Entry information : ZmRboh02
Entry ID 5493
Creation 2007-07-23 (Christophe Dunand)
Last sequence changes 2011-08-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-08-12 (Christophe Dunand)
Peroxidase information: ZmRboh02
Name ZmRboh02
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Mixed tissues
Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmRboh02
start..stop
S start..stop
SbRboh10 1212 0 67..911 167..936
SbRboh10 73 0.0000000000002 1..66 1..72
ZmRboh06 1209 0 58..911 154..933
ZmRboh06 88 4e-18 1..64 1..59
TaRboh04 1161 0 58..911 144..917
OsRboh08 1147 0 67..911 170..936
OsRboh08 45 0.00006 10..59 18..64
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 224463160..224463499 340 N° 2 224463586..224463742 157 N° 3 224463870..224463921 52 N° 4 224463964..224465324 1361
N° 5 224465466..224465568 103 N° 6 224465637..224465707 71 N° 7 224466446..224466984 539 N° 8 224467172..224467284 113
join(224463160..224463499,224463586..224463742,224463870..224463921,224463964..2 24465324,224465466..224465568,224465637..224465707,224466446..224466984,22446717 2..224467284)


exon

Literature and cross-references ZmRboh02
Literature REFERENCE 1 Wilson,R.K. The sequence of Zea mays clone.
REFERENCE 2 Wen,T.J., Qiu,F., Guo,L., Ashlock,D.A and Schnable,P.S. Expressed Sequence Tags from B73 Maize: various stages and tissues including seedlings treated with a variety of hormones
Cluster/Prediction ref. UniGene:   Zm.11637
Protein sequence: ZmRboh02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   911
PWM (Da):   %s   102616.4 Transmb domain:   %s   o303-325i446-468o536-558i
PI (pH):   %s   9.41
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHNPRPGGGDIVEMSSSASAAGEATQNERVIPHSGSLSKSSARKSAGLEEPVTTPLSAPPPRASPSSAAMHALNGLMFISRAEGTVGWEAVERRFHELAENGLLHRSKFGECIGMKEVVFAGELFDALLRRSNISGDNIDKAELLKFWDQITDTSFNGRLQTFFHMVDADADGRMSEEKVRQQYNAAQTDTALPFFYSCPDGCICGMAERMQTITQRASENKLSKITEQAEEYARLIMEELDPDKLGYIEVRNLERLLEDPSQLVSIGTAKDMRQMLRSQSLRPTPEPNPLRRTQYFLEDNWRRVWVVLLWLSICVGLFAWKFAQYRRRYVFQVMGYCVCVAKGGAETLKFNMALILLPVCRNTITWIRNHTGVGRVVPFDDNISFHMVVAAGIAVGAGLHVVSHLTCDFPRLLRATDAAYAPLAQYFGVPRPRNYWWFVKGTEGWTGLAMLVLMAVAFTLAMPWFRRGELALTDLLKRLVGPLKRLTDTLKLTDPLKRLTGQLKRLTAGPRKRPTDPLKPTDPLKRLTGFNAFWYTHHCFVAVYALLLVHGHYLYLTHKWYKKSTWMYLAVPMVLYACERLTRALRSRVRAVRIRKVGVYPGDVLSLHFSKPPGFSYKSGQYMFVNCADVSPFEWHPFCITSAPQDEYLSVHIKKQGDWTGELRNVFSVCRPPTEGNSRLLRDGSANSLSLRFPKVRIDGPYGAPAQDYKQYDVVLLVGQGIGATPMISIIKDIINNMKQLDGDLEADAGSGLGSGGVDASSSSSLPSFRTQRAYFYWVTREQGSFEWFHGIMDEVAETDKKGIIELHNHCTSVYKDGDLRSRVIAQLQMLNQAKHNIDVISGTRVKTHFARPDWPNVYKHIAENHQNQRGVFYCGGGPEPLKTLRELAKDFSRKTNTKFEFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 2, 6 introns) and 3 ESTs. Cultivar="B73".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATAACCCCAGGCCGGGCGGCGGGGACATCGTGGAGATGTCGTCGTCAGCCAGCGCGGCGGGCGAGGCGACGCAAAACGAGCGCGTGATCCCACATAGCGGCTCGCTGAGCAAGTCC
AGCGCGCGGAAGAGTGCGGGGTTAGAGGAGCCCGTGACGACGCCGCTGTCCGCGCCACCGCCGCGCGCCTCGCCGTCCTCCGCCGCCATGCACGCGCTCAATGGGCTCATGTTCATCAGC
AGGGCCGAGGGCACCGTCGGATGGGAGGCTGTGGAGAGGCGCTTCCACGAGCTCGCCGAGAACGGGCTCCTCCACCGCTCCAAGTTCGGCGAGTGCATCG
GTGGGTGACCGAGAGCCTTT
TACCTGCCTGTTCTTTCGAGGTGGTGTTCACATGGAAATACGATGGATGAACAACAAACACTACAGGGATGAAGGAGGTGGTGTTCGCCGGCGAGCTGTTCGACGCGCTGTTGCGGCGCA
GCAACATCTCGGGCGACAACATCGACAAGGCGGAGCTGCTCAAGTTCTGGGACCAAATCACCGACACCAGCTTCAACGGCCGACTGCAGACTTTCTTCCACAT
GTACGTCATCATTGATG
CGGATTGGCTTACTTGTACTAATAATTTCTGCAGGAGTATTAGTAACAGGTACTCCCTTAATTACGGACCGTGAGTGACCAAATTAACCTCCCTTCGGTTACCCTTGCAGGGTGGACGCG
GACGCGGACGGCAGGATGTCTGAGGAGAAGGTCAGACAGGTA
ACTTTTTCAGCAGCCTTTCTCCAGTTGGTTTAGCCGGAACAGCAATATAATGCCGCACAAACAGACACAGCCTTGCCT
TTCTTCTATTCCTGCCCTGATGGATGTATCTGCGGCATGGCGGAGCGCATGCAGACCATCACGCAGAGGGCGTCCGAGAACAAGCTGTCGAAGATCACAGAGCAGGCGGAGGAGTACGCC
CGGCTGATCATGGAGGAGCTGGACCCGGACAAACTCGGCTACATCGAGGTGCGCAACCTGGAGAGGCTGCTGGAGGACCCCAGCCAGTTGGTGAGCATCGGCACCGCCAAGGACATGAGG
CAGATGCTGAGGAGCCAGAGCCTCCGTCCGACGCCCGAGCCGAACCCTCTCCGGCGCACGCAGTACTTCCTGGAGGACAACTGGCGGCGCGTGTGGGTGGTGCTCCTGTGGCTGTCCATC
