Entry information : CheKat01_C4 (cat1 / KatE)
Entry ID 5388
Creation 2007-05-18 (Christophe Dunand)
Last sequence changes 2007-05-18 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: CheKat01_C4 (cat1 / KatE)
Name (synonym) CheKat01_C4 (cat1 / KatE)
Class Catalase    [Orthogroup: Kat002]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Cochliobolus
Organism Cochliobolus heterostrophus    [TaxId: 5016 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CheKat01_C4
start..stop
S start..stop
CheKat01_C5 1147 0 1..547 1..547
PnoKat01 967 0 1..546 1..546
CtheKat3 902 0 1..546 37..582
CcinKat03 801 0 3..546 26..576
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11658..13112 1455 N° 2 11397..11585 189  
complement(join(11397..11585,11658..13112))


exon

Literature and cross-references CheKat01_C4 (cat1 / KatE)
Literature Robbertse,B., Yoder,O.C., Nguyen,A., Schoch,C.L. and Turgeon,B.G. Deletion of all Cochliobolus heterostrophus monofunctional catalase-encoding genes reveals a role for one in sensitivity to oxidative stress but none with a role in virulence. Mol. Plant Microbe Interact. 16 (11), 1013-1021 (2003)
Protein ref. UniProtKB:   Q6UJ34
DNA ref. JGI genome:   scaffold_53 (13112..11397)
Protein sequence: CheKat01_C4 (cat1 / KatE)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   547
PWM (Da):   %s   62748.55  
PI (pH):   %s   6.39
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQSSNEGPADIIAKVAGVTQGGKREDDGPYFTNNEGIPWPDAEHSKTIGGIPVASDVFLFQKQQTFNRSKNLERMVHPCGSGAFGYFETTKDVTHLTKADFLKTVGEKTPIFIRFSTVTPGREYPDEARNPRGFAIKFYTGEGNYDIVGLNFPVFFCRDPIQGPDVIRSQWRNPKNFLFDYDAIFDLLANTPEGNHAGLMFFSDHGTPQGWRFNHGYGCHTFKWVNKDGQFVYIKYHFVAEHGQKQFTQEQATQMCGEDPDYSKRDLYETIENGEEVVWKAHVQVMSPEEADPDKLGFDPFDVTKVWPRKQFPMQEFGRLVLNKNPENFHRDVEQAAFSPGSMVPGVEDSPDPLLQFRMFFYRDAQYHRIGVNLHQIPVNCPFMAKSFASLNFDGQMRVDANHAGNKPYAPNSFAHKFRPDVAEAPYQVNDNIMSRKSHYWHEGKKNEYDQAKELWSRVMSVQEKQNTIKNTANMLKFVRYPEIQQYNIGTDLSRGIYDLLPKPAFDFSEVEELSHTAHEWYKEKKFRSIDGERLTGFPPSMPVYNY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). Strain="C4; ATCC 48331".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGAGCTCAAATGAGGGCCCAGCAGACATCATCGCCAAGGTTGCTGGGGTTACTCAGGGTGGAAAGCGTGAAGATGACGGCCCATATTTCACCAACAATGAAGGCATTCCATGGCCC
GACGCAGAACATAGCAAGACCATCGGCGGAATCCCAGTCGCTAGCGATGTTTTCCTCTTCCAGAAGCAGCAGACATTTAACCGCTCAAAAAATCTCGAGCGCATGGTGCACCCCTGTGGT
TCAGGTGCTTTTGGTTATTTCGAGACCACCAAAGATGTCACCCACCTCACCAAGGCCGACTTTTTGAAGACTGTAGGTGAGAAGACGCCCATATTCATACGATTCAGTACCGTTACTCCT
GGACGCGAGTATCCCGACGAAGCTCGTAACCCTCGTGGATTTGCCATCAAGTTCTATACTGGAGAAGGCAACTACGACATCGTTGGGTTGAACTTCCCAGTTTTCTTCTGCCGTGATCCT
ATCCAGGGCCCAGATGTCATCCGATCGCAATGGCGTAACCCCAAGAACTTCCTTTTCGATTACGATGCTATTTTCGACTTGCTTGCCAACACCCCCGAGGGTAACCACGCTGGCCTAATG
TTCTTCAGTGACCATGGCACGCCCCAGGGTTGGCGTTTCAACCACGGGTATGGATGCCACACGTTCAAGTGGGTGAACAAGGACGGTCAATTCGTGTACATCAAGTACCACTTTGTTGCT
