Entry information : OsRboh01 (Os01g0360200 / OsNox01 / OsRbohB)
Entry ID 5564
Creation 2007-07-18 (Christophe Dunand)
Last sequence changes 2007-07-18 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-08-13 (Qiang Li)
Peroxidase information: OsRboh01 (Os01g0360200 / OsNox01 / OsRbohB)
Name (synonym) OsRboh01 (Os01g0360200 / OsNox01 / OsRbohB)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Flowers
Inflorescences
Leaves
Roots
Stems
Vegetative tissues
Whole plant
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsRboh01
start..stop
S start..stop
ZmRboh24 1582 0 11..905 6..895
SbRboh01 1575 0 4..905 9..908
CsRboh03 1204 0 30..905 27..889
CclRboh03 1204 0 30..905 27..889
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14608941..14609499 559 N° 2 14608684..14608843 160 N° 3 14608405..14608453 49 N° 4 14608198..14608311 114
N° 5 14607690..14608124 435 N° 6 14606289..14606675 387 N° 7 14606088..14606180 93 N° 8 14605792..14605907 116
N° 9 14605597..14605699 103 N° 10 14605339..14605418 80 N° 11 14604692..14605203 512 N° 12 14604499..14604608 110
complement(join(14604499..14604608,14604692..14605203,14605339..14605418,1460559 7..14605699,14605792..14605907,14606088..14606180,14606289..14606675,14607690..1 4608124,14608198..14608311,14608405..14608453,14608684..14608843,14608941..14609 499))


exon

Literature and cross-references OsRboh01 (Os01g0360200 / OsNox01 / OsRbohB)
Literature Sasaki T.,et al., The genome sequence and structure of rice chromosome 1. Nature 420:312-316(2002).
Protein ref. UniProtKB:   Q5ZAJ0 UniProtKB_Uniparc:   A2ZT24 [Incorrect splicing]
DNA ref. GenBank:   NC_008394.1 (14609499..14604502)
mRNA ref. GenBank:   AK065117.1
Cluster/Prediction ref. UniGene:   Os.10600
Protein sequence: OsRboh01 (Os01g0360200 / OsNox01 / OsRbohB)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   905
PWM (Da):   %s   101547.27 Transmb domain:   %s   o356-375i496-518o538-560i721-738o
PI (pH):   %s   9.74