TGCGTGGGTCTCTTCGCCTGGAAGTTTGCCCAGTACCGGCGCCGGTACGTGTTCCAGGTGATGGGGTACTGCGTGTGCGTGGCCAAGGGCGGCGCCGAGACGCTCAAGTTCAACATGGCG
CTGATCCTGCTCCCTGTGTGCCGGAACACCATCACCTGGATCCGCAACCACACCGGCGTGGGCCGCGTGGTGCCCTTCGACGACAACATCAGCTTCCACATGGTGGTGGCCGCGGGCATC
GCCGTCGGCGCCGGGCTCCACGTGGTGTCCCACCTGACGTGCGACTTCCCGCGGCTGCTCCGCGCCACGGACGCCGCGTACGCGCCCCTGGCGCAGTACTTCGGGGTGCCCCGCCCGCGC
AACTACTGGTGGTTCGTGAAGGGCACGGAGGGGTGGACGGGGCTCGCCATGCTCGTGCTCATGGCCGTCGCCTTCACCCTGGCGATGCCGTGGTTCCGCCGCGGGGAGCTCGCGCTGACG
GACCTGCTGAAGCGGCTGGTAGGCCCGCTGAAGCGGCTGACGGACACGCTCAAGCTGACGGACCCGCTGAAGCGGCTGACGGGCCAGCTCAAGCGGCTGACTGCAGGCCCGCGGAAGCGG
CCGACGGACCCGCTCAAGCCGACGGACCCGCTGAAGCGGCTGACGGGTTTCAACGCGTTCTGGTACACGCACCACTGCTTCGTGGCGGTGTACGCGCTGCTGCTGGTGCACGGGCACTAC
CTGTACCTGACGCACAAGTGGTACAAGAAGTCGACGTGGATGTACCTGGCCGTGCCCATGGTGCTGTACGCGTGCGAGCGCCTCACGCGGGCGCTCCGCTCCAGGGTCCGCGCCGTCAGG
ATCCGCAAGGTGGGCGTGTACCCGGGCGACGTGCTCTCGCTCCACTTCTCCAAGCCGCCGGGCTTCAGCTACAAGAGCGGCCAGTACATGTTCGTCAACTGCGCCGACGTCTCACCGTTC
GAGTG
GTAATAAGCAGCTAGCGTTCTTCTTCTTCTCGTTCAAGCTTGGAGTTTAATTAATCATTGCACACAGAGGCTAGTATAGATGGTCAATAGTGCCGGATTAATCGGGCAGGTCCGG
AGCACGGCACAGCCCATAGTGCCCAGGCACCCGTTCTGCATCACGTCAGCCCCACAGGATGAGTACCTGAGCGTCCACATCAAGAAACAGGGCGACTGGACCGGCGAGCTCCGGAACGTC
TTCTCGAGG
GTATGTACATGTACATGCATATCCGTGCTGACCGCTGAGGCTAATAACGTACGTGCTGACGTGTGCAGGTGTGCCGGCCGCCGACGGAGGGCAACAGTCGGCTGCTCCGCG
ACGGCAGCGCCAATTCTCTATCTCTACG
GTACATGTGATAGCTCTCACGTTTACACCTAGCCAACAGAGAACAATTTTAAATAATAAACAAAATTATAGTAATGTACGGGTTAAGCATAA
ATAAAACCTTAGTCTCATATAAATTATAGTGTAAAATAGCCTTTGCCGAGTGTCTTAGACACTCGGTAAAGAACGCGATTCCGATAGTGATGGATCATTATTCCCTTGTTCTTAGCCATC
ATATTCCGCTCCGAATATTGTTAAAAGAAATATAGATAAATAAATCTTTGGGACAAAGGTCGACATGGGTTAGGCACTCCAGGGACAGTTGACTTCGCGCCCCCTCTCGCAACCAACTTT
TTTTTAAAAAAAATATACTCTCTCCACCGTACCGTCCACACAGAAGAATATAATTCTAGCAAACAATTTAAAACTCTAAATACAGTTATATACTAAACAATTATGATATAAATAAAAAAG
TACTATCAGTTAGCTATATAATAATGTACTCCCTTCGTCTCAAAATAGTGTATTCGTCTTATCTCTATATTTTTATGTCTATATTCAACTGTATGATGATGAATGTATACGTATATACAG
