Entry information : ZmRboh07 (ZmRbohC / GRMZM2G043435)
Entry ID 5489
Creation 2007-07-09 (Christophe Dunand)
Last sequence changes 2010-12-23 (Marie Brette (Scipio))
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-01-05 (Catherine Mathe)
Peroxidase information: ZmRboh07 (ZmRbohC / GRMZM2G043435)
Name (synonym) ZmRboh07 (ZmRbohC / GRMZM2G043435)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Cell culture
Mixed tissues
Pericarps
Sheaths
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmRboh07
start..stop
S start..stop
SbRboh09 1839 0 16..948 18..957
OsRboh05 1725 0 11..948 14..951
HvRboh01 1676 0 18..948 17..963
SbRboh03 1651 0 1..948 1..944
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 159845594..159846254 661 N° 2 159846344..159846503 160 N° 3 159846605..159846653 49 N° 4 159847308..159847421 114
N° 5 159849457..159849879 423 N° 6 159851392..159851775 384 N° 7 159851861..159851956 96 N° 8 159852032..159852147 116
N° 9 159852253..159852420 168 N° 10 159853725..159853884 160 N° 11 159854086..159854283 198 N° 12 159854377..159854505 129
N° 13 159854688..159854766 79 N° 14 159855742..159855851 110  
join(159845594..159846254,159846344..159846503,159846605..159846653,159847308..1 59847421,159849457..159849879,159851392..159851775,159851861..159851956,15985203 2..159852147,159852253..159852420,159853725..159853884,159854086..159854283,1598 54377..159854505,159854688..159854766,159855742..159855851)


exon

Literature and cross-references ZmRboh07 (ZmRbohC / GRMZM2G043435)
Literature Lin F., Zhao Y., Jiang M. Cloning and characterization of respiratory burst oxidase homolog gene from Zea mays.
Protein ref. UniProtKB:   A5H238
DNA ref. GenBank:   AC204293
Cluster/Prediction ref. UniGene:   Zm.25738
Protein sequence: ZmRboh07 (ZmRbohC / GRMZM2G043435)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   948
PWM (Da):   %s   106673.33 Transmb domain:   %s   o387-406i525-547o567-589i746-763o
PI (pH):   %s   9.78
