Entry information : ZmRboh03 (ZmRbohA)
Entry ID 5488
Creation 2007-07-09 (Christophe Dunand)
Last sequence changes 2010-12-23 (Marie Brette (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-02-02 (Christophe Dunand)
Peroxidase information: ZmRboh03 (ZmRbohA)
Name (synonym) ZmRboh03 (ZmRbohA)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Flowers
Meristems
Mixed tissues
Roots
Seeds
Whole plant
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmRboh03
start..stop
S start..stop
SbRboh05 1692 0 1..852 1..854
OsRboh03 1474 0 24..852 8..843
OsRboh04 1348 0 31..852 12..819
ZmRboh09 1342 0 38..852 20..822
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18204523 -18204522 N° 2 182045016..182045129 114 N° 3 182044116..182044922 807 N° 4 182043914..182044009 96
N° 5 182043715..182043830 116 N° 6 182043530..182043632 103 N° 7 182043330..182043418 89 N° 8 182043068..182043218 151
N° 9 182042838..182042984 147 N° 10 182042630..182042758 129 N° 11 182042468..182042546 79 N° 12 182042274..182042383 110
complement(join(182042274..182042383,182042468..182042546,182042630..182042758,1 82042838..182042984,182043068..182043218,182043330..182043418,182043530..1820436 32,182043715..182043830,182043914..182044009,182044116..182044922,182045016..182 045129,18204523))


exon

Literature and cross-references ZmRboh03 (ZmRbohA)
Literature Lin F., Jiang M. Cloning and characterization of respiratory burst oxidase homolog gene from Zea mays.
Protein ref. UniProtKB:   Q0MRQ8
DNA ref. GenBank:   AC205292 (163261..159285)
Cluster/Prediction ref. UniGene:   Zm.4257
Protein sequence: ZmRboh03 (ZmRbohA)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   852
PWM (Da):   %s   95699.26 Transmb domain:   %s   o302-320i433-455o483-505i670-687o
PI (pH):   %s   9.87
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
VIILSASANKLAKLKGHAATYASLIMEELDPDDRGYIEIWQLETLLRGMVSAQAPEKLKRTTSSLARTMIPSRYRNPLKRHLSKTVDFIHENWKRIWLVTLWLVVNVALFVYKFEQYKRRTAFQVMGYCVCVAKGAAEILKLNMALILLPVCRNTLTTLRSTALSHVIPFDDNINFHKVIALSIAIATAIHTLAHVTCDFPRLISCPTDKFMATLGSNFHYKQPTYLGLLESTPGVTGILMIIIMSFSFTLATHSFRRSVVKLPSPLHHLAGFNAFWYAHHLLVLAYVLLVVHSYFIFLTREWYKKTTWMYLIVPVLFYACERVIRKFRENNYHAGIVRAAIYPGDVLSIHMKKPQGFKYKSGMYLFVKCPEVSPFEWHPFSITSAPGDDYLSVHIRTLGDWTSELRMLFGACQAQVTSKKATLTRLETTVVADAQTEDTRFPKVYIDGPYGAPAQNYRKYDILLLIGLGIGATPFISILKDMLNNLKSNEVESIHGSEIGSFKNNGPGRAYFYWVTREQGSFEWFKGVMNEVAGSDHSNVIEMHNYLTSVYEEGDARSALIAMVQSLQRAKNGVDIVSGSKIRTHFARPNWRKVFCDLASAHKNSRIGVFYCGSPTLTKQLKDLSKEFSQTTTTRFHFHKENF

Retrieve as FASTA  
Remarks Complete sequence from partial genomic (chromo 3, 12 exons but 3'end is missing), 2 mRNA and 38 ESTs. Cultivar="W23", "B73".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2



