Entry information : GmPrx57 (Glyma15g13550.1)
Entry ID 556
Creation 2007-02-02 (Christophe Dunand)
Last sequence changes 2011-07-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx57 (Glyma15g13550.1)
Name (synonym) GmPrx57 (Glyma15g13550.1)
Class Class III peroxidase    [Orthogroup: Prx043]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Cotyledons
Germinating seeds
Infected roots
Roots
Roots hairs
Seedling roots
Inducers Cyst nematode infection
Wounding
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx57
start..stop
S start..stop
GmPrx58 641 0 1..350 1..349
GmPrx85 547 0 23..350 26..354
GmPrx08 543 0 1..350 1..355
MtPrx10 539 0 1..350 1..353
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10146311..10146523 213 N° 2 10147329..10147520 192 N° 3 10147691..10147856 166 N° 4 10148273..10148754 482
join(10146311..10146523,10147329..10147520,10147691..10147856,10148273..10148754 )


exon

Literature and cross-references GmPrx57 (Glyma15g13550.1)
Literature Public Soybean EST Project. Vodkin,L Functional Genomics Program for Soybean. Scheffler,et al Expressed sequence tags from soybean root hair subtractive cDNA.
DNA ref. Phytozome 11:   Gm15 (10146311..10148754)
Protein sequence: GmPrx57 (Glyma15g13550.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   351 (326)
PWM (Da):   %s   38103.68 (35541.3)  
PI (pH):   %s   8.41 (8.31) Peptide Signal:   %s   cut: 25 range:25-350
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRCFGFIVIGLVAVLGGLPFSSNAKLEPCFYKKTCPQVHFIVFKVVEKVSRTDPRMPASLVRLFFHDCFVQGCDASILLNNTATIVSEQQALPNNNSIRGLDVVNQIKTELEKACPGVVSCADILTLAAEVSSVLAHGPYLKFPLGRRDSLTANRTLANQNLPAPFFNLTQLKAAFAVQGLDTTDLVALSGAHSFGRVRCLFILDRLYNFSGTGRPDPTLDTTYLKQLRQICPQGGPPNNLVNFDPTTPDTLDKNYYSNLQVKKGLLQSDQELFSTPGADTISIVNKFSSDQIAFFKSFSASMIKMGNIGVLTGKKGEIRKQCNFVNKKSAELDIGSVASESEEGLVSSI

