Entry information : NcKat03 (cat-3)
Entry ID 5416
Creation 2007-06-15 (Marcel Zamocky)
Last sequence changes 2007-06-15 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-25 (Catherine Mathe (Scipio))
Peroxidase information: NcKat03 (cat-3)
Name (synonym) NcKat03 (cat-3)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Sordariaceae Neurospora
Organism Neurospora crassa    [TaxId: 5141 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value NcKat03
start..stop
S start..stop
PanKat02 1065 0 6..714 4..722
CgKat02 1033 0 2..714 4..704
CtheKat2 1026 0 10..714 14..722
CthedisKat2 1022 0 18..714 22..722
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3561735..3562019 285 N° 2 3562085..3562287 203 N° 3 3562351..3564022 1672  
join(3561735..3562019,3562085..3562287,3562351..3564022)


exon

Literature and cross-references NcKat03 (cat-3)
Literature REFERENCE 1 Michan S., Lledias F., Baldwin J.D., Natvig D.O., Hansberg W. Regulation and oxidation of two large monofunctional catalases. Free Radic. Biol. Med. 33:521-532(2002);
REFERENCE 2 Galagan J.E., et al. The genome sequence of the filamentous fungus Neurospora crassa. Nature 422:859-868(2003)
Protein ref. UniProtKB:   Q9C169
DNA ref. JGI genome:   supercont10.3 (3561735..3564022)
Protein sequence: NcKat03 (cat-3)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   719 (701)
PWM (Da):   %s   79049.97 (77258.9)  
PI (pH):   %s   6.22 (6.14) Peptide Signal:   %s   cut: 19 range:19-719
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRVNALLPLSGLIGTALAACPFADPSALGRRAEGGEVDARQRLKEVEVDDNGQFMTTDFGGNIEEQFSLKAGGRGSTLLEDFIFRQKLQHFDHERIPERVVHARGAGAHGIFTSYGDWSNITAASFLGAKDKQTPVFVRFSTVAGSRGSADTARDVHGFATRFYTDEGNFDIVGNNIPVFFIQDAIRFPDLIHSVKPSPDNEVPQAATAHDSAWDFFSSQPSALHTLFWAMSGNGIPRSYRHMDGFGIHTFRLVTEDGKSKLVKWHWKTKQGKAALVWEEAQVLAGKNADFHRQDLWDAIESGNAPSWELAVQLIDEDKAQAYGFDLLDPTKFLPEEFAPLQVLGEMTLNRNPMNYFAETEQISFQPGHIVRGVDFTEDPLLQGRLYSYLDTQLNRHRGPNFEQLPINRPVSGVHNNHRDGQGQAWIHKNIHHYSPSYLNKGYPAQANQTVGRGFFTTPGRTASGVLNRELSATFDDHYTQPRLFFNSLTPVEQQFVINAIRFEASHVTNEQVKKNVLEQLNKISNDVAKRVAVALGLEAPQPDPTYYHNNVTRGVSIFNESLPTIATLRVGVLSTTKGGSLDKAKALKEQLEKDGLKVTVIAEYLASGVDQTYSAADATAFDAVVVAEGAERVFSGKGAMSPLFPAGRPSQILTDGYRWGKPVAAVGSAKKALQSIGVEEKEAGVYAGAQDEVIKGVEEGLKVFKFLERFAVDGDDEE

