Entry information : CcinDyPrx01
Entry ID 5541
Creation 2007-07-13 (Christophe Dunand)
Last sequence changes 2007-07-13 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2010-08-13 (Marie Brette (Scipio))
Peroxidase information: CcinDyPrx01
Name CcinDyPrx01
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Psathyrellaceae Coprinopsis
Organism Coprinopsis cinerea (Coprinus cinereus)    [TaxId: 5346 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcinDyPrx01
start..stop
S start..stop
GmarDyPrx01 568 0 12..493 4..486
HsubDyPrx01 564 0 13..491 6..489
HcyDyPrx02 559 0 1..493 1..486
LbiDyPrx01 553 0 12..491 23..500
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 491386..491465 80 N° 2 491107..491326 220 N° 3 490716..491035 320 N° 4 490345..490655 311
N° 5 489910..490291 382 N° 6 489681..489849 169  
complement(join(489681..489849,489910..490291,490345..490655,490716..491035,4911 07..491326,491386..491465))


exon

Literature and cross-references CcinDyPrx01
Literature The Broad Institute Genome Sequencing Platform. Annotation of the Coprinopsis cinerea genome. Unpublished
DNA ref. JGI genome:   Chr_4 (491465..489684)
Protein sequence: CcinDyPrx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   493
PWM (Da):   %s   54610.68  
PI (pH):   %s   6.31
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSTNTSAPAKPTPTTGLDLNNIQGDILGGMPKKTELYYFFQITNASDFRKHLIKFAPLVKTAAQVLQDRKKINDSKKHGGHGLIPMSGVNVSFSHLGFQMGIDDSTLSLDDSDPFKLGQRVDAVQNLGDPTKPSAPEVDPLPNWEPEFLNDIHGIFLVAAESFATAQKKLKEVEGFFHVGKPEASINKVKLIVGNVRPGKEHAHEHFGFLDGISNPAVAGFDPVTLPGQGQVRPGIILTGHPGDEDGNGNPIQRESWAVDGSFLAFRYLFQKVPEFNEYLKQNPLNFGDLTPEEGSELLGARMVGRWKGAPIDITPFKDDPELAKDPQRNNNFKFEDQLNSQFKCPFAAHIRKTNPRDDLESRNISVEPRRIIRRGIQFGPEVTDEEKECKQTKEERGLLFACYQSSIRRGFQFMQQSWANATNFPPFEQQPEVPGFDPLIGQGADRKMSGLDPNQPTRELSFPDFVVPRGGEYFFAPSIKALKETLGATA