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MADLEAGMVAAATDQGNSTRSQDDAATLIPNSGNLGSSNRSTKTARFKDDDELVEITLDVQRDSVAIQEVRGVDEGGSGHGTGFDGLPLVSPSSKSGKLTSKLRQVTNGLKMKSSSRKAPSPQAQQSAKRVRKRLDRTKSSAAVALKGLQFVTAKVGNDGWAAVEKRFNQLQVDGVLLRSRFGKCIGMDGSDEFAVQMFDSLARKRGIVKQVLTKDELKDFYEQLTDQGFDNRLRTFFDMVDKNADGRLTAEEVKIIALSASANKLSKIKERADEYTALIMEELDPTNLGYIEMEDLEALLLQSPSEAAARSTTTHSSKLSKALSMKLASNKEMSPVRHYWQQFMYFLEENWKRSWVMTLWISICIALFIWKFIQYRNRAVFGIMGYCVTTAKGAAETLKFNMALVLLPVCRNTITWIRSKTQVGAVVPFNDNINFHKVIAAGVAVGVALHAGAHLTCDFPRLLHASDAQYELMKPFFGEKRPPNYWWFVKGTEGWTGVVMVVLMAIAFTLAQPWFRRNKLKDSNPLKKMTGFNAFWFTHHLFVIVYTLLFVHGTCLYLSRKWYKKTTWMYLAVPVVLYVSERILRLFRSHDAVGIQKVAVYPGNVLALYMSKPPGFRYRSGQYIFIKCTAVSPYEWHPFSITSAPGDDYLSVHIRTRGDWTSRLRTVFSACRPPTEGESGLLRADLSKGITDEKARFPKLLVDGPYGAPAQDYREYDVLLLIGLGIGATPLISIVKDVLNHIQGEGSVGTTEPESSSKAKKKPFMTKRAYFYWVTREEGSFEWFRGVMNEVSEKDKDGVIELHNHCSSVYQEGDARSALIVMLQELQHAKKGVDILSGTSVKTHFARPNWRSVFKKVAVSHENQRGVFYCGEPVLVPQLRQLSADFTHKTNTRFDFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 11 introns), 6 mRNA and 125 ESTs. Cultivar="Nipponbare". TGI accessions, TC285125 and TC332431 (frame shift) are compiles from Indica and Japonica. Two SwissProt/TREMBL accessions: Q5ZAJ0 and A2ZT24 ( extra sequence CWSYTFYGKKM not present in ESTs).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGACCTGGAAGCAGGCATGGTTGCTGCTGCCACAGACCAGGGCAATTCAACAAGGTCACAAGATGACGCAGCCACACTGATCCCGAACAGTGGCAATCTGGGCTCGAGCAACAGG
AGCACCAAGACGGCCAGGTTCAAGGACGACGACGAGCTGGTCGAGATCACCCTCGACGTGCAGCGCGATTCGGTGGCAATCCAAGAAGTGAGAGGGGTGGATGAGGGTGGCTCCGGGCAC
GGTACCGGGTTCGACGGCCTGCCACTGGTGTCACCCTCGTCGAAGAGCGGAAAGCTGACGTCAAAGCTCAGGCAGGTGACCAATGGGCTCAAGATGAAGAGCTCCAGCAGGAAGGCGCCA
TCCCCGCAGGCGCAGCAGTCTGCGAAGAGGGTGAGGAAGAGGCTGGACAGGACCAAGAGCAGCGCCGCCGTGGCGCTCAAAGGATTGCAGTTTGTGACTGCAAAGGTTGGCAATGACGGC
TGGGCCGCGGTGGAGAAGCGGTTCAATCAGCTGCAGGTGGATGGTGTGCTGCTCCGTTCAAGATTTGGGAAATGCATTG
GTAAATTTTTTTTTTCAGAAGTTGAGCTGAATTTGAATTGT
TCATACATCTGTTAGGAGAAATGGTGTTTATTCCATTATTTGGATTGATTGTGCAGGAATGGATGGGTCCGACGAGTTTGCGGTGCAAATGTTCGATTCTCTGGCGAGGAAGAGAGGGAT
AGTGAAGCAGGTGCTCACTAAGGACGAGCTCAAAGATTTCTATGAGCAATTGACTGATCAGGGGTTTGACAATCGTCTTCGGACATTCTTTGACAT
GTTAGTACTCTCTGAAAACACTTC
TAGTGTTGTCATGTTTCCTTTCTGTACTATTATAGGCATAAATATATTTCATGTGGTTAATTTGCCAAATCAAATTTCCACCACAGAGTAGCTCAATATCTTGCATAGAATTCAAGCAAG
TGAGCGACAAGCTTTTCATGCTTCTGTTTTGCTAACTGCTAAGCTATTCATTGTAGCACTTAACAATGTTCATTCTTGTTGTGCAGGGTTGACAAGAACGCTGATGGAAGGCTCACAGCA
GAAGAGGTTAAGGAG
GTAAGTCAGAAAACACAAAACCGAAAAAAAATATAACAATTTCTATATGTTCTGTGTTTAAATGGTATTAAATGGATGATTATGCTTTTGCAGATTATTGCCCTT