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRGGGGPGVGTPGRPRWGSGATTPRSLSTGSSPRGSDRSSDDGEELVEVTLDLLEDDNIVLRSVEPAAAAAAPAPPRRHPDPTPSSSAAPSRSRSPAMRRTSSHRLLQFSQELKATASRAKQFSQDLTKRFTRTQSRANLAGEPPAAAPSGIDAALEARAQRRRRAQLDRTKSGAQRAIRGLRFISGGNKASNAWIEVQANFDRLARDGYLSRADFPKCIGMTESQEFAMELFDTLSRRRQMQVDRINKDELREIWQQITDNSFDSRLQIFFDMVDKNADGHITEAEVKIIMLSASANKLSRLKEQAEEYAALIMEELDPEGLGYIELWQLETLLLQKDTYVNYSQALSYTSQALSQNLAGLRKRSPIRKISSTLNYYLEDNWKRVWVLAVWIGIMAGLFIWKFIQYRNRYVFDVMGYCVTTAKGAAETLKLNMALILLPVCRNTITWLRNTKAARALPFDDNINFHKTIAAAIVVGVVLHAGNHLVCDFPRLISSSEVKYAPLRKYFGENKPTYLDLVKGVEGITGIIMVVCMLIAFTLATRWFRRSLVKLPRPFDKLTGFNAFWYSHHLFIIVYISLVIHGECLYLIHDWYKRTTWMYLAVPVGLYVGERTLRFFRSGSYSVRLLKVAIYPGNVLTLQMSKPPTFRYKSGQYMFVQCPAVSPFEWHPFSITSAPGDDYLSIHVRQLGDWTRELKRVFSAACEPPVGGKSGLLRADETTKKALPKLLIDGPYGSPAQDYSKYDVLLLVGLGIGATPFISILKDLLNNIIKMEEEEASSDLYPPIGRSKAHVDLDTLMRITSKPKRVLKTTNAYFYWVTREQGSFDWFKGVMNEIAELDQRNIIEMHNYLTSVYEEGDARSALITMLQALNHAKNGVDIVSGTKVRTHFARPNFKKVLSKIATKHPYAKIGVFYCGAPVLAQELSKLCYEFNGKSTTKFEFHKEHF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, 13 introns), 1 mRNA (DQ897930) and 20 ESTs. Cultivar="B73", "F2", "BMS (Black Mexican Sweet)".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAGGAGGAGGAGGACCGGGCGTCGGCACGCCGGGGCGCCCGCGATGGGGCTCCGGCGCCACGACGCCGCGGTCGCTGAGCACGGGCTCCTCTCCGCGCGGCTCGGACCGGAGCTCC
GACGACGGGGAGGAGCTGGTCGAGGTCACGCTGGACCTGCTGGAGGACGATAACATTGTGCTGCGGAGCGTCGAGCCGGCGGCGGCCGCGGCTGCTCCGGCTCCGCCCCGCCGCCACCCG
GACCCTACCCCGTCCTCGTCCGCGGCCCCGTCGCGCTCGCGCTCGCCCGCGATGCGCCGGACCTCCTCGCACCGCCTGCTGCAGTTCTCGCAGGAGCTCAAGGCCACCGCCAGCCGCGCC
AAGCAGTTCTCGCAGGACCTCACCAAGCGCTTCACGCGCACCCAGAGCCGCGCCAATCTCGCGGGGGAGCCACCGGCTGCCGCGCCCTCGGGCATCGACGCCGCCCTCGAGGCCCGCGCC
CAGCGCCGCCGCCGCGCGCAGCTCGACCGTACCAAGTCCGGCGCGCAGCGCGCGATCCGCGGCCTCCGCTTCATCAGCGGCGGCAACAAGGCCAGCAACGCCTGGATCGAGGTCCAGGCC
AACTTCGACCGCCTCGCGCGCGACGGCTATCTCTCCCGCGCCGACTTCCCCAAATGCATAG
GTTCACTTCTCCCCTTCCCCTTCCCCTTCCAGAAACCCCAGGCTTCTTCGAGTGACTAG
TTCCTAATCGCATTGGAGTTCTGGATGCAGGGATGACGGAGTCACAGGAGTTCGCGATGGAGCTCTTCGACACGCTGAGCCGCCGCCGGCAGATGCAGGTGGACAGGATCAACAAGGATG
AGTTGCGCGAGATCTGGCAGCAGATCACCGATAACAGCTTCGACTCGCGCCTCCAGATCTTCTTTGACAT
GTAACCCCGCAATCTGAGAACTTCTATCTAATTAGCGCTCTATGAACACA