AACACATATATACATCAATTATTATATGAATCTAATAAAAAAGCCTAAAACGAATTTTGTTTTGGGACACAAATTTATTTCGTTACACAAATACTAGCGCTATTTATTACTATAGTCAAA
CTTCAGTTAGTTTGAATTCCCATTTCATGAAATGGTTGTTTTGTAGCTTCCCCAAGGTGAGGATCGACGGCCCGTACGGCGCGCCGGCGCAGGACTACAAGCAGTACGATGTCGTGCTTC
TGGTCGGGCAGGGCATTGGCGCTACGCCGATGATCTCCATCATCAAGGACATCATCAACAACATGAAGCAGCTAGATGGCGACCTGGAGGCCGACGCTGGCTCGGGCTTGGGCTCCGGCG
GTGTCGACGCGTCGTCGTCGTCGTCGCTGCCATCCTTCCGCACGCAGCGGGCCTACTTCTACTGGGTGACCCGGGAGCAGGGCTCCTTCGAGTGGTTCCATGGCATCATGGACGAGGTGG
CCGAGACCGACAAGAAGGGCATCATCGAGCTCCACAACCACTGCACCAGCGTGTACAAGGACGGGGACCTCCGCTCCAGGGTCATCGCCCAGCTTCAAATGCTCAACCAGGCCAAGCACA
ACATCGACGTTATTTCCGGCACCCGCGTCAAGACCCACTTCGCCAGGCCCGATTGGCCAAACGTCTACAAGCACATTGCGGAGAACCACCAAAACCAACGTGTTG
GTAAGATTTTTTTTT
TTTTGCATTGCTCAGTCGCCATTCTAGCTACTTTAGACACATGCATGCATGCATTATACTGCTACTTTAGCCAGCTTATCGTCAACGTCATAGACAATGAAATAGATGATTTAGGAAAGA
ATTGGATTTCTGAATCAGCGTTGATAGTTACCTCTGATCTTTGATATTGCAGGAGTGTTCTACTGTGGCGGTGGCCCGGAGCCGCTAAAGACGCTGCGCGAACTCGCCAAGGATTTCTCG
CGGAAAACCAACACCAAGTTCGAGTTCCACAAGGAGAACTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATAACCCCAGGCCGGGCGGCGGGGACATCGTGGAGATGTCGTCGTCAGCCAGCGCGGCGGGCGAGGCGACGCAAAACGAGCGCGTGATCCCACATAGCGGCTCGCTGAGCAAGTCC
AGCGCGCGGAAGAGTGCGGGGTTAGAGGAGCCCGTGACGACGCCGCTGTCCGCGCCACCGCCGCGCGCCTCGCCGTCCTCCGCCGCCATGCACGCGCTCAATGGGCTCATGTTCATCAGC
AGGGCCGAGGGCACCGTCGGATGGGAGGCTGTGGAGAGGCGCTTCCACGAGCTCGCCGAGAACGGGCTCCTCCACCGCTCCAAGTTCGGCGAGTGCATCG
GGATGAAGGAGGTGGTGTTC
GCCGGCGAGCTGTTCGACGCGCTGTTGCGGCGCAGCAACATCTCGGGCGACAACATCGACAAGGCGGAGCTGCTCAAGTTCTGGGACCAAATCACCGACACCAGCTTCAACGGCCGACTG
CAGACTTTCTTCCACAT
GGTGGACGCGGACGCGGACGGCAGGATGTCTGAGGAGAAGGTCAGACAGGTACAATATAATGCCGCACAAACAGACACAGCCTTGCCTTTCTTCTATTCCTGC
CCTGATGGATGTATCTGCGGCATGGCGGAGCGCATGCAGACCATCACGCAGAGGGCGTCCGAGAACAAGCTGTCGAAGATCACAGAGCAGGCGGAGGAGTACGCCCGGCTGATCATGGAG
GAGCTGGACCCGGACAAACTCGGCTACATCGAGGTGCGCAACCTGGAGAGGCTGCTGGAGGACCCCAGCCAGTTGGTGAGCATCGGCACCGCCAAGGACATGAGGCAGATGCTGAGGAGC