AGTGCATCAGCAAACAAACTTTCCAAGATCAAGGAGCGAGCTGATGAGTACACAGCACTCATTATGGAAGAGCTTGACCCTACAAACTTGGGATACATCGAG
GTTTGTCCAATTCCAAGC
ATCAAAGTAATATTGTGCACAACCTATGACCTAACCGCATTAATAATTTTGACAGATGGAGGACTTGGAAGCACTATTGCTTCAGTCACCATCTGAAGCTGCTGCAAGATCAACAACGAC
GCACAGCTCCAAACTTAGCAAAGCTCTTAGCATGAAGCTTGCGTCTAACAAAGAAATGAGCCCAGTTCGTCATTACTGGCAGCAGTTCATGTACTTCCTTGAAGAGAATTGGAAGCGCAG
TTGGGTTATGACTCTGTGGATCTCAATCTGCATTGCCCTTTTCATTTGGAAGTTCATTCAGTACCGTAATCGAGCCGTATTCGGCATCATGGGTTATTGTGTGACCACTGCAAAGGGTGC
TGCAGAGACCCTCAAATTCAACATGGCTTTGGTCCTACTTCCTGTCTGCAGAAATACAATCACATGGATTCGGTCAAAGACACAGGTTGGAGCTGTTGTACCCTTCAACGACAATATAAA
CTTTCATAAG
GTAAAATTATGTTGATTCAATCAATATTGAACTGATGGATTTTACCGTGTTGTGAATATCATCCAGTCCATTTTGCGTAGTGCTTTCCATAATCAAGTAAAGTCAATATT
TTTTTAAGATAATGGAAGCTTTATTGAACTCAGCCAATGACATCAAGATGATAGAACTGTACTAAGAACACTCTCGACCTCTGCATAACTAAGATGCACACAGTCAAAACACACCAACAC
TAGAATTTTTTTTAAAGAAAAAACTAAACAAAAGATAGGAGGGATTAAGGGCCATCAATCCATAGACTAGATCGCCACCCACGCTCCTAAGTAAAAAAACCCCCTCGCTACCTGCTCCAA
TTGTGACATGCCACAGCAATAAAATTATGCAGACCCGACTTCCGAAGAATATCCCAAGAACGGAGCCAATGAGTAATCAAAGAGATAACCTGGAAAGGAGAGTCAATCTTTATGTTATCA
AAAACCACATCATTACTGCCTAGCCACAATGACCAGCATATAGCAGCCGCTCCTAATAGGACTAAAGGTCTCAAATATTTAGATAAACACGAAAGCAAACTCGCAAACATATGTGAAACA
CTATGGGGGCAGACATAGGTTTGAAACTATTTGGATTAAAGACCAAATAGAATGAGCAAGACGACATTGGAAGAGTAAATGTTTAATCATCTCTTCTTTATGACAAAAGCAGCATATCTT
GCTACCTTGCTAATTACACTTGGCAAGATTATCCTTTGTTAGTACTACACGTCTACACCACGGCGTAAGCACCAAAGAAAGATCTTGACTTTTAGAGGACCCTTTAAATTCTAAAGTCGT
TTATTTAGTAACATATGAGTAACACATTAAACCTGTTCATCTGGTACATTTTTTCAATAATGGAAATTAGCATATCCTCTACATCAAAAAATGTGTCCGGCCATATAGTTGAGAACTAGG
CAAAAAAATATGAGTTGTGAGACTAATATCGACTTTACATAATCTATGATTTACTACTGTGCAGGTCATAGCCGCAGGTGTTGCAGTTGGTGTTGCTTTGCATGCAGGTGCTCATCTGAC
ATGTGATTTTCCCCGGCTGCTCCATGCGAGTGATGCACAATATGAACTAATGAAGCCCTTCTTTGGGGAGAAGAGGCCACCAAATTACTGGTGGTTTGTAAAGGGAACTGAAGGCTGGAC
AGGTGTGGTCATGGTGGTGCTCATGGCAATAGCATTTACATTAGCCCAACCATGGTTCCGACGTAACAAGCTCAAGGACTCCAATCCCCTCAAAAAAATGACTGGCTTCAATGCCTTCTG
GTTTACCCACCACCTGTTTGTCATTGTGTACACTTTGCTCTTTGTCCATGGAACGTGCTTGTATCTAAGCAGGAAATGGTACAAGAAGACG
GTAAAAGTCTATACCCTGAACACACAAGA
AATCCCAATGATCATAGTTGGTACCTTCTTTGTGAGGAGATCATAACTGATACTTATGGTTCATTTTTATCATTTTCAGACATGGATGTACCTCGCTGTTCCTGTTGTCCTGTATGTAAG
