Entry information : ZmRboh10
Entry ID 5491
Creation 2007-07-09 (Christophe Dunand)
Last sequence changes 2010-12-23 (Marie Brette (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-12-28 (Christophe Dunand)
Peroxidase information: ZmRboh10
Name ZmRboh10
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Cell culture
Endosperm
Mixed tissues
Seeds
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmRboh10
start..stop
S start..stop
SbRboh08 1574 0 6..891 3..916
OsRboh09 1370 0 39..891 36..909
StRboh02 1151 0 29..891 18..867
OsRboh01 1146 0 25..891 30..905
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 24652667..24653204 538 N° 2 24652430..24652589 160 N° 3 24652231..24652279 49 N° 4 24652018..24652131 114
N° 5 24651113..24651931 819 N° 6 24650804..24651018 215 N° 7 24649918..24650698 781  
complement(join(24649918..24650698,24650804..24651018,24651113..24651931,2465201 8..24652131,24652231..24652279,24652430..24652589,24652667..24653204))


exon

Literature and cross-references ZmRboh10
Literature Wilson,R.K. The sequence of Zea mays clone
DNA ref. GenBank:   AC204045.1 (126078..129361)
Cluster/Prediction ref. UniGene:   Zm.80129
Protein sequence: ZmRboh10
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   891
PWM (Da):   %s   99090.85 Transmb domain:   %s   o347-369i480-502o530-552i716-733o
PI (pH):   %s   9.15
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSNQNESGGGGGAGPPLPTAFKSPSTDGKSGSRRSTRFKDEDEYVEVTLDVRDGGGGGDDVAVLAIKDDVRDDTQDAASLLDRPAPGGAGGGLSSKLRAARARLGRIASGKRAAVPLSALLRRDPDRARLDRSVVTALRGLQFLNQAAVTEGWPEVEKRFHRLAVDGFLLRSRFGQCIGMVGSEEFAAQIFDALARRRGITAMVLTKDQVREFWEQLSDPGFDAKLQTFFDMVDKNADGQITEEELKVLTLTASANKLSKILERVDEYTALIMEELDPDSLGYIEIANLESLLLQPPSQAPTRLVTHSSNISQLISQRLAPARDDGPLRRGARAVLYFAEDNWKRVWVMALWLAINAGLFTWKFLAYRRHPTFDVMGYCVCVAKGGAETTKFNMALILLPVCRNTITWLRSRTRLGAAVPFNDNINFHKVVAGGVAVGVALHAVTHLTCDFPRLLHASAAAYEPMKAYFGQRRIPNYWWFVRGVEGITGVIMVVLMAVAYTLAHPWFRRGKLSEGNPLRRLSGFNMFWYSHHLFVIVYVAFVVHGVCLYINRTWYKQTTWMYLAIPILLYAGERLLRALRSHGLTTVRIEKVALYPGNVIAIHMSKPHGFSYKSGQYIYVNCGEVSPFEWHPFTITSAPGDDYLSMHIRCRGDWTASFRALFAQVCRPPAAGQSGLLRADFASSTAAGGGGKLPKLLIDGPYGAPAQDYRKYDVLLLIGLGIGATPLISIVKDVLNNISDNKDEEQPAEFMTRRVYFYWCTREEGSFEWFRGVMNEVAERDARGDVVELHNHCTSVYEEGDARSALLVMLQALHHAKSGVDVVSGTRVRTHFARPNWRDVFKRVACNHQGQRVGVFYCGDQKVTPELRRLSQDFSHKTTTKFVFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 10, introns) and 12 ESTs. Cultivar="B73", "F-352 near isogenic line", "BMS (Black Mexican Sweet)".