CAGAGCCTCCGTCCGACGCCCGAGCCGAACCCTCTCCGGCGCACGCAGTACTTCCTGGAGGACAACTGGCGGCGCGTGTGGGTGGTGCTCCTGTGGCTGTCCATCTGCGTGGGTCTCTTC
GCCTGGAAGTTTGCCCAGTACCGGCGCCGGTACGTGTTCCAGGTGATGGGGTACTGCGTGTGCGTGGCCAAGGGCGGCGCCGAGACGCTCAAGTTCAACATGGCGCTGATCCTGCTCCCT
GTGTGCCGGAACACCATCACCTGGATCCGCAACCACACCGGCGTGGGCCGCGTGGTGCCCTTCGACGACAACATCAGCTTCCACATGGTGGTGGCCGCGGGCATCGCCGTCGGCGCCGGG
CTCCACGTGGTGTCCCACCTGACGTGCGACTTCCCGCGGCTGCTCCGCGCCACGGACGCCGCGTACGCGCCCCTGGCGCAGTACTTCGGGGTGCCCCGCCCGCGCAACTACTGGTGGTTC
GTGAAGGGCACGGAGGGGTGGACGGGGCTCGCCATGCTCGTGCTCATGGCCGTCGCCTTCACCCTGGCGATGCCGTGGTTCCGCCGCGGGGAGCTCGCGCTGACGGACCTGCTGAAGCGG
CTGGTAGGCCCGCTGAAGCGGCTGACGGACACGCTCAAGCTGACGGACCCGCTGAAGCGGCTGACGGGCCAGCTCAAGCGGCTGACTGCAGGCCCGCGGAAGCGGCCGACGGACCCGCTC
AAGCCGACGGACCCGCTGAAGCGGCTGACGGGTTTCAACGCGTTCTGGTACACGCACCACTGCTTCGTGGCGGTGTACGCGCTGCTGCTGGTGCACGGGCACTACCTGTACCTGACGCAC
AAGTGGTACAAGAAGTCGACGTGGATGTACCTGGCCGTGCCCATGGTGCTGTACGCGTGCGAGCGCCTCACGCGGGCGCTCCGCTCCAGGGTCCGCGCCGTCAGGATCCGCAAGGTGGGC
GTGTACCCGGGCGACGTGCTCTCGCTCCACTTCTCCAAGCCGCCGGGCTTCAGCTACAAGAGCGGCCAGTACATGTTCGTCAACTGCGCCGACGTCTCACCGTTCGAGTG
GCACCCGTTC
TGCATCACGTCAGCCCCACAGGATGAGTACCTGAGCGTCCACATCAAGAAACAGGGCGACTGGACCGGCGAGCTCCGGAACGTCTTCTCGAGG
GTGTGCCGGCCGCCGACGGAGGGCAAC
AGTCGGCTGCTCCGCGACGGCAGCGCCAATTCTCTATCTCTACG
CTTCCCCAAGGTGAGGATCGACGGCCCGTACGGCGCGCCGGCGCAGGACTACAAGCAGTACGATGTCGTGCTTCTG
GTCGGGCAGGGCATTGGCGCTACGCCGATGATCTCCATCATCAAGGACATCATCAACAACATGAAGCAGCTAGATGGCGACCTGGAGGCCGACGCTGGCTCGGGCTTGGGCTCCGGCGGT
GTCGACGCGTCGTCGTCGTCGTCGCTGCCATCCTTCCGCACGCAGCGGGCCTACTTCTACTGGGTGACCCGGGAGCAGGGCTCCTTCGAGTGGTTCCATGGCATCATGGACGAGGTGGCC
GAGACCGACAAGAAGGGCATCATCGAGCTCCACAACCACTGCACCAGCGTGTACAAGGACGGGGACCTCCGCTCCAGGGTCATCGCCCAGCTTCAAATGCTCAACCAGGCCAAGCACAAC
ATCGACGTTATTTCCGGCACCCGCGTCAAGACCCACTTCGCCAGGCCCGATTGGCCAAACGTCTACAAGCACATTGCGGAGAACCACCAAAACCAACGTGTTG
GAGTGTTCTACTGTGGC
GGTGGCCCGGAGCCGCTAAAGACGCTGCGCGAACTCGCCAAGGATTTCTCGCGGAAAACCAACACCAAGTTCGAGTTCCACAAGGAGAACTTCTAG

Retrieve as FASTA