Retrieve as FASTA  
Remarks complete sequence from genomic and 19+32 ESTs. Two independant compiles TC204494, TC190243 (partial seq) with 3 AA mismatches. TC19024.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTGTTTTGGTTTTATAGTGATAGGTCTAGTGGCTGTGCTTGGAGGGTTACCCTTCTCCTCAAATGCAAAATTAGAACCCTGTTTTTACAAGAAGACTTGTCCCCAGGTGCATTTT
ATTGTATTTAAAGTCGTAGAGAAAGTTTCAAGAACGGATCCACGTATGCCTGCCAGTCTCGTTAGGCTTTTCTTCCATGACTGTTTTGTTCAA
GTATGTAAATTTACTTGCTTATTCATC
CTCCCTTTCTATCTAATTTAGTTAATCCTTTCCTGCTTTAAATGACAAATCCCACAATTAAAATCAAAATAAATCCCTTGCTCCAATTTTATTTTTTTTATCTCTGAGTGGGTTTATTAG
TCTCAAATAATTAAGCTCGTAGTATTTTGAATTCTTTTATCACTTTAGGTACTCTTTTTCCATTTAAAACATTTAATGAGTCATATTTGAGTTTGATTTTCATGTATTGTTGGTATAAAA
TTGTTTATACTATTAACCAAACAAAAATAATTTAGGTATGACTTTTAACTTAGTTATTATGTAAAAAAAAAAAAAAACTTAGTTATTATAGGTAAGTTTGTTTAAGTTTATTTTAAAGAA
AAATCCTTATTTTAATAAAATAAATCATTTTATACTTTATGATCTGCCTGTCTAACTGTTTTTACTTTTTCTTTACAACCACAGCTCCTCTGTAATTTAAATTCGTTATATTTTGCTATT
AGACATTCAAATAATGCATGAGATCATAAAAGCAGGGAACACCTTGTTTATTTCAACAAAATCCCACAACAGAACGCGACCTTATAAAAATTATACCCGAATTTTATTTTATTTTTTAAA
GAAAAAACGTTTGTCTCGTCTCAAATTAAAAGTAAGTGGTTTGGATTTTGGAATGTCGAAAATTTCTAGTGGGAACTACACAAATGTTCAAGAAAAGAAATTGATTCTTACTTCGTCATG
TGTATTTGTTGAGAATGAACAAGAAATGAATTATGTTGTTTATGCTTGTGGCATGCAGGGGTGTGATGCATCAATTTTGTTGAACAACACTGCCACCATAGTGAGTGAGCAACAAGCTCT
GCCAAACAACAACTCAATAAGAGGTTTGGATGTTGTAAACCAGATCAAGACAGAGTTGGAAAAAGCTTGCCCTGGCGTAGTTTCTTGCGCTGATATTCTTACCCTTGCAGCTGAAGTATC
TTCTGTTCTG
GTATGTCTCATTTTAGGTCAAAGAAAAAAACTTAGATCAACTTCTTTTGTTACATCCTTTTTTATCAAGTTGTCCAATCAAATAACAACAAATAAATGTTTATATATTGC
AACATATATTTAATAGAGGTTGTTTATTATTAGAAAGAATATTCATGTATCATTTGACAGGCTCATGGTCCTTATTTGAAATTTCCCTTGGGAAGGAGGGATAGTTTAACAGCAAATAGA
ACCCTTGCGAATCAAAACCTTCCTGCTCCTTTCTTCAACCTCACTCAACTTAAAGCTGCCTTTGCTGTTCAAGGCCTTGACACTACCGATCTTGTTGCACTCTCAG
GTAATAAATATTCC
CCAATTCAAATTATCCTATGTGTTGCAACAATTAATGCTACCTATAATAACAACAACAATAAAACACCTATAGTTGATCCGAGTAGAATTGGACTCAGATCCTTTAAATAAGATCTCGAG
TTTAAATCTTATAAAAAAAATATGATTAAAAAGAAAAATGTCACTATTCTTAATAGGGATTAGATATTAAAAAAAAATGATGAATACTTCGTAGTTCGCATCAATATCACACTAATGAAA
AAAAAATCTTAGAAATTCAGGGTAAGATATAAGATATTGGATTTACTGGTGAACACATTAACATTACTCTAAATTCACCATCTTAACTTGGTTTGACTTTGGAAGAATTCATCTTATGAA
AATGATGGACTAGTATATGATTTGTATATGATTCAATTTCAGGAGCTCATTCATTTGGCAGAGTTCGCTGCTTATTCATTCTTGACCGATTGTACAATTTCAGTGGTACTGGCAGACCCG
ATCCAACTCTTGACACAACTTACTTAAAACAATTGCGCCAAATATGCCCCCAAGGTGGGCCCCCTAACAACCTTGTCAATTTTGACCCAACCACTCCTGATACATTGGACAAGAACTACT
ACTCCAATCTTCAGGTTAAGAAGGGTTTGCTTCAGAGTGATCAAGAGTTGTTCTCAACACCTGGTGCTGATACCATCAGCATTGTCAACAAATTCAGTAGTGACCAAATAGCTTTCTTTA
AGAGCTTTTCGGCTTCCATGATTAAAATGGGAAATATTGGTGTGCTAACTGGGAAGAAAGGAGAAATCAGAAAACAATGTAACTTTGTTAACAAGAAATCTGCGGAACTTGATATAGGTA
GTGTGGCATCCGAATCAGAAGAGGGTCTGGTTAGCTCAATATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTGTTTTGGTTTTATAGTGATAGGTCTAGTGGCTGTGCTTGGAGGGTTACCCTTCTCCTCAAATGCAAAATTAGAACCCTGTTTTTACAAGAAGACTTGTCCCCAGGTGCATTTT
ATTGTATTTAAAGTCGTAGAGAAAGTTTCAAGAACGGATCCACGTATGCCTGCCAGTCTCGTTAGGCTTTTCTTCCATGACTGTTTTGTTCAA
GGGTGTGATGCATCAATTTTGTTGAAC
AACACTGCCACCATAGTGAGTGAGCAACAAGCTCTGCCAAACAACAACTCAATAAGAGGTTTGGATGTTGTAAACCAGATCAAGACAGAGTTGGAAAAAGCTTGCCCTGGCGTAGTTTCT
TGCGCTGATATTCTTACCCTTGCAGCTGAAGTATCTTCTGTTCTG
GCTCATGGTCCTTATTTGAAATTTCCCTTGGGAAGGAGGGATAGTTTAACAGCAAATAGAACCCTTGCGAATCAA
AACCTTCCTGCTCCTTTCTTCAACCTCACTCAACTTAAAGCTGCCTTTGCTGTTCAAGGCCTTGACACTACCGATCTTGTTGCACTCTCAG
GAGCTCATTCATTTGGCAGAGTTCGCTGC
TTATTCATTCTTGACCGATTGTACAATTTCAGTGGTACTGGCAGACCCGATCCAACTCTTGACACAACTTACTTAAAACAATTGCGCCAAATATGCCCCCAAGGTGGGCCCCCTAACAAC
CTTGTCAATTTTGACCCAACCACTCCTGATACATTGGACAAGAACTACTACTCCAATCTTCAGGTTAAGAAGGGTTTGCTTCAGAGTGATCAAGAGTTGTTCTCAACACCTGGTGCTGAT
ACCATCAGCATTGTCAACAAATTCAGTAGTGACCAAATAGCTTTCTTTAAGAGCTTTTCGGCTTCCATGATTAAAATGGGAAATATTGGTGTGCTAACTGGGAAGAAAGGAGAAATCAGA
AAACAATGTAACTTTGTTAACAAGAAATCTGCGGAACTTGATATAGGTAGTGTGGCATCCGAATCAGAAGAGGGTCTGGTTAGCTCAATATGA

Retrieve as FASTA