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTCAAACCAGAACGAGAGCGGCGGCGGCGGCGGCGCGGGACCGCCGCTGCCGACGGCGTTCAAGAGCCCGTCCACGGACGGCAAGAGCGGCAGCCGCCGGAGCACGCGGTTCAAG
GACGAGGACGAGTACGTGGAGGTCACGCTCGACGTCCGGGACGGCGGCGGCGGCGGCGACGACGTCGCCGTCCTGGCCATCAAGGACGACGTCCGCGACGACACGCAGGACGCCGCGTCG
CTCCTGGACCGCCCGGCGCCCGGCGGGGCGGGGGGCGGCCTGTCCTCCAAGCTCAGGGCAGCGCGCGCGCGCCTCGGCCGCATCGCGTCGGGGAAGCGCGCCGCGGTGCCGCTCTCGGCG
CTGCTCCGCCGCGACCCCGACCGCGCCAGGCTCGACAGGAGCGTCGTCACCGCGCTCAGGGGCCTCCAGTTCCTCAACCAGGCCGCCGTCACCGAGGGCTGGCCCGAGGTCGAGAAGCGC
TTCCACCGCCTCGCCGTCGACGGCTTCCTCCTCCGCTCGCGATTCGGCCAGTGCATCG
GTGAGTCACCGTCCACCACTCTTCTTTCTTGCATCTCTCTCTCTCTCTCCACTGCTTCTCTA
AACCATTTGCTGCAGGGATGGTCGGATCCGAGGAGTTTGCGGCGCAGATCTTCGACGCCCTGGCACGGCGAAGGGGGATCACGGCAATGGTGCTCACCAAGGATCAGGTCCGGGAGTTCT
GGGAGCAGCTCTCTGATCCAGGATTCGATGCCAAGCTTCAGACCTTCTTTGACAT
GTATGTCATGACTCATGACTGGTTTACCCACTCCTATAGTCCAGTTTTTCCTCTGCTACCAGTGG
TCAAGTCAAGTGCATTCCGATACGACTTTCAGAAACTTTTAAGTCTGTTGATGTCTGAACTTGCTTGATTGTTAACTTGTTGCAGGGTTGACAAGAATGCCGATGGTCAGATCACTGAGG
AGGAGCTCAAGGAG
GTAATGTAACTAGTCGATGAAATGGATCAATGGTCCCCAACAAACATTGCTCAATTCAGTTATAACAATCTAAACTTTCTGAATTTCTTGCACCATCAGGTCCTCA
CTCTGACTGCCTCTGCGAACAAGCTGTCCAAGATCCTGGAGCGTGTGGACGAGTACACGGCGCTGATCATGGAGGAGCTCGATCCTGACAGCCTTGGCTACATCGAG
GTTATTACTCTTT
GCTTTGCAGTTTGCTTGCCCTCCCAATTCTGTATCAGCTTGACACTGACCTCCGAACCAATCAAACAAAACAGATCGCGAACCTGGAGTCGCTGCTGCTGCAGCCGCCGTCGCAGGCGCC
GACGAGGTTGGTGACGCACAGCTCCAACATCAGCCAGCTGATCAGCCAGAGGCTGGCGCCAGCGCGCGACGACGGCCCGCTCCGGCGCGGCGCCAGGGCCGTGCTCTACTTCGCGGAGGA
CAACTGGAAGCGCGTCTGGGTGATGGCGCTCTGGCTGGCCATCAACGCCGGACTCTTCACCTGGAAGTTCCTCGCGTACCGGCGCCACCCCACGTTCGACGTCATGGGCTACTGCGTCTG
CGTCGCCAAGGGCGGCGCCGAGACCACCAAGTTCAACATGGCGCTCATCCTGCTCCCCGTGTGCCGGAACACCATCACGTGGCTGCGGTCCCGGACCAGGCTCGGCGCCGCCGTCCCGTT
CAACGACAACATCAACTTCCACAAGGTGGTCGCCGGCGGCGTGGCGGTCGGCGTGGCGCTGCACGCCGTGACGCACCTCACGTGCGACTTCCCGCGGCTGCTGCACGCCAGCGCCGCCGC
