Entry information : GmPrx53 (Glyma20g31190.1)
Entry ID 548
Creation 2005-06-21 (Christophe Dunand)
Last sequence changes 2011-10-12 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx53 (Glyma20g31190.1)
Name (synonym) GmPrx53 (Glyma20g31190.1)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type Etiolated hypocotyls
Inducers Pathogen interaction
Phytophthora infection
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx53
start..stop
S start..stop
GmPrx197 632 0 1..323 1..323
GmPrx209 582 0 1..323 1..323
MtPrx110 568 0 1..323 1..321
MtPrx76 561 0 1..323 1..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 39845684..39845899 216 N° 2 39846012..39846203 192 N° 3 39846315..39846480 166 N° 4 39846575..39846972 398
join(39845684..39845899,39846012..39846203,39846315..39846480,39846575..39846972 )


exon

Literature and cross-references GmPrx53 (Glyma20g31190.1)
Literature Public Soybean EST Project. Vodkin,L Functional Genomics Program for Soybean.
DNA ref. Phytozome 11:   Gm20 (39845684..39846972)
Protein sequence: GmPrx53 (Glyma20g31190.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (298)
PWM (Da):   %s   34498.21 (31828.8)  
PI (pH):   %s   7.22 (7.25) Peptide Signal:   %s   cut: 26 range:26-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAYRTSSITSLFVTLVLLGTILCDAQLSSTFYDSACPNALSTIRSVIRSAVSAERRMAASLIRLHFHDCFVQGCDASILLDDSSTIESEKSALQNANSIRGYNIIDQAKSEVEKVCPGVVSCADIVAVAARDASFAVGGPSWTVKLGRRDSTTASKSSATSDLPRFTDDLDTLISKFNNKGLTARDMVTLSGAHTIGQAQCFTFRGRIYNNASDIDAGFASTRQRGCPSVSNDDNDKKLAALDLVTPNSFDNNYFKNLIQKKGLLQSDQVLFSGGSTDSIVSEYSKNPTTFKSDFAAAMIKMGDIEPLTGSAGMIRKICSSVN

Retrieve as FASTA  
Remarks Complete sequence from genomic and 5 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTATAGAACTTCAAGTATCACAAGTTTGTTCGTGACATTGGTGCTGTTAGGCACGATATTATGTGATGCACAATTGTCTTCTACGTTTTATGACAGTGCATGCCCCAATGCACTT
AGCACCATAAGATCTGTCATTCGTAGTGCAGTTTCTGCGGAGCGCCGCATGGCTGCTTCTCTCATTCGCCTTCATTTTCACGATTGCTTCGTTCAG
GTACATATGTGTTGATTTATTAAT
TTCATTTTTTGCATGCATGCATGATGCATGTACTTAACTTGATTAATCCATCTTAATTTGAACCATATATATGTGCAATGCATTGCAGGGTTGTGATGCATCAATATTGCTTGATGATAG
CTCCACTATCGAGAGCGAAAAGAGTGCACTTCAGAATGCTAACTCAATAAGGGGATATAACATCATCGACCAAGCAAAATCTGAGGTGGAGAAAGTATGTCCCGGGGTTGTGTCATGCGC
TGACATTGTAGCAGTAGCAGCACGTGATGCATCATTTGCC
GTAAGTCACAGTAACAAACTAACTAGCTATATATATACGTTAATTTCAACTTAATAATTAACATGCAGAAGCTATATAAT
GAGTTATGCATTTATTTTAATTATTGATTAGGTGGGTGGTCCATCATGGACTGTGAAGCTTGGACGAAGAGATTCTACCACTGCAAGCAAAAGTTCGGCTACTAGTGACCTTCCACGATT
CACAGACGATCTTGACACTCTTATCTCTAAATTCAATAATAAGGGTCTCACTGCCAGAGACATGGTTACTCTATCCG
GTAATTGCTTAATCATCAAGCTTCTCAATTTTGTATTTATAAA
TTTTAAGTGTGAGACATTTATTAAGCAAATATATATCATGAAAACATGCAGGTGCCCACACAATCGGACAAGCTCAATGCTTCACATTTCGTGGAAGGATATACAATAATGCAAGTGACA
TTGATGCAGGATTTGCTAGCACTCGTCAACGTGGTTGTCCATCCGTCAGTAATGATGATAATGATAAGAAATTGGCTGCACTAGACTTGGTCACACCCAATTCATTTGACAACAACTACT
TCAAGAATTTGATTCAGAAGAAGGGTCTTCTTCAATCAGACCAAGTTCTGTTTAGTGGAGGATCTACAGATTCTATTGTCTCCGAATACAGCAAAAATCCTACAACCTTTAAATCCGACT
TCGCAGCTGCTATGATAAAAATGGGAGATATTGAACCATTAACTGGTTCAGCTGGAATGATAAGAAAGATTTGCAGTTCTGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTATAGAACTTCAAGTATCACAAGTTTGTTCGTGACATTGGTGCTGTTAGGCACGATATTATGTGATGCACAATTGTCTTCTACGTTTTATGACAGTGCATGCCCCAATGCACTT
AGCACCATAAGATCTGTCATTCGTAGTGCAGTTTCTGCGGAGCGCCGCATGGCTGCTTCTCTCATTCGCCTTCATTTTCACGATTGCTTCGTTCAG
GGTTGTGATGCATCAATATTGCTT
GATGATAGCTCCACTATCGAGAGCGAAAAGAGTGCACTTCAGAATGCTAACTCAATAAGGGGATATAACATCATCGACCAAGCAAAATCTGAGGTGGAGAAAGTATGTCCCGGGGTTGTG
TCATGCGCTGACATTGTAGCAGTAGCAGCACGTGATGCATCATTTGCC
GTGGGTGGTCCATCATGGACTGTGAAGCTTGGACGAAGAGATTCTACCACTGCAAGCAAAAGTTCGGCTACT
AGTGACCTTCCACGATTCACAGACGATCTTGACACTCTTATCTCTAAATTCAATAATAAGGGTCTCACTGCCAGAGACATGGTTACTCTATCCG
GTGCCCACACAATCGGACAAGCTCAA
TGCTTCACATTTCGTGGAAGGATATACAATAATGCAAGTGACATTGATGCAGGATTTGCTAGCACTCGTCAACGTGGTTGTCCATCCGTCAGTAATGATGATAATGATAAGAAATTGGCT
GCACTAGACTTGGTCACACCCAATTCATTTGACAACAACTACTTCAAGAATTTGATTCAGAAGAAGGGTCTTCTTCAATCAGACCAAGTTCTGTTTAGTGGAGGATCTACAGATTCTATT
GTCTCCGAATACAGCAAAAATCCTACAACCTTTAAATCCGACTTCGCAGCTGCTATGATAAAAATGGGAGATATTGAACCATTAACTGGTTCAGCTGGAATGATAAGAAAGATTTGCAGT
TCTGTCAACTAA

Retrieve as FASTA