GAGCACGGTCAAAAGCAATTCACCCAGGAACAAGCGACACAAATGTGTGGCGAGGACCCTGACTATTCCAAGCGTGATCTATATGAGACTATTGAGAATGGCGAGGAGGTAGTCTGGAAA
GCACACGTACAGGTCATGAGCCCAGAGGAAGCCGATCCCGATAAGCTTGGCTTCGATCCTTTTGACGTCACCAAGGTCTGGCCGCGTAAGCAATTTCCTATGCAAGAGTTTGGACGCCTG
GTTTTGAACAAGAACCCTGAAAATTTCCATCGTGACGTCGAGCAGGCGGCCTTCTCCCCGGGTAGCATGGTGCCCGGTGTTGAAGACTCGCCTGATCCACTTCTTCAGTTCCGCATGTTC
TTCTACCGCGATGCGCAGTACCACCGTATTGGTGTGAACTTGCACCAGATTCCCGTCAACTGCCCATTCATGGCCAAGTCTTTCGCATCCCTCAATTTTGATGGCCAGATGCGTGTCGAT
GCCAATCATGCTGGGAACAAGCCGTATGCCCCAAACAGCTTCGCGCACAAGTTCCGGCCCGATGTCGCTGAAGCACCATACCAGGTCAATGACAACATCATGAGCCGAAAGAGTCATTAT
TGGCATGAGGGCAAGAAGAACGAGTACGACCAGGCTAAGGAGCTTTGGTCACGCGTAATGAGCGTACAGGAGAAGCAAAACACCATCAAGAACACCGCAAACATGCTTAAGTTTGTCCGA
TACCCCGAGATTCAG
GTAAATTCTCCCTGACAGATTCCGCACATCGCGTTTTCGCTAACAATCTTGAAGAAGAAGTACCTGGCGCAGCAATATAATATCGGTACCGACCTGTCGAGAGGC
ATTTACGACCTCCTCCCGAAGCCAGCGTTCGATTTCAGCGAAGTCGAGGAGCTTTCTCACACAGCCCATGAGTGGTATAAGGAGAAGAAGTTTAGGTCTATCGATGGCGAGAGGCTTACA
GGTTTCCCTCCATCGATGCCTGTTTATAATTACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGAGCTCAAATGAGGGCCCAGCAGACATCATCGCCAAGGTTGCTGGGGTTACTCAGGGTGGAAAGCGTGAAGATGACGGCCCATATTTCACCAACAATGAAGGCATTCCATGGCCC
GACGCAGAACATAGCAAGACCATCGGCGGAATCCCAGTCGCTAGCGATGTTTTCCTCTTCCAGAAGCAGCAGACATTTAACCGCTCAAAAAATCTCGAGCGCATGGTGCACCCCTGTGGT
TCAGGTGCTTTTGGTTATTTCGAGACCACCAAAGATGTCACCCACCTCACCAAGGCCGACTTTTTGAAGACTGTAGGTGAGAAGACGCCCATATTCATACGATTCAGTACCGTTACTCCT
GGACGCGAGTATCCCGACGAAGCTCGTAACCCTCGTGGATTTGCCATCAAGTTCTATACTGGAGAAGGCAACTACGACATCGTTGGGTTGAACTTCCCAGTTTTCTTCTGCCGTGATCCT
ATCCAGGGCCCAGATGTCATCCGATCGCAATGGCGTAACCCCAAGAACTTCCTTTTCGATTACGATGCTATTTTCGACTTGCTTGCCAACACCCCCGAGGGTAACCACGCTGGCCTAATG
TTCTTCAGTGACCATGGCACGCCCCAGGGTTGGCGTTTCAACCACGGGTATGGATGCCACACGTTCAAGTGGGTGAACAAGGACGGTCAATTCGTGTACATCAAGTACCACTTTGTTGCT
GAGCACGGTCAAAAGCAATTCACCCAGGAACAAGCGACACAAATGTGTGGCGAGGACCCTGACTATTCCAAGCGTGATCTATATGAGACTATTGAGAATGGCGAGGAGGTAGTCTGGAAA
GCACACGTACAGGTCATGAGCCCAGAGGAAGCCGATCCCGATAAGCTTGGCTTCGATCCTTTTGACGTCACCAAGGTCTGGCCGCGTAAGCAATTTCCTATGCAAGAGTTTGGACGCCTG
GTTTTGAACAAGAACCCTGAAAATTTCCATCGTGACGTCGAGCAGGCGGCCTTCTCCCCGGGTAGCATGGTGCCCGGTGTTGAAGACTCGCCTGATCCACTTCTTCAGTTCCGCATGTTC
TTCTACCGCGATGCGCAGTACCACCGTATTGGTGTGAACTTGCACCAGATTCCCGTCAACTGCCCATTCATGGCCAAGTCTTTCGCATCCCTCAATTTTGATGGCCAGATGCGTGTCGAT
GCCAATCATGCTGGGAACAAGCCGTATGCCCCAAACAGCTTCGCGCACAAGTTCCGGCCCGATGTCGCTGAAGCACCATACCAGGTCAATGACAACATCATGAGCCGAAAGAGTCATTAT
TGGCATGAGGGCAAGAAGAACGAGTACGACCAGGCTAAGGAGCTTTGGTCACGCGTAATGAGCGTACAGGAGAAGCAAAACACCATCAAGAACACCGCAAACATGCTTAAGTTTGTCCGA
TACCCCGAGATTCAG
CAATATAATATCGGTACCGACCTGTCGAGAGGCATTTACGACCTCCTCCCGAAGCCAGCGTTCGATTTCAGCGAAGTCGAGGAGCTTTCTCACACAGCCCATGAG
TGGTATAAGGAGAAGAAGTTTAGGTCTATCGATGGCGAGAGGCTTACAGGTTTCCCTCCATCGATGCCTGTTTATAATTACTGA

Retrieve as FASTA