Entry information : GmPrx[P]49
Entry ID 544
Creation 2011-11-10 (Qiang Li (Scipio))
Last sequence changes 2011-12-14 (Qiang Li)
Sequence status theoretical translation / pseudogene
Reviewer Not yet reviewed
Last annotation changes 2011-11-28 (Qiang Li)
Peroxidase information: GmPrx[P]49
Name GmPrx[P]49
Class Class III peroxidase     [Orthogroup: Prx006]*
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Cotyledons
Immature seed coats
Somatic embryos
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx[P]49
start..stop
S start..stop
GmPrx35 322 3e-112 1..191 1..197
PvPrx11 301 6e-104 1..191 1..197
GmPrx02 295 7e-102 1..191 1..193
VuPrx01 293 5e-101 1..191 1..196
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 9031419..9031633 215 N° 2 9031113..9031298 186 N° 3 9030655..9030825 171  
complement(join(9030655..9030825,9031113..9031298,9031419..9031633))


exon

Literature and cross-references GmPrx[P]49
DNA ref. Phytozome 11:   Gm04 (9031633..9030655)
Protein sequence: GmPrx[P]49
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   190 (166)
PWM (Da):   %s   21040.19 (18645.8)  
PI (pH):   %s   8.76 (8.50) Peptide Signal:   %s   cut: 25 range:25-190
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPKGLTFLVVLI*VSALSLSPSVAEEGQDNGLxSCPQAEDIITEQVKLLYKRHKNTTFSWLRNIFHDCVVQSCDASLLLDSTRRSLSEKETNKNFESRNFRYIETIKEALERECPRVVSCADILVLSTRDGIVQLRGPHILLKTGRKDGRKSKTNVVELFRPNHNKSIFVVLDKFGAIGIDTPSIVALLG

Retrieve as FASTA  
Remarks Pseudogene from genomic. Incorrect prediction from phytozome (Stop in frame, frame shifts and last exon is missing => not found). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTCCCAAGGGTTTAACCTTTTTGGTTGTGTTAATATGAGTTTCAGCACTGTCACTGAGTCCTTCTGTTGCGGAGGAAGGGCAAGATAATGGCCTTAANTCATGCCCTCAGGCTGAAG
ACATCATCACAGAACAAGTCAAGCTTCTCTACAAGCGCCACAAGAACACTACTTTCTCCTGGCTCAGAAACATCTTCCATGATTGTGTTGTTCAG
GTAATTAAGCTTGGTTTTTGTTCTG
TGTTTGCAAGGTGCATGTTCGTCATTCTTTTTTGTCAGTTAATTTTTTATATATGAAAGTATTTGTTCTTTACTTCTTTTTTTGTGTGAGGGTAGAGTTGTGATGCTTCACTATTACTGG
ACTCCACAAGAAGGAGCTTGTCTGAGAAGGAAACAAATAAAAACTTTGAGTCGAGAAATTTTAGGTACATTGAGACCATCAAAGAAGCTTTGGAAAGAGAATGCCCAAGAGTTGTTTCCT
GTGCTGATATCCTCGTTCTCTCTACCAGAGATGGCATTGTT
TTGATAATTTACTCCTCCCAGCTTGTCCCTTTCTTTTTTGTTCTGTTCTGTTTCCTACTAGATCTGTTTTGTTTCCTCT
TTTAACAAAGTTCCCTTTTGAAAGTTAATTAATTAAAGTCCATGTACATATACCCTGTCCATAATTCTAGAAAGATCAATCTATTTTTAGTGTGGGGATAAGTAGTTGGAGACTTATTTG
GTCTAGATTTGTTTTAGCAATTAACTGCTTTAATAGTTTATCTGTTAATTATTCTTATAATGAATGAATTAATTTGATGTGTTGCATGCAACTACGAGGTCCCCATATCCTTCTTAAAAC
TGGAAGAAAGGATGGTAGAAAGAGCAAAACTAATGTGGTTGAGCTGTTCCGCCCAAATCACAATAAGTCTATTTTTGTAGTTCTTGACAAGTTTGGTGCCATAGGAATTGACACCCCCAG
CATCGTCGCATTACTTGGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTCCCAAGGGTTTAACCTTTTTGGTTGTGTTAATATGAGTTTCAGCACTGTCACTGAGTCCTTCTGTTGCGGAGGAAGGGCAAGATAATGGCCTTAANTCATGCCCTCAGGCTGAAG
ACATCATCACAGAACAAGTCAAGCTTCTCTACAAGCGCCACAAGAACACTACTTTCTCCTGGCTCAGAAACATCTTCCATGATTGTGTTGTTCAG
AGTTGTGATGCTTCACTATTACTGG
ACTCCACAAGAAGGAGCTTGTCTGAGAAGGAAACAAATAAAAACTTTGAGTCGAGAAATTTTAGGTACATTGAGACCATCAAAGAAGCTTTGGAAAGAGAATGCCCAAGAGTTGTTTCCT
GTGCTGATATCCTCGTTCTCTCTACCAGAGATGGCATTGTT
CAACTACGAGGTCCCCATATCCTTCTTAAAACTGGAAGAAAGGATGGTAGAAAGAGCAAAACTAATGTGGTTGAGCTGT
TCCGCCCAAATCACAATAAGTCTATTTTTGTAGTTCTTGACAAGTTTGGTGCCATAGGAATTGACACCCCCAGCATCGTCGCATTACTTGGT

Retrieve as FASTA