GTACGAGCCCATGAAGGCGTACTTCGGCCAGCGCCGGATCCCCAACTACTGGTGGTTCGTCAGGGGCGTGGAGGGGATCACCGGCGTCATCATGGTCGTGCTCATGGCCGTCGCCTACAC
GCTGGCGCACCCGTGGTTCCGCCGGGGGAAGCTCAGCGAGGGCAACCCGCTGCGCCGGCTCAGCGGCTTCAACATGTTCTGGTACTCGCACCACCTCTTCGTCATCGTCTACGTCGCCTT
CGTCGTCCACGGCGTCTGCCTCTACATCAACAGGACGTGGTACAAACAGACG
GTAAAGCATTTCAGTGGCTTAGCTTGCTTTGAGAATTTATTCTAATCAACTTTTCAGTGACTTTCAGT
TCCTCACAACAAATGCGCATTTTCAGACATGGATGTACCTCGCCATTCCCATCCTTCTCTACGCCGGCGAGCGGCTTCTCCGGGCGCTGAGGTCCCATGGCCTCACCACCGTGAGGATCG
AGAAGGTTGCCCTGTACCCCGGGAATGTCATCGCCATTCACATGAGCAAGCCGCATGGGTTCAGCTACAAGAGCGGGCAGTACATCTACGTCAACTGCGGCGAGGTCTCGCCCTTCGAGT
G
GTAAAACCCGCCTCCGTCATTATTTTGCCGGGCCCGGCGTCGGCGACGGAGATCGCGCGCCATGGATGTTGATCTATCAGTTGCTCAATCCATTCGTGGCTGCAGGCACCCGTTCACCA
TCACCTCGGCGCCCGGCGACGACTACCTGAGCATGCACATCCGGTGCCGCGGCGACTGGACGGCCAGCTTCAGGGCGCTCTTCGCGCAGGTGTGCCGGCCGCCCGCCGCCGGCCAGAGCG
GCCTCCTGCGGGCCGACTTCGCGTCCTCCACGGCGGCCGGCGGCGGCGGGAAGCTGCCGAAGCTGCTGATCGACGGGCCCTACGGCGCCCCCGCGCAGGACTACCGCAAGTACGACGTGC
TCCTCCTCATCGGTCTCGGCATCGGCGCCACCCCGCTCATCAGCATCGTCAAGGACGTGCTCAACAACATCTCGGACAACAAAGACGAAGAGCAGCCGGCGGAGTTCATGACGCGGCGCG
TGTACTTCTACTGGTGCACGCGGGAGGAGGGCTCCTTCGAGTGGTTCCGCGGCGTGATGAACGAGGTGGCGGAGCGCGACGCCCGCGGCGACGTGGTGGAGCTCCACAACCACTGCACCA
GCGTGTACGAGGAAGGCGACGCGCGGTCGGCGCTGCTGGTGATGCTGCAAGCGCTGCACCACGCCAAGAGCGGCGTCGACGTGGTGTCCGGGACGCGGGTGCGCACGCACTTCGCGCGGC
CCAACTGGCGGGACGTCTTCAAGCGGGTGGCCTGCAACCACCAGGGCCAGCGCGTCGGCGTCTTCTACTGCGGCGACCAGAAGGTCACGCCGGAGCTCCGACGCCTGTCGCAGGACTTCT
CGCACAAGACCACCACCAAGTTCGTCTTCCACAAGGAGAACTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTCAAACCAGAACGAGAGCGGCGGCGGCGGCGGCGCGGGACCGCCGCTGCCGACGGCGTTCAAGAGCCCGTCCACGGACGGCAAGAGCGGCAGCCGCCGGAGCACGCGGTTCAAG
GACGAGGACGAGTACGTGGAGGTCACGCTCGACGTCCGGGACGGCGGCGGCGGCGGCGACGACGTCGCCGTCCTGGCCATCAAGGACGACGTCCGCGACGACACGCAGGACGCCGCGTCG
CTCCTGGACCGCCCGGCGCCCGGCGGGGCGGGGGGCGGCCTGTCCTCCAAGCTCAGGGCAGCGCGCGCGCGCCTCGGCCGCATCGCGTCGGGGAAGCGCGCCGCGGTGCCGCTCTCGGCG
CTGCTCCGCCGCGACCCCGACCGCGCCAGGCTCGACAGGAGCGTCGTCACCGCGCTCAGGGGCCTCCAGTTCCTCAACCAGGCCGCCGTCACCGAGGGCTGGCCCGAGGTCGAGAAGCGC
TTCCACCGCCTCGCCGTCGACGGCTTCCTCCTCCGCTCGCGATTCGGCCAGTGCATCG
GGATGGTCGGATCCGAGGAGTTTGCGGCGCAGATCTTCGACGCCCTGGCACGGCGAAGGGGG
