Entry information : LmaCP01 (LmaKatG1)
Entry ID 5403
Creation 2007-06-05 (Marcel Zamocky)
Last sequence changes 2011-05-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: LmaCP01 (LmaKatG1)
Name (synonym) LmaCP01 (LmaKatG1)
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Leptosphaeriaceae Leptosphaeria
Organism Leptosphaeria maculans    [TaxId: 5022 ]
Cellular localisation Cytosolic
Tissue type Mycelium
Inducer Oxidative stress
Repressor N/D
Best BLASTp hits
Perox score E-value LmaCP01
start..stop
S start..stop
PterCP 1380 0 1..761 1..760
PtritCP01 1371 0 1..761 1..760
SturCP 1370 0 1..761 1..759
AalteCP01 1370 0 1..761 1..760
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1238281..1238540 260 N° 2 1238612..1239087 476 N° 3 1239146..1240695 1550  
join(1238281..1238540,1238612..1239087,1239146..1240695)


exon

Literature and cross-references LmaCP01 (LmaKatG1)
Literature REFERENCE 1 Idnurm,A., Cozijnsen,A.J. and Howlett,B.J. Expressed sequence tags of Leptosphaeria maculans, cause of blackleg disease of oilseed Brassicas unpublished since 2001;
REFERENCE 2 M. Zamocky et al. Catalase-peroxidases in phytopathogenic fungi (ICBIC 2007 presentation)
Protein ref. UniProtKB:   E5A1L6 [Incorrect splicing]
DNA ref. JGI genome:   lm_SuperContig_16_v2 (1238281..1240695)
EST ref. GenBank:   BG370112.1
Protein sequence: LmaCP01 (LmaKatG1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   762
PWM (Da):   %s   84302.33  
PI (pH):   %s   6.11
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKGECPVKTANVAGAGTRNVDWWPNELRTNILRQHDPRQNPLGPDFDYAEEFKKLDYEALKKDLNALMTDSQDWWPADFGHYGGFFIRLAWHGAGTYRVTDGRGGGGEGQQRFAPLNSWPDNVSLDKARRLLWPIKQKYGNKISYADLMLLAGNVALESMGCPTFGFAAGRTDTFQSDESVYWGGETEWLGNDIRYSKGAKGVKGEGIVDGDQHKVNDKISHEAEDLEKPLAASHMGLIYVNPEGPDGVPDPVAAAHDIRTTFGRMAMNDEETAALIIGGHSFGKTHGAAPSENIGPDPNSEDVAAQGLGWINKHGSGKGPDTITSGLEVTWTGTPTKWSNKYLEYLYKFEWELEKSPAGANQWVAKTDELIIPDAFDPNKKHKPRMLTTDLSMRMDPAYEKITRRWLDHPEELHDAFVRAWFKLLHRDMGPRSRWLGPEVPKEILLWEDPIPEPQGEMIGESDIATLKKQILDAGIEPSKLIRTAWASAASFRGSDKRGGANGARIRLAPQKDWEVNNPKELAEVLKALEGVQSKFNSGSKKVSLADLIVLAGVAALEKASGTSVPFTPGRTDASQEQTDVQSFAHLEPVTDGFRNYGKGNDRVLTEQLDVDKAHLLRLTAPELVVLTGGLRSLNANWDGSSHGVFTKRPGQLSNDFFINLLDQNTEWKAVDNSQPHELYEGKDRKSGQKKWTATRHDLVFGSHPELRAIAETYATADNTDKFVKDFIAAWDKIMNNDRFDLKNKSVSGTSSVSSRPRL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns) and 1 EST. Strain="M1".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAAAGGCGAGTGTCCCGTAAAGACCGCCAATGTCGCCGGCGCCGGTACTAGGAATGTCGACTGGTGGCCAAACGAGCTGAGGACCAACATCCTCCGCCAGCACGATCCCCGCCAA