GTTATTATACTGAGCGCGTCAGCGAACAAGCTAGCCAAGCTGAAGGGTCACGCCGCGACCTACGCGTCCCTGATCATGGAAGAGCTCGACCCGGACGACCGCGGCTACATTGAG
ATTTGG
CAACTGGAGACGTTGCTCCGGGGCATGGTGAGCGCGCAGGCTCCCGAGAAGCTGAAGCGGACGACGTCGAGCCTGGCGCGGACGATGATCCCGTCGCGGTACCGGAACCCGCTGAAGCGG
CACCTGTCCAAGACGGTGGACTTCATCCACGAGAACTGGAAGCGGATATGGCTCGTGACGCTGTGGCTGGTCGTCAACGTCGCCCTGTTCGTGTACAAGTTCGAGCAGTACAAGCGCCGA
ACCGCGTTCCAGGTGATGGGCTACTGCGTCTGCGTCGCCAAGGGTGCCGCTGAGATCCTCAAGCTCAACATGGCTCTCATCCTGCTGCCCGTCTGCCGGAATACGCTGACGACGCTCAGG
TCCACCGCGCTCAGCCATGTCATACCCTTCGATGACAACATCAACTTCCACAAGGTCATCGCGCTGTCCATCGCGATCGCCACAGCGATCCACACGCTCGCACACGTGACCTGCGACTTC
CCAAGGCTGATCAGCTGCCCGACGGACAAGTTCATGGCCACCTTGGGGTCCAACTTCCACTACAAGCAGCCGACTTACCTGGGCTTGCTGGAGAGCACACCCGGGGTTACCGGAATCCTC
ATGATCATCATAATGTCCTTCTCCTTCACGCTGGCAACACATTCCTTCAGGCGGAGTGTGGTGAAGCTGCCATCGCCGCTACACCACCTTGCCGGTTTCAATGCCTTCTGGTACGCTCAC
CACCTGCTGGTCCTTGCGTATGTCCTGCTGGTGGTGCACTCCTACTTCATATTCCTCACCAGGGAGTGGTACAAGAAGACG
GTCGTGCTTGCAGAAACAACATTTTGCTTTCTGTTCGTA
TCCAACAGCGATAAGTGGTACGCGTTGCTTATACAACCAAACGGTGTGATGCAGACATGGATGTACCTGATTGTCCCTGTCCTCTTCTATGCCTGTGAAAGAGTCATCAGGAAATTTCGT
GAGAACAACTACCATGCGGGAATTGTGAGG
GTAAACCTCGGACACCTTGCTTTGAGATGAAACTCATTCTCCCCTCTGCATGTTCAGTCAGTGTTGGGAGCAGCAAAATAACATATGGTC
TCAATTGTTTATTCAGGCAGCAATTTATCCGGGAGATGTGCTCTCTATTCACATGAAGAAGCCACAGGGTTTCAAGTACAAGAGTGGGATGTATCTGTTTGTTAAATGCCCAGAAGTCTC
GCCCTTCGAGTG
GTAAGCTATTGAACTAAATTGATTTGGTTCATTCTGAGTTTCTGGCTGGTAATTGTTAATCAAATTCTGTTATGTATATGCAGGCACCCCTTCTCTATAACTTCGGCA
CCAGGCGATGACTACTTGAGTGTGCATATCCGTACGCTGGGTGACTGGACATCCGAACTGCGGATGCTTTTTGGGAAG
GTACCATTTCATTAATTGTTGCATACATCTCCAAGAAATAAT
TTATCTGTGGTTCTTGCTTACCGTTCTCTCATATTTGCAGGCTTGCCAGGCACAAGTAACTTCCAAGAAGGCTACCCTTACAAGACTTGAAACTACAGTTGTGGCAGACGCCCAGACAGA
GGACACTAG
GTTAGTTTGAGGCAGCAAAAGTGTTAAGAGTTGGAAGAGTAACAATACTGTTTTTTGAATGGCAGAATAATGTGGACTATCAGAAATGTATAATGTGGATTATTCGCACAG

GTTTCCCAAGGTCTACATAGACGGGCCATACGGTGCACCAGCACAAAATTACAGGAAATATGACATTCTTCTGCTTATTGGCCTTGGAATAGGAGCAACTCCTTTCATCAGCATACTGAA
GGATATGTTGAACAACCTAAAATCCAACGAA
GTGCTTACCTTTCTTTCATTTTTTCACACCCTATAGTTTGATTGGTTTTAGAGAAACTACTGCAACTTTAAGATTTTATTAACCTGGTC
AGCTTTGGTGTGTTTGCTTTAGGAGGTGGAAAGCATCCACGGCTCTGAGATAGGCAGCTTCAAGAACAATGGTCCAGGAAGGGCTTACTTCTACTGGGTCACCAGAGAGCAAGGATCTTT
CGAATGGTTCAAAGGAGTCATGAATGAGGTTGCAGGGAGCGATCACAGC
GTAATTTCCCTTTTTAATGCATTATTTCGATACTGTTAAGAAAATCAAGGATAGCTGATAACCGTACTGAG
TTGATTAAACAGAATGTTATAGAGATGCACAATTACCTGACCAGCGTGTATGAAGAAGGTGACGCAAGGTCAGCTCTGATTGCCATGGTACAGTCACTTCAGCGTGCTAAAAACGGCGTG
GATATCGTCTCCGGCAGCAAG
GTACTGTCTCACTCTCATTTCTCTTAAATCTTAATTACAGCGTATGTTCATAAACTAAGTTGAAATCTGGCTGCTGCAGATTCGAACACATTTTGCAAG
ACCAAACTGGAGGAAGGTATTCTGTGATTTGGCCAGCGCACACAAGAACTCTCGCATAG
GTATACGATAATTTCCCTTTTGCTCAACTGTAAAGTGTTTTGCATATGCTATCTGTTTTGG
TTAACGGAGCACTCTGTTGCAGGAGTTTTCTATTGTGGATCTCCGACGCTCACAAAACAACTGAAGGATCTTTCGAAAGAATTCAGCCAGACAACCACAACCCGGTTCCATTTCCACAAA
GAGAACTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2

