGTTCTGCTCCGACTTTAGGTACTTTGGCACGGAGTACGGCGACGAGTGCTACTGTGGTAGTTTCCTTGC
TGGCTCGAGTGCAACCGCCCCCCTGGCCGACTGCAACATGCCCTGCGCCGGCAACGAGTTTGAGTACTGCGGTGCCAGCAACCGTCTCGAGCTCTACATCAACCCCAACGTCACTGGTGG
AAACCCTGAGCAGCCCGCTGCCGCCGGCGACTTTGTGTTTGTCGGCTGCCAGACTGAGGGCAACGGCACCCGCGCCCTGACGGGCGCTGCCACCGCAACAGGCACCATGACTGTTGAGGC
ATGCGCTGAGTTTTGTGCCGACTTTACGTACTTTGGCACCGAGTACGGCAGCGAATGCTACTGTGGCAACACTCTGGCGCCCTCGTCTCTCAAGGCGCCGGCGGCGGACTGCAACATGCT
GTGCAGCGGCAACGAGCTTGAGTACTGTGGCGCGGGCAACCGCCTCTCACTGTACACCAAGAAGCCCGAAGAGCTTACAGAGGAGGATGAATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTCGACAGCTGCCCTGGTGGGCCTCCTGAGCCTGACGAGCTCGGCCCTGGCTGATCCGACATGGCCCAATGCCATTGACGAGATCGAGGAGATCATGACCCAACTCCAGTCGTTC
CGCGCCCGCAAATTCGCCGACACGGTGAGCCCGTGCTCCAACGAAGCCTCCGGGCCCGGCCGCCAGAACGCCGCCGAGTGGCTCCGGGTCGGCTTCCACGACATGTCCACGGCCAACACG
TACTTTGGCATTGGAGGTCTCGATGGCTCGCTGCAGTACGAGCTGGACAATGGCGAGAATACCGGGCCCGGCCACAGGACGACGCTCGAGTTCATGGCCCCCTATGTCTCTCCTCGGTCG
ACCCTGGCCGACCTCATCGCCCTCGGCGTCTACACGTCTGTCCGCTCCTGCGGTGGCCCTGCCGTGCCGATTCGCGTCGGCCGTATCGATGCCACCGGCAAGGGAGCGCCAGGTGTCCCC
CAGCCGCAAAACTCCGTCGCCACGTTCAAGCAGCAGTTCGACCGCATGGGCTTCAGCGTCGAGGAGATGATCCAGGTCACGGCCTGTGGCCACACTCTGGGCGGCGTCCACAACACCGAG
TTCCCCGACATTGTGCCCGCCGGAACTGGCCTCGACGGGGAATCGGGTCTCGACACGAGCGATGCCGTCTTTGACAACCTCGTTGTCACCGAGTATCTCTCCGGCGAGACCAAGAACCCG
CTTGTCGTAGGCCCGTCGATCAAGATTGACAAGAACTCCGACTTCAAGGTCTTCAACGCCGACGGCAACCAGACCATGGAGGCCCTGGCTGATGCAGAGACCTTCAAGTCCGTCTGCAAG
ACTGTCCTGCAAAAGATGATTGACGTCGTGCCCCCGAGCGTCAAGTTGACCGACCCCATCGTCCCCTACAAGGTCAAGCCTGTCAACCTGCAGCTGACCCTGATCAACGGCGGCAGCACC
CTCCAGCTGACGGGCTTCATCCGCGTCAAGACCACCGGCCTCGCCCAGGGCAGCATATCCAGCGTGTCCATCACCTACAAGAACCGCAGGGGCACCACTGACTGCGGCCTGAGCACCTGT
GTCGTCACCAGCACTGTTCAGGGCGCCAGCCAGGGCTTTGACGATACCTTTGCCTTCTACCCCATCTCGGCCAACATCCTCGCCTCCTCGGGGATCTCGTCCTTCACCGTGACTATCAAC
AATGCTGACGGCACCAAGGACATCTACGACAACAATGGCAACGAGTATCCTGTCCAGGATGCCATCATCTTCCAGTCTCCCCAAAGCTGTGTCCTCGGCTCCTCGGGTGCTTTGACTGCC
GTGGCTGCTGTCCGCAACGACCGTCTCAGCCAGGGCGCGCAAGTCAAGGTCTGGTACAAGACGCCCCAGACAAACAGCCCCGTTCCTTTGCTGCAGAGCACGACCCTCGACCTCAAGAAG
GGGCAGTGCGCCGGACCGTACACTCTGTTCAACGTCGACTACACCATCGAAGGTGGCCTGGCGTACGAGGGATACGTCGACGTCATCAATGGTGACCAGTCCGACAGCTTCAAGGCCCTG
ACCAGCGTTGGCGGTACCTGCCGTGCCTTTGCGAACCCAGCTGCCTGCGTTGGCGGAGAGGATGAGGGATCCGGCGGCACAACGGCCGTCACAAGCGTTCCAACCACGACCGAGGCTCTC
CCTACTACTACGGAGCCTCCTGTCACTACTGGTCCTGTCACTGACCCCCCTGTTACTTCTCCTCCTGTCACGGAGCCTCCCACGACCACAGAGCCTGCGACGACGACGACGACGCCACCT
CCTGTTCCCAGTCACCGCCCTGCAGTCGACGGATATGTCCTGGTTTCTTGCTGGACCGAGGGTGACGGTGTGCGTGCTCTGGCTGGCAACGCCTATGCAAACGACTCGATGACTCTGGAG
ACCTGCAGAGACTTTTGCAGCAACTATGTCTACTGGGGCACAGAGTATGGCCGCGAAT
GCTACTGTGGCAACACCCTTGCCAAGAGCAGCGGAGAGGCTCCCCTTGATGAGTGCAACATG
GTCTGCGCTGGTGATGCCAGCGAGTACTGTGGTGCTGGCAACCGGCTCGAGCTGTACTCGACCACAGTCACCCAGCCTCCCACTCCCACTGGCACCCTGACCCACGAGCCCACTGTCGGC
CCATACACACTGGTGGGCTGCTGGACGGAAGGCTCAGGCGATCGCGCCCTGGGCCAGAAGGCTACCATTGACCCTGACATGACCAACGAGGCCTGTGCCGAGTTCTGCTCCGACTTTAGG
TACTTTGGCACGGAGTACGGCGACGAGTGCTACTGTGGTAGTTTCCTTGCTGGCTCGAGTGCAACCGCCCCCCTGGCCGACTGCAACATGCCCTGCGCCGGCAACGAGTTTGAGTACTGC
GGTGCCAGCAACCGTCTCGAGCTCTACATCAACCCCAACGTCACTGGTGGAAACCCTGAGCAGCCCGCTGCCGCCGGCGACTTTGTGTTTGTCGGCTGCCAGACTGAGGGCAACGGCACC
CGCGCCCTGACGGGCGCTGCCACCGCAACAGGCACCATGACTGTTGAGGCATGCGCTGAGTTTTGTGCCGACTTTACGTACTTTGGCACCGAGTACGGCAGCGAATGCTACTGTGGCAAC
ACTCTGGCGCCCTCGTCTCTCAAGGCGCCGGCGGCGGACTGCAACATGCTGTGCAGCGGCAACGAGCTTGAGTACTGTGGCGCGGGCAACCGCCTCTCACTGTACACCAAGAAGCCCGAA
GAGCTTACAGAGGAGGATGAATGA

Retrieve as FASTA