TGAGCGTATTCTTCGGTTGTTTAGGAGCCATGATGCAGTTGGGATTCAGAAG
GTACCATCAATCAAATCTCTTTCCTCAACTTACATATTACTACTATCCATCGCCATCCACATCTTTCC
TTTTTTTATGTTGTATTTTATTTAAAGGGTTTGAACTGAAACTAGCCTTGGAATGTCTGGAAGCTCTGAATCCGTCTTTTTTTTTTGGGTTTAACATCTCTGCTTTCAACAGGTTGCAGT
GTATCCCGGGAATGTATTGGCTCTTTATATGTCGAAGCCACCTGGTTTCAGATACCGTAGTGGGCAGTACATCTTCATAAAATGCACTGCTGTGTCTCCATATGAATG
GTGCTGGTCTTA
CACATTTTATGGAAAGAAAATGTATTATTTTGAAATAAAGTCCGCAGATAACTAAAAGAGCAATACTTTGTCTGTTACAGGCATCCATTTTCCATAACATCAGCACCTGGAGATGATTAT
CTTAGTGTTCATATTCGCACAAGGGGTGATTGGACTTCACGGCTTAGAACTGTTTTCTCTGAG
GTAATTGAACCAACTGCCTTTTATTTTTTTTGCTTTGTTCTATAGATAAACTCCTAA
GAAACATGACTTACGAACTTTGTAAGCACCTGAATTGCATTGTCTTTCATTTGTCATATCCAATTTATCTGCTTGATGGATTCAATCGACAACAAGTATGATAACAAAATCTTTGAACCA
GGCATGCCGACCCCCCACTGAGGGAGAAAGTGGACTACTTAGAGCTGACCTTTCCAAGGGAATAACGGACGAAAAAGCAAGGTGCAAAGGACTTCATTTGATTTGTTTGCGAAAAGCAGA
AATGCATTATATATCTTGCTTCATCTCATGGTAGGACTTTCCGTTATCTAAAGAAAAATCTTCCGTCTAACGATAATTCTGCTTTACATGCACTAGATTCCCAAAACTTTTGGTCGATGG
ACCGTATGGTGCACCGGCACAAGATTACCGTGAATACGATGTGCTACTTCTCATCGGGCTGGGCATCGGAGCCACCCCTTTGATTAGCATTGTGAAGGACGTGCTTAACCACATTCAAGG
TGAGGGATCAGTTGGAACCACGGAGCCGGAGAGCAGCAGCAAGGCGAAGAAGAAACCTTTCATGACGAAGAGAGCCTACTTCTACTGGGTGACGAGAGAGGAGGGCTCGTTTGAGTGGTT
CAGAGGCGTCATGAACGAGGTGTCTGAGAAGGACAAGGATGGAGTCATTGAGCTCCATAACCACTGCTCAAGCGTGTACCAGGAAGGCGATGCTCGTTCTGCTCTCATTGTCATGCTCCA
AGAACTTCAGCATGCGAAGAAGGGCGTCGATATCTTGTCGGGAACTAGTGTGAAGACCCATTTCGCACGACCTAATTGGCGAAGCGTCTTCAAGAAGGTTGCGGTCAGCCATGAGAACCA
GCGCGTCG
GTATGTTCTTCTTCCTGTCCTTTCAAATCCAGTAGTAGGAATGTCCATGATCCATTGCATATTAACCCTGTATATTTCTTCAGGTGTGTTCTACTGTGGTGAGCCTGTGCTG
GTTCCCCAACTAAGGCAGTTGTCAGCAGATTTCACCCACAAGACAAACACAAGATTTGATTTCCACAAGGAGAACTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGACCTGGAAGCAGGCATGGTTGCTGCTGCCACAGACCAGGGCAATTCAACAAGGTCACAAGATGACGCAGCCACACTGATCCCGAACAGTGGCAATCTGGGCTCGAGCAACAGG
AGCACCAAGACGGCCAGGTTCAAGGACGACGACGAGCTGGTCGAGATCACCCTCGACGTGCAGCGCGATTCGGTGGCAATCCAAGAAGTGAGAGGGGTGGATGAGGGTGGCTCCGGGCAC
GGTACCGGGTTCGACGGCCTGCCACTGGTGTCACCCTCGTCGAAGAGCGGAAAGCTGACGTCAAAGCTCAGGCAGGTGACCAATGGGCTCAAGATGAAGAGCTCCAGCAGGAAGGCGCCA
TCCCCGCAGGCGCAGCAGTCTGCGAAGAGGGTGAGGAAGAGGCTGGACAGGACCAAGAGCAGCGCCGCCGTGGCGCTCAAAGGATTGCAGTTTGTGACTGCAAAGGTTGGCAATGACGGC
TGGGCCGCGGTGGAGAAGCGGTTCAATCAGCTGCAGGTGGATGGTGTGCTGCTCCGTTCAAGATTTGGGAAATGCATTG