GTTATTATACTGAGCGCGTCAGCGAACAAGCTAGCCAAGCTGAAGGGTCACGCCGCGACCTACGCGTCCCTGATCATGGAAGAGCTCGACCCGGACGACCGCGGCTACATTGAGATTTGG
CAACTGGAGACGTTGCTCCGGGGCATGGTGAGCGCGCAGGCTCCCGAGAAGCTGAAGCGGACGACGTCGAGCCTGGCGCGGACGATGATCCCGTCGCGGTACCGGAACCCGCTGAAGCGG
CACCTGTCCAAGACGGTGGACTTCATCCACGAGAACTGGAAGCGGATATGGCTCGTGACGCTGTGGCTGGTCGTCAACGTCGCCCTGTTCGTGTACAAGTTCGAGCAGTACAAGCGCCGA
ACCGCGTTCCAGGTGATGGGCTACTGCGTCTGCGTCGCCAAGGGTGCCGCTGAGATCCTCAAGCTCAACATGGCTCTCATCCTGCTGCCCGTCTGCCGGAATACGCTGACGACGCTCAGG
TCCACCGCGCTCAGCCATGTCATACCCTTCGATGACAACATCAACTTCCACAAGGTCATCGCGCTGTCCATCGCGATCGCCACAGCGATCCACACGCTCGCACACGTGACCTGCGACTTC
CCAAGGCTGATCAGCTGCCCGACGGACAAGTTCATGGCCACCTTGGGGTCCAACTTCCACTACAAGCAGCCGACTTACCTGGGCTTGCTGGAGAGCACACCCGGGGTTACCGGAATCCTC
ATGATCATCATAATGTCCTTCTCCTTCACGCTGGCAACACATTCCTTCAGGCGGAGTGTGGTGAAGCTGCCATCGCCGCTACACCACCTTGCCGGTTTCAATGCCTTCTGGTACGCTCAC
CACCTGCTGGTCCTTGCGTATGTCCTGCTGGTGGTGCACTCCTACTTCATATTCCTCACCAGGGAGTGGTACAAGAAGACG
ACATGGATGTACCTGATTGTCCCTGTCCTCTTCTATGCC
TGTGAAAGAGTCATCAGGAAATTTCGTGAGAACAACTACCATGCGGGAATTGTGAGG
GCAGCAATTTATCCGGGAGATGTGCTCTCTATTCACATGAAGAAGCCACAGGGTTTCAAGTAC
AAGAGTGGGATGTATCTGTTTGTTAAATGCCCAGAAGTCTCGCCCTTCGAGTG
GCACCCCTTCTCTATAACTTCGGCACCAGGCGATGACTACTTGAGTGTGCATATCCGTACGCTGGGT
GACTGGACATCCGAACTGCGGATGCTTTTTGGGAAG
GCTTGCCAGGCACAAGTAACTTCCAAGAAGGCTACCCTTACAAGACTTGAAACTACAGTTGTGGCAGACGCCCAGACAGAGGAC
ACTAG
GTTTCCCAAGGTCTACATAGACGGGCCATACGGTGCACCAGCACAAAATTACAGGAAATATGACATTCTTCTGCTTATTGGCCTTGGAATAGGAGCAACTCCTTTCATCAGCATA
CTGAAGGATATGTTGAACAACCTAAAATCCAACGAA
GAGGTGGAAAGCATCCACGGCTCTGAGATAGGCAGCTTCAAGAACAATGGTCCAGGAAGGGCTTACTTCTACTGGGTCACCAGA
GAGCAAGGATCTTTCGAATGGTTCAAAGGAGTCATGAATGAGGTTGCAGGGAGCGATCACAGC
AATGTTATAGAGATGCACAATTACCTGACCAGCGTGTATGAAGAAGGTGACGCAAGG
TCAGCTCTGATTGCCATGGTACAGTCACTTCAGCGTGCTAAAAACGGCGTGGATATCGTCTCCGGCAGCAAG
ATTCGAACACATTTTGCAAGACCAAACTGGAGGAAGGTATTCTGTGAT
TTGGCCAGCGCACACAAGAACTCTCGCATAG
GAGTTTTCTATTGTGGATCTCCGACGCTCACAAAACAACTGAAGGATCTTTCGAAAGAATTCAGCCAGACAACCACAACCCGGTTCCAT
TTCCACAAAGAGAACTTCTGA

Retrieve as FASTA