Entry information : HjCP02
Entry ID 5459
Creation 2007-06-22 (Marcel Zamocky)
Last sequence changes 2011-05-20 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: HjCP02
Name HjCP02
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Hypocrea
Organism Hypocrea jecorina (Trichoderma reesei)    [TaxId: 51453 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HjCP02
start..stop
S start..stop
TharCP02 1444 0 1..792 1..793
TviCP02 1439 0 1..792 1..793
TatCP02 1378 0 1..792 1..794
TaspCP01 1368 0 1..792 1..795
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 68392..68713 322 N° 2 68778..69005 228 N° 3 69077..69661 585 N° 4 69725..69967 243
N° 5 70025..70350 326 N° 6 70413..70602 190 N° 7 70675..71159 485  
join(68392..68713,68778..69005,69077..69661,69725..69967,70025..70350,70413..706 02,70675..71159)


exon

Literature and cross-references HjCP02
Literature Martinez,D., Rokhsar,D., Putnam,N., Grigoriev,I., Salamov,A., Bristow,J., Rubin,E., Lucas,S., Hammon,N., Israni,S., Glavina,T., Detter,C. and Richardson,P. The Genome of Trichoderma reesei QM6a.
DNA ref. JGI genome:   scaffold_41 (68392..71159)
Protein sequence: HjCP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   792 (774)
PWM (Da):   %s   85581.09 (83792.0)  
PI (pH):   %s   6.45 (6.28) Peptide Signal:   %s   cut: 19 range:19-792
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPLKNLLAIAGTLPLATAIGCPHINGNGNANVNIARAHPESILEKRFSPDGPDFGTCPRKSTVAGGGTRSRQWWPCELNLGVLRQFSEKSNPLGSDFDYASAFGKIDVAQLKKDITAVQTTSQDWWPADFGDYGPFFIRLAWHNAGTYRAVDGRGGAGQGQQRFAPLNSWPDNANLDKARRLLWPIKQKYGSALSWADLFVFAGNTAMENMGFPTYGFGFGREDTWQSDEGIYWGGEQEMFPEALNNVVRYNGSTDFTERADKLESPLGAVSMGLIYVDPRGPNGQPDTRASALDIRETFGRMGMNDEETVALIAGGHAFGKTHGAVTGDNIGPEPNAAGIELQGLGWKNSFGSGNADNAYTSGLEVIWSRTPTKWANEFLFSLLNNNFTLTKSPDGAPQWEALDANASYPDPFIKGKFRRPTMLTSDLGLRDDPIYNNISRTFLNDFDYFTEKFGLAWYKLLHRDMGPIARYLGPEVPKKAPLIWQDPLPTPAYTTLAASDISSLKQQILAAPGLNVSNLVTTAWGSASTFRISDKRGGANGARIALQPQVNFAANNPPRLQAVLKLKGVQTKFQSSGKKVSLADLIVLGGVAAIEKAAKAAGLTLTVPFTPGRVDATQDQTDASTFAFLEPKADGFRNFGHGTASSLTEEILVDKAALLTLSPPELTVLIGGMRALSANFDGSSTGVLTSRPGQLTNDFFVNLLGSYSTWSVVNGTNEELFQSKDSNGKVQWTASRSDLIFGSHPELRALAEVYGSSDAKTKFANDFVAAWAKVMDLDRYDVKGHKGAY

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns). No EST. Strain="QM6a".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCTCAAGAACCTCCTGGCCATTGCCGGCACGCTGCCGCTCGCCACGGCCATTGGCTGCCCTCACATCAACGGCAACGGCAATGCCAACGTCAATATCGCTCGAGCCCATCCCGAG
TCCATCTTGGAGAAGAGGTTCAGCCCGGACGGCCCCGACTTCGGCACGTGCCCTCGCAAGAGCACCGTTGCTGGAGGAGGCACGCGCAGCAGGCAGTGGTGGCCCTGCGAACTGAACCTC