ATCACGGCAATGGTGCTCACCAAGGATCAGGTCCGGGAGTTCTGGGAGCAGCTCTCTGATCCAGGATTCGATGCCAAGCTTCAGACCTTCTTTGACAT
GGTTGACAAGAATGCCGATGGT
CAGATCACTGAGGAGGAGCTCAAGGAG
GTCCTCACTCTGACTGCCTCTGCGAACAAGCTGTCCAAGATCCTGGAGCGTGTGGACGAGTACACGGCGCTGATCATGGAGGAGCTCGATCCT
GACAGCCTTGGCTACATCGAG
ATCGCGAACCTGGAGTCGCTGCTGCTGCAGCCGCCGTCGCAGGCGCCGACGAGGTTGGTGACGCACAGCTCCAACATCAGCCAGCTGATCAGCCAGAGG
CTGGCGCCAGCGCGCGACGACGGCCCGCTCCGGCGCGGCGCCAGGGCCGTGCTCTACTTCGCGGAGGACAACTGGAAGCGCGTCTGGGTGATGGCGCTCTGGCTGGCCATCAACGCCGGA
CTCTTCACCTGGAAGTTCCTCGCGTACCGGCGCCACCCCACGTTCGACGTCATGGGCTACTGCGTCTGCGTCGCCAAGGGCGGCGCCGAGACCACCAAGTTCAACATGGCGCTCATCCTG
CTCCCCGTGTGCCGGAACACCATCACGTGGCTGCGGTCCCGGACCAGGCTCGGCGCCGCCGTCCCGTTCAACGACAACATCAACTTCCACAAGGTGGTCGCCGGCGGCGTGGCGGTCGGC
GTGGCGCTGCACGCCGTGACGCACCTCACGTGCGACTTCCCGCGGCTGCTGCACGCCAGCGCCGCCGCGTACGAGCCCATGAAGGCGTACTTCGGCCAGCGCCGGATCCCCAACTACTGG
TGGTTCGTCAGGGGCGTGGAGGGGATCACCGGCGTCATCATGGTCGTGCTCATGGCCGTCGCCTACACGCTGGCGCACCCGTGGTTCCGCCGGGGGAAGCTCAGCGAGGGCAACCCGCTG
CGCCGGCTCAGCGGCTTCAACATGTTCTGGTACTCGCACCACCTCTTCGTCATCGTCTACGTCGCCTTCGTCGTCCACGGCGTCTGCCTCTACATCAACAGGACGTGGTACAAACAGACG
ACATGGATGTACCTCGCCATTCCCATCCTTCTCTACGCCGGCGAGCGGCTTCTCCGGGCGCTGAGGTCCCATGGCCTCACCACCGTGAGGATCGAGAAGGTTGCCCTGTACCCCGGGAAT
GTCATCGCCATTCACATGAGCAAGCCGCATGGGTTCAGCTACAAGAGCGGGCAGTACATCTACGTCAACTGCGGCGAGGTCTCGCCCTTCGAGTG
GCACCCGTTCACCATCACCTCGGCG
CCCGGCGACGACTACCTGAGCATGCACATCCGGTGCCGCGGCGACTGGACGGCCAGCTTCAGGGCGCTCTTCGCGCAGGTGTGCCGGCCGCCCGCCGCCGGCCAGAGCGGCCTCCTGCGG
GCCGACTTCGCGTCCTCCACGGCGGCCGGCGGCGGCGGGAAGCTGCCGAAGCTGCTGATCGACGGGCCCTACGGCGCCCCCGCGCAGGACTACCGCAAGTACGACGTGCTCCTCCTCATC
GGTCTCGGCATCGGCGCCACCCCGCTCATCAGCATCGTCAAGGACGTGCTCAACAACATCTCGGACAACAAAGACGAAGAGCAGCCGGCGGAGTTCATGACGCGGCGCGTGTACTTCTAC
TGGTGCACGCGGGAGGAGGGCTCCTTCGAGTGGTTCCGCGGCGTGATGAACGAGGTGGCGGAGCGCGACGCCCGCGGCGACGTGGTGGAGCTCCACAACCACTGCACCAGCGTGTACGAG
GAAGGCGACGCGCGGTCGGCGCTGCTGGTGATGCTGCAAGCGCTGCACCACGCCAAGAGCGGCGTCGACGTGGTGTCCGGGACGCGGGTGCGCACGCACTTCGCGCGGCCCAACTGGCGG
GACGTCTTCAAGCGGGTGGCCTGCAACCACCAGGGCCAGCGCGTCGGCGTCTTCTACTGCGGCGACCAGAAGGTCACGCCGGAGCTCCGACGCCTGTCGCAGGACTTCTCGCACAAGACC
ACCACCAAGTTCGTCTTCCACAAGGAGAACTTCTGA

Retrieve as FASTA