TCAGGTTTTCAGTTAATCCGTCTTCGTTTTGGTATGTATCATTTTAATCAGGGTGGATAAGAATGCAGATGGCCATATCACGGAGGCCGAGGTGAAAGAGGTAAACAATTCCTCGTCGTC
GCTGTGCTTTGTGTTTCACTTGCGATATTTTTTCCTCTCCCGTATGGGGATATTTTCGTACAATTATTTGGGGTCTTTTGATAACTGGTCTGTCCATTTCCATGCCTCTGTAGTTATATG
TACTTGTTTTCTTGTTGCCTTACAAGTTTGTGTTCCTGGATTTGCGCATAATAAGGATTACGGACTCAGTAGCTTGGAGAAACATTGCCGACTAATCGAGGCATCCCGGCGAAACTGGCG
GAGAAAGCATCCCCACCACCGGCCGGTCTCCAGACATCTTTTTTTTTTTTTTGGCAAAATCGATATTGGTCGTTCTAGAACGTGGGAGGGGTTCTTAGTAAATTTACTATTGATGGAGAT
GGAACTCTAACCTACAGGAGGCTGGAGGCTAGAAAGCAATAGTTGGTGGGGGCATTTCAGTCATGCTGCCTAACTAGTACTCTAATCTGCTCAAACAGCGTGGAACCGGGGTGGGGGGGG
GGGAGCTTTTGGATTAGAGCTTATTTTATTTATTGAACTGGGGTCATAGTCTAAAGGGCCAGGCTAGGTTGTTTGGTTACTTTTTTCGATGCGGGAAAACTGAAAAGTATGTTCGTGATC
AGTTTATTGAAAAATGACATTTTTTTGTTTCCAGATCATTATGCTGAGTGCTTCTGCTAATAAATTGTCGAGGCTTAAGGAGCAAGCTGAGGAGTATGCAGCCTTGATCATGGAGGAACT
TGATCCTGAAGGGCTTGGCTACATTGAG
GTAAGCATAGCATGTTGTTTTATCCCATACTGCCTATGATCTGAGACAAATAACTGATTCCATAGTACTCTTTATATTGCATGATCCCATCA
GTATCCACTGATTTTGAAGGTGTTTAGAAGATGTTGAATTACTGAGTAGAGTGACAAAAAAAGAGAGTTTTGACTGGATGTATTTGGGTCTGTCCACTGTCCAGTAATAAATTGATACTG
CAGGCCTGATTAACTTGTTTTAACCAAACAACATGACAAGGTTGGTCACTTCACCAGCCATTATTTCTTATTTGGTGAAAATTGAAACGGAGGTTAACCAATTTTTTTTAAAGAATCCCA
TTCCCGGGTCAGTATCTGAAGGAGGATTTTGTTTTCTTGCTCCCGCCTAGTCAAACCCTTCCACTGATCTCCTCCAACTGTCCTAAATACCAGTCTAATCTTGGTCATCCCTGCTTCCCT
CTGTACATCTACTTAACGTACCAGAATGCAGTGGTCTGTGGTCATGACCATCTAGATCAGATTTGATCTGGAAAGAAGTCTATTATTTTATTATTTCTCCTAGTACTTGCTCCTCATGTG
CCTTTTGGAGTTCTATTTCCAAACTTTTTATAACTGTGCAGTTGAGTTTCTTCCTATGATAAAAGGAGATGGGCACCTGGAGCCGTTCTTTCTTAAAATGTAACCACCTGACTTCATCTA
AGGAGACTCTTTGATCTTTGTATCTGAAGACATTATATGTTGGCTCACTTGAGGTTGTCTTGTAGCAAAACTGCAAAATTATTTTATCTCTAGCCAGCACATTGTAGGTGTATATTGTAA
CTAAAAATCAGTGTCATCAGCACTCATATTACACAAGGGAGCCTAGCCATGGCAGCTTAAGTTGTTTCCTAGCTACTGTAAAATCTCAGGACACCAAGCTCCTGCTGCTGGAACCAAAAA
TCTACAGGTCACTCTCATCAACATGACATTTAAATAATCTGAATTCTTGATAACAATCTCTATATTTTAATAACCAGCTGTACGGAGAAACTTGCGTCTTCCTCTACTTTCACTCTTTAC
TTTTGCTTCCTAGTTTGTACAGCCCATTTTCTTCAAATGATATCTTCAGGTCTTCTGAAAGGAATAGCACACAGTGTGATGATTATTTTCATTTGATTTTGAGACCATGTTTCATATATA