GAATGGATGGGTCCGACGAGTTTGCGGTGCAAATGTTCGAT
TCTCTGGCGAGGAAGAGAGGGATAGTGAAGCAGGTGCTCACTAAGGACGAGCTCAAAGATTTCTATGAGCAATTGACTGATCAGGGGTTTGACAATCGTCTTCGGACATTCTTTGACAT
G
GTTGACAAGAACGCTGATGGAAGGCTCACAGCAGAAGAGGTTAAGGAG
ATTATTGCCCTTAGTGCATCAGCAAACAAACTTTCCAAGATCAAGGAGCGAGCTGATGAGTACACAGCACTC
ATTATGGAAGAGCTTGACCCTACAAACTTGGGATACATCGAG
ATGGAGGACTTGGAAGCACTATTGCTTCAGTCACCATCTGAAGCTGCTGCAAGATCAACAACGACGCACAGCTCCAAA
CTTAGCAAAGCTCTTAGCATGAAGCTTGCGTCTAACAAAGAAATGAGCCCAGTTCGTCATTACTGGCAGCAGTTCATGTACTTCCTTGAAGAGAATTGGAAGCGCAGTTGGGTTATGACT
CTGTGGATCTCAATCTGCATTGCCCTTTTCATTTGGAAGTTCATTCAGTACCGTAATCGAGCCGTATTCGGCATCATGGGTTATTGTGTGACCACTGCAAAGGGTGCTGCAGAGACCCTC
AAATTCAACATGGCTTTGGTCCTACTTCCTGTCTGCAGAAATACAATCACATGGATTCGGTCAAAGACACAGGTTGGAGCTGTTGTACCCTTCAACGACAATATAAACTTTCATAAG
GTC
ATAGCCGCAGGTGTTGCAGTTGGTGTTGCTTTGCATGCAGGTGCTCATCTGACATGTGATTTTCCCCGGCTGCTCCATGCGAGTGATGCACAATATGAACTAATGAAGCCCTTCTTTGGG
GAGAAGAGGCCACCAAATTACTGGTGGTTTGTAAAGGGAACTGAAGGCTGGACAGGTGTGGTCATGGTGGTGCTCATGGCAATAGCATTTACATTAGCCCAACCATGGTTCCGACGTAAC
AAGCTCAAGGACTCCAATCCCCTCAAAAAAATGACTGGCTTCAATGCCTTCTGGTTTACCCACCACCTGTTTGTCATTGTGTACACTTTGCTCTTTGTCCATGGAACGTGCTTGTATCTA
AGCAGGAAATGGTACAAGAAGACG
ACATGGATGTACCTCGCTGTTCCTGTTGTCCTGTATGTAAGTGAGCGTATTCTTCGGTTGTTTAGGAGCCATGATGCAGTTGGGATTCAGAAGGTT
GCAGTGTATCCCGGGAATGTATTGGCTCTTTATATGTCGAAGCCACCTGGTTTCAGATACCGTAGTGGGCAGTACATCTTCATAAAATGCACTGCTGTGTCTCCATATGAATG
GCATCCA
TTTTCCATAACATCAGCACCTGGAGATGATTATCTTAGTGTTCATATTCGCACAAGGGGTGATTGGACTTCACGGCTTAGAACTGTTTTCTCTGAG
GCATGCCGACCCCCCACTGAGGGA
GAAAGTGGACTACTTAGAGCTGACCTTTCCAAGGGAATAACGGACGAAAAAGCAAG
ATTCCCAAAACTTTTGGTCGATGGACCGTATGGTGCACCGGCACAAGATTACCGTGAATACGAT
GTGCTACTTCTCATCGGGCTGGGCATCGGAGCCACCCCTTTGATTAGCATTGTGAAGGACGTGCTTAACCACATTCAAGGTGAGGGATCAGTTGGAACCACGGAGCCGGAGAGCAGCAGC
AAGGCGAAGAAGAAACCTTTCATGACGAAGAGAGCCTACTTCTACTGGGTGACGAGAGAGGAGGGCTCGTTTGAGTGGTTCAGAGGCGTCATGAACGAGGTGTCTGAGAAGGACAAGGAT
GGAGTCATTGAGCTCCATAACCACTGCTCAAGCGTGTACCAGGAAGGCGATGCTCGTTCTGCTCTCATTGTCATGCTCCAAGAACTTCAGCATGCGAAGAAGGGCGTCGATATCTTGTCG
GGAACTAGTGTGAAGACCCATTTCGCACGACCTAATTGGCGAAGCGTCTTCAAGAAGGTTGCGGTCAGCCATGAGAACCAGCGCGTCG
GTGTGTTCTACTGTGGTGAGCCTGTGCTGGTT
CCCCAACTAAGGCAGTTGTCAGCAGATTTCACCCACAAGACAAACACAAGATTTGATTTCCACAAGGAGAACTTCTAA

Retrieve as FASTA