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns). No EST. Strain="okayama7#130".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCACAAACACCTCTGCCCCTGCCAAACCTACCCCCACTACAGGCCTTGACTTGAACAACATTCAAGGCGACATCCTGTACGTATCACTGCTGCAGCTACCTTCCGTTCTTCGGCTA
ACGAGTCACGACTGAATAGTGGTGGGATGCCAAAGAAGACCGAGCTCTACTACTTCTTCCAAATCACCAACGCGTCAGATTTCCGCAAACATCTCATCAAATTCGCGCCTCTCGTCAAGA
CGGCCGCACAAGTCTTGCAGGACCGCAAGAAGATCAATGACTCGAAGAAACATGGCGGCCACGGCTTGATCCCCATGAGCGGTGTAAACGTTTCATTCTCCCATCTCGGATTCCAGAAG
G
TACATTGTCTGTCCAAACACGTGATGTACTAGAGCGTATCTCTGACGACAGTACTGTTACATGCTCGCAGATGGGAATCGACGATTCCACACTCTCCCTCGACGACTCGGACCCATTCAA
GCTTGGCCAACGCGTAGATGCCGTCCAGAACTTGGGCGACCCAACCAAGCCCTCCGCTCCCGAGGTCGACCCTCTGCCCAACTGGGAACCCGAATTCCTCAACGATATCCACGGTATCTT
TCTGGTCGCGGCCGAAAGCTTTGCCACTGCCCAGAAGAAGCTCAAGGAAGTCGAAGGGTTCTTCCACGTCGGAAAGCCTGAAGCGTCTATCAACAAAGTCAAGTTGATCGTCGGTAACGT
TCGCCCCGGCAAGGAGCATGCGCACGAACA
GTACGTCTTTCCTCGGTTATCTTTGTTGTAATCATGGGCGTAACGAAGCCGACCTCATAGCTTCGGCTTCCTCGACGGAATCTCTAATCC
CGCCGTGGCTGGTTTCGACCCAGTCACGCTCCCAGGACAAGGCCAGGTTCGACCTGGCATCATCCTGACTGGACATCCCGGCGACGAAGACGGCAACGGGAACCCAATCCAGCGTGAATC
CTGGGCTGTCGATGGCAGCTTCCTCGCTTTCAGGTACCTCTTCCAGAAGGTTCCCGAGTTCAACGAATACTTGAAGCAGAACCCACTCAACTTCGGCGATTTGACGCCCGAAGAGGGAAG
CGAGCTCTTGGGCGCTAGAATGGTCGGCAGGTGGAAGAGCG
GTACGTTTTTTTCTTAAATCATTTGGGATGTACACTAAAAATGCGTTATTAAGGTGCACCCATTGATATCACCCCCTTC
AAGGATGACCCCGAGTTGGCCAAAGACCCTCAGAGGAACAACAACTTCAAATTCGAAGACCAACTCAATTCACAATTCAAGTGCCCCTTCGCCGCACACATCCGCAAGACCAACCCGCGT
GACGACCTTGAGTCACGCAACATCTCAGTCGAGCCACGTCGCATCATCCGACGTGGTATTCAATTCGGCCCAGAGGTCACAGACGAAGAGAAGGAATGCAAGCAAACAAAGGAAGAGCGT
GGTCTACTCTTTGCTTGCTACCAGAGCAGCATCAGGCGAGGATTCCAATTCATGCAACAGAGCTGGGCGAATGCGACGAACTTCCCGCCCTTTGAACAACAGCCTGAGGTTCCAGG
GTAA
GTCTTGCCAAACAAAAAGAAATACCTTCTTGGAAAGGCTGACTCCGTTGGGGATAGATTCGACCCTCTCATTGGTCAAGGTGCCGACCGTAAGATGTCGGGATTGGACCCCAACCAGCCC
ACTAGGGAGTTGTCGTTCCCTGACTTCGTCGTTCCCCGAGGAGGCGAATATTTCTTTGCGCCCTCTATCAAGGCCCTGAAGGAAACTTTGGGCGCTACTGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCACAAACACCTCTGCCCCTGCCAAACCTACCCCCACTACAGGCCTTGACTTGAACAACATTCAAGGCGACATCCTTGGTGGGATGCCAAAGAAGACCGAGCTCTACTACTTCTTC
CAAATCACCAACGCGTCAGATTTCCGCAAACATCTCATCAAATTCGCGCCTCTCGTCAAGACGGCCGCACAAGTCTTGCAGGACCGCAAGAAGATCAATGACTCGAAGAAACATGGCGGC
CACGGCTTGATCCCCATGAGCGGTGTAAACGTTTCATTCTCCCATCTCGGATTCCAGAAG
ATGGGAATCGACGATTCCACACTCTCCCTCGACGACTCGGACCCATTCAAGCTTGGCCAA
CGCGTAGATGCCGTCCAGAACTTGGGCGACCCAACCAAGCCCTCCGCTCCCGAGGTCGACCCTCTGCCCAACTGGGAACCCGAATTCCTCAACGATATCCACGGTATCTTTCTGGTCGCG
GCCGAAAGCTTTGCCACTGCCCAGAAGAAGCTCAAGGAAGTCGAAGGGTTCTTCCACGTCGGAAAGCCTGAAGCGTCTATCAACAAAGTCAAGTTGATCGTCGGTAACGTTCGCCCCGGC
AAGGAGCATGCGCACGAACA
CTTCGGCTTCCTCGACGGAATCTCTAATCCCGCCGTGGCTGGTTTCGACCCAGTCACGCTCCCAGGACAAGGCCAGGTTCGACCTGGCATCATCCTGACT
GGACATCCCGGCGACGAAGACGGCAACGGGAACCCAATCCAGCGTGAATCCTGGGCTGTCGATGGCAGCTTCCTCGCTTTCAGGTACCTCTTCCAGAAGGTTCCCGAGTTCAACGAATAC
TTGAAGCAGAACCCACTCAACTTCGGCGATTTGACGCCCGAAGAGGGAAGCGAGCTCTTGGGCGCTAGAATGGTCGGCAGGTGGAAGAGCG
GTGCACCCATTGATATCACCCCCTTCAAG
GATGACCCCGAGTTGGCCAAAGACCCTCAGAGGAACAACAACTTCAAATTCGAAGACCAACTCAATTCACAATTCAAGTGCCCCTTCGCCGCACACATCCGCAAGACCAACCCGCGTGAC
GACCTTGAGTCACGCAACATCTCAGTCGAGCCACGTCGCATCATCCGACGTGGTATTCAATTCGGCCCAGAGGTCACAGACGAAGAGAAGGAATGCAAGCAAACAAAGGAAGAGCGTGGT
CTACTCTTTGCTTGCTACCAGAGCAGCATCAGGCGAGGATTCCAATTCATGCAACAGAGCTGGGCGAATGCGACGAACTTCCCGCCCTTTGAACAACAGCCTGAGGTTCCAGG
ATTCGAC
CCTCTCATTGGTCAAGGTGCCGACCGTAAGATGTCGGGATTGGACCCCAACCAGCCCACTAGGGAGTTGTCGTTCCCTGACTTCGTCGTTCCCCGAGGAGGCGAATATTTCTTTGCGCCC
TCTATCAAGGCCCTGAAGGAAACTTTGGGCGCTACTGCTTGA

Retrieve as FASTA