ATCCTATGCAATATCTTCACTTCTTCAGGTCTTCATCTTTTTTATTTTCAGATAATCCTATGCAGTATTGCTATTTTTGCAGTTGTGTAATTTCAGTCCTCAGATGTGAGTACAACTGAG
AGTCTGAGAATCAAGTTCATGTCCCACCTTTTTCACAATGGAATTATTGTGTGCATGTTCTACAAGATTGTGGCATGTATGGTGGGCTCATATGGGAGCCATGTGCACCACCAGATGCAA
TTATAATCTTGAGGGGACCACCTGCATCTGGTGGAGTGTTTGACTTTTGTCCCTTAGATTGACGTGTATGGTTAACCTGCTTCTTTTTCTCCTGAGAAGTGTAATTAAGGATTCTCAGGA
GATGACACTATGAACTATTTTTGTTAATTCCACTTAGGCAATATTTTGTGTCATTATGTGCTAATAATGAGATTACTGTAAGCATAGAATCATTCATAAATTTAGCTATCAAATATCTGA
TCGTTCTGCTGAATCTGAAGCTATACCTATGTAATTGAGCAGTTGTACTTCTCTGAAGTCAACAAGGATATTTTTGCTTTTCCTTTTGTCTAGGGAGATCCTCACTGCGCAATATTCTAA
AAGGTTTTTTGTAGTTTTGTTCTTTAATTTCAGTACTAAATCATTATATACACCACATTTTAGATGCACTATGTTTACATGTACGTCTGTACATATTTTTAAAAAAATATATATATACGT
GCCTGATCAATGACCTGTTGACTGTAACCTGCAGAACATATATCTTTGCAAAAAAAATGCTCTGTACTTATTTTTCCCCAAATTGCTCTGGTGTTAGGGGACATATTTTATTTTTTTTAA
AATGCCTTTTATTGTCATTGCAGCTTTGGCAACTGGAGACATTGCTACTGCAAAAGGATACCTATGTCAACTACAGCCAGGCCTTGAGCTACACAAGCCAAGCACTAAGCCAGAACCTTG
CTGGTCTAAGGAAAAGAAGTCCAATCCGAAAAATTAGCAGCACATTGAACTACTATCTGGAGGACAACTGGAAACGTGTTTGGGTGCTTGCAGTATGGATTGGAATAATGGCTGGATTGT
TTATTTGGAAGTTCATTCAGTACCGTAACCGTTATGTCTTTGATGTGATGGGCTACTGTGTCACAACTGCGAAAGGTGCTGCAGAGACTCTCAAACTGAACATGGCACTTATTCTCTTGC
CTGTATGCCGCAACACTATCACCTGGCTGCGGAATACGAAAGCTGCACGGGCATTGCCGTTTGATGACAACATTAACTTCCACAAG
GTTAGTCCTAGACTCAAATTAGTCTTTTATTGCC
CCTTCAAATTGGGGGCTGGAGGTTCATGGTACATATTTAGTCGCAATGTTGCATACACTGACCATTTCAACCCGAAAGCTTAAGTTGATGGGAGAGGTGGGTAATTCACTTATAAACTCC
AACAGTACAACTTTAGGGTTTGCAAACGGTTGTTTGTTTGTGAGATATGTTACATCTTTACTTTGTTTCTATAGTGCATGCTGGTCATCTGAATTCACGTGAATGTGAAAAAATTGGTTA
AATGAATTGTCCTTTGCACTGCATGGTCGTCACGTGTGGGGCTGCTTTATCACAATGTCCAGCAGTTTGAAAAGAGACTTAGGGCGTGATTGGTTTCCTGGTTTTGCCAGGGCCAGGTCC
TGCCGGCGCAGGCACCTTGTTATTTGGTTTCCCGTACAGCCTCATGGGCTAGGCCCAATTCATGCACCGACCACGCCACAGCCTGGCCGGGCGGATACCGGAGAATTGGTCTTCGCTCCT
GAGCCAGGTTGCGCTGATGCAGGCATGGAACACAAGAAATCATTTTAAGTTGGTATTTATGTTATATCTCTTAATTAATACATCTAATTAATAAAACGATTTTACTTTAGCGTTCCTGCC
GTTGTTACGAATAAAACTAGACTACACTTATATAAATTCTTTTTTAAAATATTTATTTTTTATGTTTATTCTATCTCCCTCATGACCCAGTCTACCAAACATTGTCCCTTCTCAGCCTGG