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo III, 2 introns). No EST. Strain="ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTGTCAACGCTCTTCTACCGTTGAGCGGCCTTATTGGCACTGCTCTAGCGGCATGCCCCTTTGCCGACCCTTCTGCTCTTGGTCGCCGTGCCGAGGGCGGTGAGGTTGACGCCCGT
CAGAGGTTGAAGGAGGTTGAGGTTGACGACAACGGCCAATTCATGACAACAGATTTCGGCGGCAACATTGAGGAACAGTTCAGTCTGAAGGCTGGTGGCCGGGGCTCGACATTGCTTGAG
GACTTCATCTTCCGTCAGAAGCTCCAGCACTTCGACCATGAGCGC
GTATGTCTTCCCTGCCATGGCCCAATTAGCATCAAGAATCCTAGCTAACGAAAGTTTGATACCAGATTCCCGAGA
GAGTCGTTCATGCCCGTGGTGCCGGTGCCCACGGTATCTTCACCAGTTATGGCGACTGGTCCAACATCACCGCCGCCTCCTTCCTGGGCGCCAAGGACAAGCAAACACCGGTCTTCGTCC
GCTTCTCTACCGTTGCCGGTTCCAGGGGTTCCGCCGACACTGCCCGTGATGTTCACGGCTTCGCCACGAGATT
GTATGTTGACCACGTAACAACCCTTCCCTTCACCTCTTCAGCAGGGC
GTTAACTTGACTCCAGCTATACCGACGAGGGCAACTTTGATATCGTCGGCAACAACATTCCCGTCTTTTTCATCCAGGATGCCATCCGCTTCCCCGACCTTATTCACTCCGTCAAGCCTA
GCCCCGACAATGAGGTTCCCCAAGCCGCCACCGCCCACGACTCCGCTTGGGACTTCTTCAGCTCCCAGCCCTCCGCTCTCCACACCCTCTTCTGGGCCATGTCTGGCAACGGTATTCCCC
GCAGCTACCGTCATATGGATGGTTTCGGTATCCATACCTTCCGTCTGGTGACCGAGGACGGCAAGTCCAAGCTCGTCAAGTGGCATTGGAAGACGAAACAGGGAAAGGCCGCTCTCGTCT
GGGAGGAGGCTCAAGTCCTCGCCGGCAAGAACGCCGACTTCCACCGTCAGGATCTCTGGGACGCTATCGAGTCCGGAAACGCCCCTTCATGGGAGCTCGCCGTTCAGCTTATTGACGAGG
ACAAGGCCCAGGCTTACGGCTTCGACCTTCTTGATCCCACCAAGTTCCTTCCCGAGGAGTTCGCCCCTCTCCAGGTTCTCGGTGAGATGACCCTCAACCGCAACCCTATGAACTACTTCG
CCGAGACCGAGCAGATCTCCTTCCAGCCCGGCCACATTGTTCGCGGCGTCGACTTCACCGAGGATCCCCTGCTGCAGGGTCGTCTCTACAGCTACCTCGACACCCAGCTCAACCGCCACA
GGGGCCCCAACTTTGAGCAGCTCCCCATCAACCGCCCTGTCTCTGGCGTCCACAACAACCACCGCGACGGTCAAGGCCAGGCTTGGATCCACAAGAACATCCACCACTACAGCCCGTCTT
ACCTCAACAAGGGCTACCCTGCCCAGGCCAACCAGACCGTCGGCCGCGGCTTCTTCACTACCCCCGGCCGCACCGCGTCTGGCGTCCTGAACCGCGAGCTCAGCGCCACCTTTGACGACC
ACTACACCCAGCCCCGGCTCTTCTTCAACTCGCTCACCCCCGTCGAGCAGCAGTTCGTCATCAACGCGATCCGCTTCGAGGCCAGCCACGTCACCAACGAGCAGGTCAAGAAGAACGTTC
TCGAGCAGCTTAACAAGATCTCCAACGACGTGGCCAAGCGCGTGGCCGTTGCGCTCGGCCTCGAGGCGCCCCAGCCCGACCCGACCTACTACCACAACAATGTCACCCGCGGCGTTTCCA
TCTTCAACGAGAGCCTCCCCACCATCGCCACCCTCCGCGTCGGCGTCCTCTCCACCACCAAGGGCGGCTCCCTCGACAAGGCCAAGGCCCTCAAGGAGCAGCTCGAGAAGGACGGCCTCA
AGGTCACCGTCATCGCCGAGTACCTTGCCAGCGGTGTCGACCAGACCTACTCCGCTGCCGACGCCACCGCCTTCGATGCCGTTGTCGTGGCCGAGGGCGCTGAGCGCGTCTTCAGCGGCA
AGGGCGCCATGAGCCCTCTTTTCCCTGCTGGCCGTCCTAGCCAGATTCTTACTGATGGTTACCGCTGGGGTAAGCCCGTTGCTGCCGTCGGCAGCGCCAAGAAGGCGCTCCAGAGCATCG
GGGTAGAGGAGAAGGAGGCCGGTGTTTATGCCGGTGCTCAGGACGAGGTTATCAAGGGCGTCGAGGAGGGCCTCAAGGTGTTCAAGTTCCTTGAGCGTTTCGCCGTTGATGGCGATGATG
AGGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTGTCAACGCTCTTCTACCGTTGAGCGGCCTTATTGGCACTGCTCTAGCGGCATGCCCCTTTGCCGACCCTTCTGCTCTTGGTCGCCGTGCCGAGGGCGGTGAGGTTGACGCCCGT
CAGAGGTTGAAGGAGGTTGAGGTTGACGACAACGGCCAATTCATGACAACAGATTTCGGCGGCAACATTGAGGAACAGTTCAGTCTGAAGGCTGGTGGCCGGGGCTCGACATTGCTTGAG
GACTTCATCTTCCGTCAGAAGCTCCAGCACTTCGACCATGAGCGC
ATTCCCGAGAGAGTCGTTCATGCCCGTGGTGCCGGTGCCCACGGTATCTTCACCAGTTATGGCGACTGGTCCAAC
ATCACCGCCGCCTCCTTCCTGGGCGCCAAGGACAAGCAAACACCGGTCTTCGTCCGCTTCTCTACCGTTGCCGGTTCCAGGGGTTCCGCCGACACTGCCCGTGATGTTCACGGCTTCGCC
ACGAGATT
CTATACCGACGAGGGCAACTTTGATATCGTCGGCAACAACATTCCCGTCTTTTTCATCCAGGATGCCATCCGCTTCCCCGACCTTATTCACTCCGTCAAGCCTAGCCCCGAC
AATGAGGTTCCCCAAGCCGCCACCGCCCACGACTCCGCTTGGGACTTCTTCAGCTCCCAGCCCTCCGCTCTCCACACCCTCTTCTGGGCCATGTCTGGCAACGGTATTCCCCGCAGCTAC
CGTCATATGGATGGTTTCGGTATCCATACCTTCCGTCTGGTGACCGAGGACGGCAAGTCCAAGCTCGTCAAGTGGCATTGGAAGACGAAACAGGGAAAGGCCGCTCTCGTCTGGGAGGAG
GCTCAAGTCCTCGCCGGCAAGAACGCCGACTTCCACCGTCAGGATCTCTGGGACGCTATCGAGTCCGGAAACGCCCCTTCATGGGAGCTCGCCGTTCAGCTTATTGACGAGGACAAGGCC
CAGGCTTACGGCTTCGACCTTCTTGATCCCACCAAGTTCCTTCCCGAGGAGTTCGCCCCTCTCCAGGTTCTCGGTGAGATGACCCTCAACCGCAACCCTATGAACTACTTCGCCGAGACC
GAGCAGATCTCCTTCCAGCCCGGCCACATTGTTCGCGGCGTCGACTTCACCGAGGATCCCCTGCTGCAGGGTCGTCTCTACAGCTACCTCGACACCCAGCTCAACCGCCACAGGGGCCCC
AACTTTGAGCAGCTCCCCATCAACCGCCCTGTCTCTGGCGTCCACAACAACCACCGCGACGGTCAAGGCCAGGCTTGGATCCACAAGAACATCCACCACTACAGCCCGTCTTACCTCAAC
AAGGGCTACCCTGCCCAGGCCAACCAGACCGTCGGCCGCGGCTTCTTCACTACCCCCGGCCGCACCGCGTCTGGCGTCCTGAACCGCGAGCTCAGCGCCACCTTTGACGACCACTACACC
CAGCCCCGGCTCTTCTTCAACTCGCTCACCCCCGTCGAGCAGCAGTTCGTCATCAACGCGATCCGCTTCGAGGCCAGCCACGTCACCAACGAGCAGGTCAAGAAGAACGTTCTCGAGCAG
CTTAACAAGATCTCCAACGACGTGGCCAAGCGCGTGGCCGTTGCGCTCGGCCTCGAGGCGCCCCAGCCCGACCCGACCTACTACCACAACAATGTCACCCGCGGCGTTTCCATCTTCAAC
GAGAGCCTCCCCACCATCGCCACCCTCCGCGTCGGCGTCCTCTCCACCACCAAGGGCGGCTCCCTCGACAAGGCCAAGGCCCTCAAGGAGCAGCTCGAGAAGGACGGCCTCAAGGTCACC
GTCATCGCCGAGTACCTTGCCAGCGGTGTCGACCAGACCTACTCCGCTGCCGACGCCACCGCCTTCGATGCCGTTGTCGTGGCCGAGGGCGCTGAGCGCGTCTTCAGCGGCAAGGGCGCC
ATGAGCCCTCTTTTCCCTGCTGGCCGTCCTAGCCAGATTCTTACTGATGGTTACCGCTGGGGTAAGCCCGTTGCTGCCGTCGGCAGCGCCAAGAAGGCGCTCCAGAGCATCGGGGTAGAG
GAGAAGGAGGCCGGTGTTTATGCCGGTGCTCAGGACGAGGTTATCAAGGGCGTCGAGGAGGGCCTCAAGGTGTTCAAGTTCCTTGAGCGTTTCGCCGTTGATGGCGATGATGAGGAGTAA

Retrieve as FASTA