GGGGTACTCCGCCAGTTTTCCGAGAAGTCGAATCCCTTGGGCTCCGACTTTGACTATGCCTCTGCCTTTGGCAAGATTGATG
GTATGTTATGTTGAGCGACTTGTCAGTGGGATTATACA
AGGCCAAGCGCTGATATCAAGGACAGTCGCCCAGCTCAAGAAGGACATCACCGCCGTCCAGACCACTTCCCAGGACTGGTGGCCTGCCGACTTTGGCGACTATGGCCCGTTCTTCATCCG
TCTAGCATGGCACAACGCGGGTACCTACCGCGCCGTTGACGGACGCGGAGGAGCCGGTCAGGGCCAGCAGCGATTTGCTCCCCTCAACAGCTGGCCGGACAATGCCAACCTGGACAAGGC
TCGTCGTCTGCTTT
GTAAGTCAGATCCAGGGACTGCTGTCAGCCCAATCTGGGGCCATGTCTTGCTAATCAACCTATCATGGTAGGGCCCATCAAGCAAAAGTACGGCAGCGCCCTCTCG
TGGGCCGACCTGTTCGTCTTTGCCGGCAACACTGCCATGGAGAACATGGGCTTCCCCACGTACGGCTTTGGCTTTGGTCGCGAGGATACCTGGCAGTCAGACGAGGGCATCTACTGGGGT
GGCGAGCAGGAGATGTTCCCCGAGGCGCTCAACAACGTGGTCCGCTACAACGGAAGCACAGACTTCACTGAGCGAGCGGACAAACTCGAGAGCCCACTGGGAGCCGTCAGCATGGGTCTC
ATCTACGTCGATCCTCGCGGGCCCAATGGCCAGCCGGATACCCGTGCGAGTGCTTTGGACATTCGTGAGACATTTGGGCGCATGGGCATGAACGACGAGGAGACCGTCGCCCTCATCGCT
GGTGGCCACGCCTTTGGCAAGACCCACGGCGCTGTGACGGGAGACAACATTGGTCCTGAGCCCAACGCTGCCGGCATTGAGCTGCAGGGTCTTGGCTGGAAGAACAGCTTTGGCAGTGGA
AACGCCGACAACGCCTACACTTCGGGTCTTGAGGTCATCTGGTCCCGCACTCCCACCAAGTGGGCAAATG
GTGAGTTACCCTCTTGTCCCTTTTGCTCTCTCTCGCATTCCTGTTGCTGA
CTATGTCTCGCAGAATTCCTCTTCTCCCTGCTCAACAACAACTTCACCCTCACCAAGTCCCCCGATGGTGCCCCTCAGTGGGAGGCTCTCGATGCCAACGCATCTTACCCCGACCCCTTC
ATCAAGGGCAAGTTCCGCCGGCCCACGATGCTGACCTCCGACTTGGGTCTCCGTGATGACCCCATCTACAACAACATCTCCAGGACGTTCCTCAACGACTTTGACTACTTTACCGAGAAG
TTTGGCCTTGCCTGGT
GTAAGTCAGCGTGCTACCCTACCTTATGATGTATGCCCCAGCTGACCCCTGATCCAGACAAGCTGCTGCACCGTGACATGGGTCCCATCGCCCGCTACCTCGGC
CCCGAGGTCCCCAAGAAGGCACCCCTCATTTGGCAGGACCCTCTCCCGACGCCGGCTTACACCACTCTGGCTGCTTCGGACATTTCCTCGCTGAAGCAGCAGATTCTCGCCGCCCCCGGC
CTCAACGTCTCCAACCTGGTCACCACTGCCTGGGGCTCTGCATCGACCTTCCGTATCTCTGACAAGCGCGGTGGTGCCAACGGAGCTCGCATTGCTCTCCAGCCCCAGGTCAACTTTGCT
GCCAACAACCCTCCACGCCTGCAGGCTGTCCTCAAGGCC
GTAAGTAACAGTACCACACCAGCTACATGTGCTTATGCTAACAACTACTTCTCCGGCTATAGCTCAAGGGTGTCCAGACCA
AGTTCCAGTCCAGCGGCAAGAAGGTGTCTCTGGCTGATCTCATTGTCCTCGGCGGTGTCGCTGCCATTGAGAAGGCTGCCAAGGCCGCTGGGCTCACCCTCACCGTGCCCTTTACCCCTG
GTCGTGTTGATGCCACCCAAGATCAGACCGATGCCTCCACCTTTGCGTTCC
GTGCGTCCACCCCCCTACGCCCCGATGACCCTCGCAGTTGTGTCGCATTTGCTAACCTTTATATTCCTG
CAGTCGAGCCCAAGGCTGACGGTTTCCGCAACTTCGGCCACGGCACAGCTTCGTCGCTGACTGAGGAGATCCTTGTGGACAAGGCTGCCCTCCTTACCCTGAGCCCCCCCGAACTGACGG
TTCTCATTGGTGGCATGCGCGCCCTCTCTGCCAACTTTGACGGCTCCTCCACCGGCGTCCTGACTTCTCGCCCCGGCCAGCTCACCAACGACTTCTTCGTCAACCTGCTGGGCTCCTACT
CGACCTGGTCCGTTGTCAACGGCACCAACGAGGAGCTGTTCCAGAGCAAGGACTCGAACGGCAAGGTCCAGTGGACCGCCTCCCGCTCTGATCTCATTTTTGGCTCCCACCCTGAGCTGC
GTGCCCTTGCTGAGGTCTACGGCTCTTCTGACGCTAAGACCAAGTTTGCCAATGACTTTGTCGCCGCATGGGCAAAGGTCATGGACCTGGACCGCTATGATGTCAAGGGACATAAGGGTG
CCTACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCTCAAGAACCTCCTGGCCATTGCCGGCACGCTGCCGCTCGCCACGGCCATTGGCTGCCCTCACATCAACGGCAACGGCAATGCCAACGTCAATATCGCTCGAGCCCATCCCGAG
TCCATCTTGGAGAAGAGGTTCAGCCCGGACGGCCCCGACTTCGGCACGTGCCCTCGCAAGAGCACCGTTGCTGGAGGAGGCACGCGCAGCAGGCAGTGGTGGCCCTGCGAACTGAACCTC
GGGGTACTCCGCCAGTTTTCCGAGAAGTCGAATCCCTTGGGCTCCGACTTTGACTATGCCTCTGCCTTTGGCAAGATTGATG
TCGCCCAGCTCAAGAAGGACATCACCGCCGTCCAGACC
ACTTCCCAGGACTGGTGGCCTGCCGACTTTGGCGACTATGGCCCGTTCTTCATCCGTCTAGCATGGCACAACGCGGGTACCTACCGCGCCGTTGACGGACGCGGAGGAGCCGGTCAGGGC
CAGCAGCGATTTGCTCCCCTCAACAGCTGGCCGGACAATGCCAACCTGGACAAGGCTCGTCGTCTGCTTT
GGCCCATCAAGCAAAAGTACGGCAGCGCCCTCTCGTGGGCCGACCTGTTC
GTCTTTGCCGGCAACACTGCCATGGAGAACATGGGCTTCCCCACGTACGGCTTTGGCTTTGGTCGCGAGGATACCTGGCAGTCAGACGAGGGCATCTACTGGGGTGGCGAGCAGGAGATG
TTCCCCGAGGCGCTCAACAACGTGGTCCGCTACAACGGAAGCACAGACTTCACTGAGCGAGCGGACAAACTCGAGAGCCCACTGGGAGCCGTCAGCATGGGTCTCATCTACGTCGATCCT
CGCGGGCCCAATGGCCAGCCGGATACCCGTGCGAGTGCTTTGGACATTCGTGAGACATTTGGGCGCATGGGCATGAACGACGAGGAGACCGTCGCCCTCATCGCTGGTGGCCACGCCTTT
GGCAAGACCCACGGCGCTGTGACGGGAGACAACATTGGTCCTGAGCCCAACGCTGCCGGCATTGAGCTGCAGGGTCTTGGCTGGAAGAACAGCTTTGGCAGTGGAAACGCCGACAACGCC
TACACTTCGGGTCTTGAGGTCATCTGGTCCCGCACTCCCACCAAGTGGGCAAATG
AATTCCTCTTCTCCCTGCTCAACAACAACTTCACCCTCACCAAGTCCCCCGATGGTGCCCCTCAG
TGGGAGGCTCTCGATGCCAACGCATCTTACCCCGACCCCTTCATCAAGGGCAAGTTCCGCCGGCCCACGATGCTGACCTCCGACTTGGGTCTCCGTGATGACCCCATCTACAACAACATC
TCCAGGACGTTCCTCAACGACTTTGACTACTTTACCGAGAAGTTTGGCCTTGCCTGGT
ACAAGCTGCTGCACCGTGACATGGGTCCCATCGCCCGCTACCTCGGCCCCGAGGTCCCCAAG
AAGGCACCCCTCATTTGGCAGGACCCTCTCCCGACGCCGGCTTACACCACTCTGGCTGCTTCGGACATTTCCTCGCTGAAGCAGCAGATTCTCGCCGCCCCCGGCCTCAACGTCTCCAAC
CTGGTCACCACTGCCTGGGGCTCTGCATCGACCTTCCGTATCTCTGACAAGCGCGGTGGTGCCAACGGAGCTCGCATTGCTCTCCAGCCCCAGGTCAACTTTGCTGCCAACAACCCTCCA
CGCCTGCAGGCTGTCCTCAAGGCC
CTCAAGGGTGTCCAGACCAAGTTCCAGTCCAGCGGCAAGAAGGTGTCTCTGGCTGATCTCATTGTCCTCGGCGGTGTCGCTGCCATTGAGAAGGCT
GCCAAGGCCGCTGGGCTCACCCTCACCGTGCCCTTTACCCCTGGTCGTGTTGATGCCACCCAAGATCAGACCGATGCCTCCACCTTTGCGTTCC
TCGAGCCCAAGGCTGACGGTTTCCGC
AACTTCGGCCACGGCACAGCTTCGTCGCTGACTGAGGAGATCCTTGTGGACAAGGCTGCCCTCCTTACCCTGAGCCCCCCCGAACTGACGGTTCTCATTGGTGGCATGCGCGCCCTCTCT
GCCAACTTTGACGGCTCCTCCACCGGCGTCCTGACTTCTCGCCCCGGCCAGCTCACCAACGACTTCTTCGTCAACCTGCTGGGCTCCTACTCGACCTGGTCCGTTGTCAACGGCACCAAC
GAGGAGCTGTTCCAGAGCAAGGACTCGAACGGCAAGGTCCAGTGGACCGCCTCCCGCTCTGATCTCATTTTTGGCTCCCACCCTGAGCTGCGTGCCCTTGCTGAGGTCTACGGCTCTTCT
GACGCTAAGACCAAGTTTGCCAATGACTTTGTCGCCGCATGGGCAAAGGTCATGGACCTGGACCGCTATGATGTCAAGGGACATAAGGGTGCCTACTAA

Retrieve as FASTA