TTGACGACATGCAACTTAACCAAACAATCAATCCTGTATGTTTACAATCTAGTCTCAGTGAGCCTGGTTGATCACATGCGAGCCAGGCTGAGTTAAGAAACCAATTACGCCCTTAGGTAC
TATATGTACTATATAATATATATACAGCTCAATTGATGGATTATTCCTCCATACATTTTGTCTGAAAGTTTTATTTGACATTCCTATAGTCAGGCCATAGTCTAAATTGATTTAACCCTT
TTAAATAGTCATCTTGTGCCTACGGTAGATCATATTCACCCAATATTGTTCTTGATCAGCACACAAGGTAGCCAGTGTTCTGCTTGCCTCTTGGCTCCAGCTAACAAAGAACATGATTTT
GCTGATGGAATTATATTCTTCCTGATATTCAGTTAAAAGGAGGCACTGTAAGCTAAAACCATTTGATTATACGTGTACCGTGATTTGACCATAGCAATTTAGCTAAAAGCAAAAGTTGGG
CAATGCCATGTTTAGACAACTTATGACTTGCCTTTCTTGTTGGCTGTGAATGTAACGAAAAATTAATCATAAGTATATATCTGGTCTGCTTAGACCTTGTTTTTTCTTCTTAATAGGCGC
AGTTCTCCTGCGTTTTTCGAAAAAAAGTATAATGGGGGCATTAGTGGTGCCTGATAAGGGTTTTTCGTAATAAGGGATACATGTGACATGTGGTTCATCCAGACCAAAAATATAACTAAA
AGAACATTTTTTTTCTTTTGCTTGTTTTGTAATGGCAGACTATTGCAGCAGCAATTGTGGTTGGTGTTGTCCTTCATGCAGGGAACCACCTTGTATGTGATTTTCCACGGCTCATTAGTT
CATCAGAGGTGAAGTATGCTCCACTGCGCAAATACTTTGGGGAAAATAAACCAACATATCTGGATCTGGTAAAAGGAGTGGAGGGCATAACAGGGATAATCATGGTTGTGTGCATGCTTA
TCGCTTTTACTCTAGCAACAAGGTGGTTCCGCCGTAGCCTGGTGAAGCTTCCAAGGCCATTTGACAAACTAACTGGCTTCAATGCATTCTGGTACTCTCATCATTTGTTCATCATTGTGT
ACATATCACTTGTTATTCATGGAGAGTGTCTATACCTTATCCACGACTGGTACAAAAGGACG
GTGAGATAATCTTCTTTTTTTGTTTTGTCTACTCTGTGGACCTCAGTAACTTTTTAAG
TATCTAATATCCTTTTATTTTGTACAGACATGGATGTACCTTGCTGTTCCTGTTGGTCTGTATGTAGGGGAGAGGACTCTGAGGTTTTTCAGATCGGGCAGTTATTCTGTCCGGTTATTG
AAG
GTAACCTTCACATATTTAGAAATCTTGAGTATTAAAAGTTTGTTTACAGTCCTCTGACCCATGGTTCTTCTGCAGGTGGCTATATATCCTGGTAATGTTTTGACATTGCAGATGTCT
AAACCTCCCACATTCCGTTACAAGAGTGGGCAGTATATGTTTGTTCAATGCCCTGCAGTTTCACCTTTTGAATG
GTGTGTGGATCTTCTTTGTAACCAAACTCGAGCTAGCTCACAAAAT
CATGTTTCTGGAGTCTGGACACTAGAATGTGTAGTTAAACACTTGGTTTCTTCTTTCAGGCATCCTTTCTCAATTACTTCAGCACCTGGGGATGACTATCTAAGCATTCATGTTCGACAA
CTTGGTGACTGGACACGGGAGCTCAAACGGGTATTCTCAGCAGCTTGTGAGCCACCTGTGGGTGGGAAAAGTGGCCTTCTTCGAGCAGACGAAACAACCAAGAAAGC
GTATGTTAATTCC
CCATATGCATCTCAATACTTAATAATATATATTTGCTATTTGGGGCTTCATTTTTGTGGGAAACCCTGTCCGTGACCGCCGGGAGGAGCACTGTAGGTGGCCGGCGCTAGAGTAGGGGCC
TCGGTCTCCAAGGTGAGCTCCTCGAGGATAAGCTCGTTGCGGACGGCGTAGAAGGTGTGGAAGGGCACAATCCTCTTGATGAGAGCCTTCAGGTGGCCGTAGCGGGGGTTGAGGCCACGC