AACCCTCTCGGCCCCGACTTCGACTATGCGGAGGAGTTCAAGAAGCTCGACTACGAGGCCTTGAAGAAGGATCTCAATGCCTTGATGACCGACTCCCAGGACTGGTGGCCTGCCGACTTT
GGCCACTACGGTGGTTTCTT
GTAAGCAGCATCATCACGCTTCCCATCTCTTGCCTTGCTTGTGCAAATATAAACTAACCGCCCACACACAGCATCCGATTGGCATGGCACGGCGCCGGTA
CCTATCGTGTCACGGATGGCCGTGGTGGAGGTGGCGAAGGACAACAGCGCTTTGCCCCTCTCAACTCATGGCCCGACAATGTCTCGCTTGACAAGGCTCGTCGCCTCTTGTGGCCCATCA
AGCAAAAGTATGGCAACAAGATCTCCTATGCCGACCTCATGCTCCTGGCTGGCAACGTCGCCCTCGAGTCCATGGGTTGCCCCACATTCGGTTTCGCCGCTGGCCGTACCGACACCTTCC
AGTCTGACGAGTCGGTCTACTGGGGAGGCGAGACAGAGTGGCTAGGAAACGATATCCGCTATTCCAAAGGAGCCAAGGGTGTCAAGGGCGAAGGCATCGTCGATGGAGACCAGCACAAGG
TCAACGACAAAATCTCACACGAAGCAGAGGATCTCGAGAAGCCATTGGCTGCCTCGCACATGGGTCTCATTTACGTGAATCCCGAGG
GTGAGTTGTGGGACCCCAACGTCACACACAGAA
ACTTGTGGTCTAACAAGTAGTACAGGTCCCGACGGTGTTCCTGACCCAGTCGCTGCTGCCCACGACATCCGCACAACCTTTGGCCGCATGGCCATGAACGACGAGGAGACAGCTGCCCTC
ATCATTGGTGGCCACTCGTTTGGAAAGACCCACGGCGCGGCCCCATCGGAGAACATTGGCCCAGACCCCAACTCAGAGGACGTTGCAGCACAAGGTCTTGGATGGATCAACAAGCACGGC
AGTGGCAAGGGACCAGACACCATCACCAGTGGTCTTGAAGTCACTTGGACTGGCACCCCCACCAAGTGGAGCAACAAGTACCTCGAGTACCTGTACAAGTTTGAGTGGGAGCTGGAGAAG
TCTCCTGCCGGTGCCAACCAGTGGGTCGCCAAGACGGATGAGTTGATCATCCCCGATGCCTTTGACCCGAACAAGAAGCACAAGCCAAGAATGTTGACCACCGATCTGTCCATGCGCATG
GATCCAGCGTACGAGAAGATTACTCGTCGTTGGTTGGATCATCCAGAGGAGCTCCACGATGCCTTTGTCCGTGCCTGGTTCAAGCTTCTCCACCGTGACATGGGCCCTCGATCCAGGTGG
CTTGGCCCTGAAGTCCCCAAGGAGATCCTCCTCTGGGAAGACCCTATTCCAGAGCCTCAGGGTGAGATGATTGGCGAGTCTGACATTGCCACCCTGAAGAAACAGATTTTGGATGCTGGC
ATCGAGCCATCCAAGCTCATCCGCACAGCCTGGGCTTCGGCAGCCTCTTTCCGTGGCAGCGACAAGCGTGGTGGTGCCAATGGTGCTCGTATCCGCCTCGCGCCCCAGAAGGACTGGGAG
GTCAACAACCCCAAGGAGCTTGCCGAGGTCCTCAAGGCGCTCGAGGGCGTCCAGTCCAAGTTCAACAGCGGCAGCAAGAAGGTCTCGCTTGCCGATCTCATCGTCTTGGCTGGTGTGGCA
GCACTCGAAAAGGCTTCTGGAACCTCGGTGCCCTTCACACCTGGCCGCACCGATGCCAGCCAGGAGCAGACTGATGTCCAGTCGTTTGCCCACCTCGAGCCTGTCACCGATGGTTTCCGC
AACTACGGCAAGGGTAACGACCGTGTCCTCACCGAGCAGCTGGATGTTGACAAGGCCCATCTCTTGCGCCTCACAGCTCCTGAGCTCGTTGTTCTTACCGGTGGTCTTCGCTCGCTGAAC
GCCAACTGGGATGGCTCGTCTCACGGCGTCTTCACCAAGCGCCCCGGCCAGCTCTCCAACGACTTCTTCATCAACCTACTCGATCAAAACACAGAGTGGAAGGCGGTTGACAACAGCCAG
CCACACGAGCTGTACGAGGGCAAGGACCGCAAGTCGGGCCAGAAGAAGTGGACGGCCACCCGGCACGATCTGGTCTTTGGATCGCACCCCGAGCTCCGTGCCATTGCTGAGACGTATGCG
ACGGCGGACAACACAGACAAGTTTGTCAAGGACTTTATCGCTGCGTGGGACAAGATTATGAACAACGACCGATTCGACCTCAAGAACAAGTCGGTGAGTGGCACATCGAGTGTTTCGAGC
AGGCCTCGTCTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAAAGGCGAGTGTCCCGTAAAGACCGCCAATGTCGCCGGCGCCGGTACTAGGAATGTCGACTGGTGGCCAAACGAGCTGAGGACCAACATCCTCCGCCAGCACGATCCCCGCCAA
AACCCTCTCGGCCCCGACTTCGACTATGCGGAGGAGTTCAAGAAGCTCGACTACGAGGCCTTGAAGAAGGATCTCAATGCCTTGATGACCGACTCCCAGGACTGGTGGCCTGCCGACTTT
GGCCACTACGGTGGTTTCTT
CATCCGATTGGCATGGCACGGCGCCGGTACCTATCGTGTCACGGATGGCCGTGGTGGAGGTGGCGAAGGACAACAGCGCTTTGCCCCTCTCAACTCATGG
CCCGACAATGTCTCGCTTGACAAGGCTCGTCGCCTCTTGTGGCCCATCAAGCAAAAGTATGGCAACAAGATCTCCTATGCCGACCTCATGCTCCTGGCTGGCAACGTCGCCCTCGAGTCC
ATGGGTTGCCCCACATTCGGTTTCGCCGCTGGCCGTACCGACACCTTCCAGTCTGACGAGTCGGTCTACTGGGGAGGCGAGACAGAGTGGCTAGGAAACGATATCCGCTATTCCAAAGGA
GCCAAGGGTGTCAAGGGCGAAGGCATCGTCGATGGAGACCAGCACAAGGTCAACGACAAAATCTCACACGAAGCAGAGGATCTCGAGAAGCCATTGGCTGCCTCGCACATGGGTCTCATT
TACGTGAATCCCGAGG
GTCCCGACGGTGTTCCTGACCCAGTCGCTGCTGCCCACGACATCCGCACAACCTTTGGCCGCATGGCCATGAACGACGAGGAGACAGCTGCCCTCATCATTGGT
GGCCACTCGTTTGGAAAGACCCACGGCGCGGCCCCATCGGAGAACATTGGCCCAGACCCCAACTCAGAGGACGTTGCAGCACAAGGTCTTGGATGGATCAACAAGCACGGCAGTGGCAAG
GGACCAGACACCATCACCAGTGGTCTTGAAGTCACTTGGACTGGCACCCCCACCAAGTGGAGCAACAAGTACCTCGAGTACCTGTACAAGTTTGAGTGGGAGCTGGAGAAGTCTCCTGCC
GGTGCCAACCAGTGGGTCGCCAAGACGGATGAGTTGATCATCCCCGATGCCTTTGACCCGAACAAGAAGCACAAGCCAAGAATGTTGACCACCGATCTGTCCATGCGCATGGATCCAGCG
TACGAGAAGATTACTCGTCGTTGGTTGGATCATCCAGAGGAGCTCCACGATGCCTTTGTCCGTGCCTGGTTCAAGCTTCTCCACCGTGACATGGGCCCTCGATCCAGGTGGCTTGGCCCT
GAAGTCCCCAAGGAGATCCTCCTCTGGGAAGACCCTATTCCAGAGCCTCAGGGTGAGATGATTGGCGAGTCTGACATTGCCACCCTGAAGAAACAGATTTTGGATGCTGGCATCGAGCCA
TCCAAGCTCATCCGCACAGCCTGGGCTTCGGCAGCCTCTTTCCGTGGCAGCGACAAGCGTGGTGGTGCCAATGGTGCTCGTATCCGCCTCGCGCCCCAGAAGGACTGGGAGGTCAACAAC
CCCAAGGAGCTTGCCGAGGTCCTCAAGGCGCTCGAGGGCGTCCAGTCCAAGTTCAACAGCGGCAGCAAGAAGGTCTCGCTTGCCGATCTCATCGTCTTGGCTGGTGTGGCAGCACTCGAA
AAGGCTTCTGGAACCTCGGTGCCCTTCACACCTGGCCGCACCGATGCCAGCCAGGAGCAGACTGATGTCCAGTCGTTTGCCCACCTCGAGCCTGTCACCGATGGTTTCCGCAACTACGGC
AAGGGTAACGACCGTGTCCTCACCGAGCAGCTGGATGTTGACAAGGCCCATCTCTTGCGCCTCACAGCTCCTGAGCTCGTTGTTCTTACCGGTGGTCTTCGCTCGCTGAACGCCAACTGG
GATGGCTCGTCTCACGGCGTCTTCACCAAGCGCCCCGGCCAGCTCTCCAACGACTTCTTCATCAACCTACTCGATCAAAACACAGAGTGGAAGGCGGTTGACAACAGCCAGCCACACGAG
CTGTACGAGGGCAAGGACCGCAAGTCGGGCCAGAAGAAGTGGACGGCCACCCGGCACGATCTGGTCTTTGGATCGCACCCCGAGCTCCGTGCCATTGCTGAGACGTATGCGACGGCGGAC
AACACAGACAAGTTTGTCAAGGACTTTATCGCTGCGTGGGACAAGATTATGAACAACGACCGATTCGACCTCAAGAACAAGTCGGTGAGTGGCACATCGAGTGTTTCGAGCAGGCCTCGT
CTTTGA

Retrieve as FASTA