AGAAGGTTCAGCGCAGTGTACGGTCGACGATGTGCTCGCCGAGGTCGTGGAGAGAGTCCGCCATGCCCTTCATTTGGCGGCAGTATTCTCCCACGGAGAGATCCCGCCGAGAGAACCGGT
GAAACTGGGCGTCGAGGTGGAGCGCCAGAGCCTGCCGGTTCCCGAGGAACTGTCCCTCGAGCGCGAACCACGCCTGGCGAGCAATGTCCGCTAGGTCACGGATGATGTCCTATAGCTCAA
CGGTGATGGTGTCGTGGAGCCACAAGAGGACCACGTTGTCCATCCGGTACCACGATGGAGACAGCGGGGCGATGAGGTCGTCGAGGACGTGGTCGGCGAGAGCATACCGCCGAAGTGTGA
GAACGACCTGAGCCTGGACACGTCGGGTCCAACACAATGGACACGAGGGATCAAATGTTGTGAATCCCGACGGCTTGAGCGTGGAGGGCGGCGTTGAGTCCGGAGGTGGGGGGGGGGGGC
TCGGGAGCGATCGGAGGATCCGCAAAGGCACGCGCGTCGGCTGCTGCAGCGGCGGAGAGGCCGACCAGGGCCACTACGTCGGAGGGGCGCGCGCCGGCGACCTCGCAAGTGGAGGCACCC
ATGGCGGCGTCCAGGTCAGAGGTGCACGAGAGCTCCATGGCGTAGGTCCGTGTGGGGAAGCTGTCGGTTGTGGCTGTCGACGATGGAGAAGGGCAGGCCGTGACTGGGCGCACCGGCGGC
GAGGAAGAGGCAAGCCACGGCTTGTGGCGCCGAGCCGCCGCCGACGGGGGAGGTGGCCATCGGTTGTAGGAGGGCAGTGGCTGGGGTGCGGCCTGGAGAGGGGTGCCAGCGGCTGTGCAG
GGAGGTGCAGGTGGGTGGTCTGAGGGTTGGGAGGGAGAGAAAAGAATCCTAGCTCTATACTATGTGGGAAACCCTAACTCAGGGTTGGGCGTTTGTATTAATAGACAAGTTAGATGGGCC
TAGCCCATTACACAGGGGTGAGACTGTAATTACAAGGGGCTAACCGCAAAACCCTAATGAGTACTCTAACAATTTTTTTGGGGGAATGCAGGTTACCAAAACTTTTGATTGACGGACCAT
ATGGTTCTCCTGCACAAGACTACAGCAAGTATGACGTTTTACTACTTGTCGGATTAGGTATCGGTGCCACACCTTTTATTAGCATACTGAAAGACCTGCTCAATAACATCATCAAAATGG
AGGAAGAGGAA
GTAAGTGATCTTTCTCCTGTCCCCATCTAGCTTCTTATACTATATAGAAAAAACTGGTCTCTTATTTCTGCTTGTGATCTAGAAATTAACAATGATTGTAATTCTTGTT
TTCTTTGTGTTTAGTTAGTCATCTATTCAAATGTTTTTCCTCATTAATTCCAGACTAAGCCAGTAATTAATTTATTCATGTAAAATTTGCAGGAAGCTTCAAGCGATCTTTACCCACCAA
TTGGTCGCAGCAAGGCACATGTTGATCTTGACACCCTTATGAGGATTACCTCAAAACCAAAGAGGGTACTGAAGACAACAAATGCTTACTTTTATTGGGTGACACGTGAACAAGGGTCTT
TTGATTGGTTTAAAGGGGTCATGAATGAAATTGCTGAACTAGATCAGAGG
GTATGTATCATATACCTGTCATATTTTACAAATCATGCTATTTGGTTTTCCCTTTGCAAATTTGTTCTTA
CGGATGGTTTTGTTCAATACTAGAATATCATTGAGATGCACAATTATCTCACAAGTGTTTACGAGGAAGGGGATGCTCGGTCAGCACTCATTACGATGCTACAAGCTCTCAACCATGCCA
AGAATGGTGTTGATATAGTTTCTGGAACTAAA
GTAAGTTCCAGCACCCTGATATGCATCACACCCTAAAGGGTTAAAACTTCATTGTAGTACAGTTAAGAAAATATGTTTGGAATAATTT
GTCATATTTTTGGTTCTTTCCTTTTTTTCCTATACCAATTCACTCAGCAGAAAAAAAAACTTTGTTTTGATGTACTGATAAGTTATTTTTGCAGGTGCGGACACATTTTGCAAGGCCAAA
TTTTAAAAAGGTCTTATCTAAGATAGCTACCAAACATCCATATGCTAAGATTG
GTGAGATACGTTTCATATTTCTGATATAGTTGAAAACTACCTTTTATACTTTTTAACTATGAATATA
AATATCCTTTAGGATGGGAATTTTGTTTACTAACTAGCTAATACATCTAACTAAAGCAATAAACTTACTATATTTCAGTAGAAGTGGTTACTATAAATTTAATGAGCAAACATGGGTAAG
GACTTGAAAGCCTCCTTTCGGAGACCAAGACTTTTGGAAGTCTATAATTTTGTTTTTGGCTAATTTTTGGGCCTCTATAGTTCGAACCATCTGAAAGAAACACAACCCATGATATTAAAT
TGCTTGCCTTGACCTCTAGGGTCGATGGTGCTTATTTATTTATACAAGCACCGACAGGAGCTACCTATTGCAAGTGGAATCCTACTCTGTACTATATGGCAATGCTTTCTTTCAGCAAGA
CCGTTTTACTGATGAGCATGAGGATGAGGACAAGACACTAGGTGTGAGATAGCTATCTTGGTGAAAAACGAGTTCAGATGCTGATACTGGTCTCCTCATCAGTTTGGATAGCAATGATCT
AGATGTTAAAGCGGCACTCAACCATGTTCTGAAATTTAACAAACTTTTCAAACACGTTGCACACTTTGCTGTCTATTACAAGAGGAATCCTACTTGGTTACAACATCCCTCCCAACCAAC
TCTGACTCTAAATGAATTGGATGCACGCAGTTCTATTCTGTTTTATATCTAACTCAAATCATAGTTGGTTTCTAATATAGCCTAAGAGAATCCTGGACAACTAAGACCGTAGCCTATGTA
TAACATATTCTAACAAAAGCTGCCTGGCCTAGGCAGCTGAGATTGTGCTGCCTGGCCAGGGCAACCAAGCTGCCTGGCCTAGTTGTAACATATTCTAACAACGTTTACTTCTTCCAGAAT
CAGTAATTTCGGTCCCATCTTCTATGATCTGATCACTGTAAGAAGGTAATTGTTGTTGTTGTGTACAGGAGTGTTCTACTGCGGGGCTCCAGTTCTGGCACAGGAACTAAGCAAGCTCTG
TTATGAATTCAATGGCAAGTCTACAACAAAATTCGAATTCCACAAGGAGCATTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAGGAGGAGGAGGACCGGGCGTCGGCACGCCGGGGCGCCCGCGATGGGGCTCCGGCGCCACGACGCCGCGGTCGCTGAGCACGGGCTCCTCTCCGCGCGGCTCGGACCGGAGCTCC
GACGACGGGGAGGAGCTGGTCGAGGTCACGCTGGACCTGCTGGAGGACGATAACATTGTGCTGCGGAGCGTCGAGCCGGCGGCGGCCGCGGCTGCTCCGGCTCCGCCCCGCCGCCACCCG
GACCCTACCCCGTCCTCGTCCGCGGCCCCGTCGCGCTCGCGCTCGCCCGCGATGCGCCGGACCTCCTCGCACCGCCTGCTGCAGTTCTCGCAGGAGCTCAAGGCCACCGCCAGCCGCGCC
AAGCAGTTCTCGCAGGACCTCACCAAGCGCTTCACGCGCACCCAGAGCCGCGCCAATCTCGCGGGGGAGCCACCGGCTGCCGCGCCCTCGGGCATCGACGCCGCCCTCGAGGCCCGCGCC
CAGCGCCGCCGCCGCGCGCAGCTCGACCGTACCAAGTCCGGCGCGCAGCGCGCGATCCGCGGCCTCCGCTTCATCAGCGGCGGCAACAAGGCCAGCAACGCCTGGATCGAGGTCCAGGCC
AACTTCGACCGCCTCGCGCGCGACGGCTATCTCTCCCGCGCCGACTTCCCCAAATGCATAG
GGATGACGGAGTCACAGGAGTTCGCGATGGAGCTCTTCGACACGCTGAGCCGCCGCCGG
CAGATGCAGGTGGACAGGATCAACAAGGATGAGTTGCGCGAGATCTGGCAGCAGATCACCGATAACAGCTTCGACTCGCGCCTCCAGATCTTCTTTGACAT
GGTGGATAAGAATGCAGAT
GGCCATATCACGGAGGCCGAGGTGAAAGAG
ATCATTATGCTGAGTGCTTCTGCTAATAAATTGTCGAGGCTTAAGGAGCAAGCTGAGGAGTATGCAGCCTTGATCATGGAGGAACTTGAT
CCTGAAGGGCTTGGCTACATTGAG
CTTTGGCAACTGGAGACATTGCTACTGCAAAAGGATACCTATGTCAACTACAGCCAGGCCTTGAGCTACACAAGCCAAGCACTAAGCCAGAACCTT
GCTGGTCTAAGGAAAAGAAGTCCAATCCGAAAAATTAGCAGCACATTGAACTACTATCTGGAGGACAACTGGAAACGTGTTTGGGTGCTTGCAGTATGGATTGGAATAATGGCTGGATTG
TTTATTTGGAAGTTCATTCAGTACCGTAACCGTTATGTCTTTGATGTGATGGGCTACTGTGTCACAACTGCGAAAGGTGCTGCAGAGACTCTCAAACTGAACATGGCACTTATTCTCTTG
CCTGTATGCCGCAACACTATCACCTGGCTGCGGAATACGAAAGCTGCACGGGCATTGCCGTTTGATGACAACATTAACTTCCACAAG
ACTATTGCAGCAGCAATTGTGGTTGGTGTTGTC
CTTCATGCAGGGAACCACCTTGTATGTGATTTTCCACGGCTCATTAGTTCATCAGAGGTGAAGTATGCTCCACTGCGCAAATACTTTGGGGAAAATAAACCAACATATCTGGATCTGGTA
AAAGGAGTGGAGGGCATAACAGGGATAATCATGGTTGTGTGCATGCTTATCGCTTTTACTCTAGCAACAAGGTGGTTCCGCCGTAGCCTGGTGAAGCTTCCAAGGCCATTTGACAAACTA
ACTGGCTTCAATGCATTCTGGTACTCTCATCATTTGTTCATCATTGTGTACATATCACTTGTTATTCATGGAGAGTGTCTATACCTTATCCACGACTGGTACAAAAGGACG
ACATGGATG
TACCTTGCTGTTCCTGTTGGTCTGTATGTAGGGGAGAGGACTCTGAGGTTTTTCAGATCGGGCAGTTATTCTGTCCGGTTATTGAAG
GTGGCTATATATCCTGGTAATGTTTTGACATTG
CAGATGTCTAAACCTCCCACATTCCGTTACAAGAGTGGGCAGTATATGTTTGTTCAATGCCCTGCAGTTTCACCTTTTGAATG
GCATCCTTTCTCAATTACTTCAGCACCTGGGGATGAC
TATCTAAGCATTCATGTTCGACAACTTGGTGACTGGACACGGGAGCTCAAACGGGTATTCTCAGCAGCTTGTGAGCCACCTGTGGGTGGGAAAAGTGGCCTTCTTCGAGCAGACGAAACA
ACCAAGAAAGC
GTTACCAAAACTTTTGATTGACGGACCATATGGTTCTCCTGCACAAGACTACAGCAAGTATGACGTTTTACTACTTGTCGGATTAGGTATCGGTGCCACACCTTTTATT
AGCATACTGAAAGACCTGCTCAATAACATCATCAAAATGGAGGAAGAGGAA
GAAGCTTCAAGCGATCTTTACCCACCAATTGGTCGCAGCAAGGCACATGTTGATCTTGACACCCTTATG
AGGATTACCTCAAAACCAAAGAGGGTACTGAAGACAACAAATGCTTACTTTTATTGGGTGACACGTGAACAAGGGTCTTTTGATTGGTTTAAAGGGGTCATGAATGAAATTGCTGAACTA
GATCAGAGG
AATATCATTGAGATGCACAATTATCTCACAAGTGTTTACGAGGAAGGGGATGCTCGGTCAGCACTCATTACGATGCTACAAGCTCTCAACCATGCCAAGAATGGTGTTGAT
ATAGTTTCTGGAACTAAA
GTGCGGACACATTTTGCAAGGCCAAATTTTAAAAAGGTCTTATCTAAGATAGCTACCAAACATCCATATGCTAAGATTGGAGTGTTCTACTGCGGGGCTCCA
GTTCTGGCACAGGAACTAAGCAAGCTCTGTTATGAATTCAATGGCAAGTCTACAACAAAATTCGAATTCCACAAGGAGCATTTCTGA

Retrieve as FASTA