Entry information : OsRboh02 (Os01g0734200 / OsNox02 / RbohAOsp / OsRbohA)
Entry ID 5567
Creation 2007-07-19 (Christophe Dunand)
Last sequence changes 2010-08-04 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-11 (Catherine Mathe)
Peroxidase information: OsRboh02 (Os01g0734200 / OsNox02 / RbohAOsp / OsRbohA)
Name (synonym) OsRboh02 (Os01g0734200 / OsNox02 / RbohAOsp / OsRbohA)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Callus
Inflorescences
Roots
Stems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsRboh02
start..stop
S start..stop
ZmRboh05 1727 0 1..943 1..942
SbRboh03 1726 0 1..943 1..944
OsRboh05 1680 0 11..943 19..951
SbRboh09 1655 0 11..943 18..957
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 30615335..30615980 646 N° 2 30616072..30616231 160 N° 3 30616350..30616398 49 N° 4 30617561..30617674 114
N° 5 30623848..30624270 423 N° 6 30624523..30624906 384 N° 7 30624991..30625086 96 N° 8 30625161..30625276 116
N° 9 30625431..30625598 168 N° 10 30625685..30625844 160 N° 11 30625999..30626196 198 N° 12 30626304..30626432 129
N° 13 30626595..30626673 79 N° 14 30627010..30627119 110  
join(30615335..30615980,30616072..30616231,30616350..30616398,30617561..30617674 ,30623848..30624270,30624523..30624906,30624991..30625086,30625161..30625276,306 25431..30625598,30625685..30625844,30625999..30626196,30626304..30626432,3062659 5..30626673,30627010..30627119)


exon

Literature and cross-references OsRboh02 (Os01g0734200 / OsNox02 / RbohAOsp / OsRbohA)
Cluster/Prediction ref. UniGene:   Os.3427
Protein sequence: OsRboh02 (Os01g0734200 / OsNox02 / RbohAOsp / OsRbohA)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   943
PWM (Da):   %s   106043.57 Transmb domain:   %s   o381-398i520-542o567-589i741-758o
PI (pH):   %s   9.57
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRGGASSGPQRWGSAGTTPRSLSTGSSPRGSDDRSSDDGEELVEVTLDLQDDDTIVLRSVEPAAAAAAGVGAGAGAASARGELTGGPSSSSSRSRSPSIRRSSSHRLLQFSQELKAEAMARARQFSQDLTKRFGRSHSRSEAQAPSGLESALAARAARRQRAQLDRTRSGAHKALRGLRFISSNKANNAWMEVQANFDRLARDGYLSRSDFAECIGMTESKEFALELFDTLSRRRQMKVDTINKDELREIWQQITDNSFDSRLQIFFEMVDKNADGRITEAEVKIIMLSASANKLSRLKEQAEEYAALIMEELDPEGLGYIELWQLETLLLQKDTYMNYSQALSYTSQALSQNLAGLRKKSSIRKISTSLSYYFEDNWKRLWVLALWIGIMAGLFTWKFMQYRNRYVFDVMGYCVTTAKGAAETLKLNMAIILLPVCRNTITWLRSTRAARALPFDDNINFHKTIAAAIVVGIILHAGNHLVCDFPRLIKSSDEKYAPLGQYFGEIKPTYFTLVKGVEGITGVIMVVCMIIAFTLATRWFRRSLVKLPRPFDKLTGFNAFWYSHHLFIIVYIALIVHGECLYLIHVWYRRTTWMYLSVPVCLYVGERILRFFRSGSYSVRLLKVAIYPGNVLTLQMSKPPTFRYKSGQYMFVQCPAVSPFEWHPFSITSAPGDDYLSIHVRQLGDWTRELKRVFAAACEPPAGGKSGLLRADETTKKILPKLLIDGPYGSPAQDYSKYDVLLLVGLGIGATPFISILKDLLNNIIKMEEEDASTDLYPPMGRNKPHVDLGTLMTITSRPKKILKTTNAYFYWVTREQGSFDWFKGVMNEIADLDQRNIIEMHNYLTSVYEEGDARSALITMLQALNHAKNGVDIVSGTKVRTHFARPNWRKVLSKISSKHPYAKIGVFYCGAPVLAQELSKLCHEFNGKCTTKFEFHKEHF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 10 introns), 4 mRNA and 12 ESTs. O48539 (partial mRNA, 5'end missing), O24214 (partial mRNA, 5'end missing), Q0JJJ9 (partial prediction, 5'end missing), A2ZXJ9 (partial prediction, 5'end missing), Q5JL59 (partial prediction, 5'end missing), A2ZXJ8 (partial prediction, short 5'end).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGGGCGGCGCCTCCTCGGGACCCCAGCGATGGGGCTCGGCGGGGACGACACCGCGGTCGCTGAGCACGGGCTCGTCGCCGCGCGGGTCCGACGACCGGAGCTCCGACGACGGGGAG
GAGCTGGTCGAGGTCACGCTCGACCTGCAGGACGACGACACCATTGTGCTTCGGAGCGTCGAGCCCGCGGCGGCGGCGGCGGCGGGGGTGGGGGCGGGGGCGGGGGCGGCGTCGGCGCGG
GGGGAGCTCACGGGTGGCCCGTCGTCGTCGTCGTCGCGGTCGAGGTCGCCGTCGATCCGGAGGAGCTCGTCGCACCGGCTGCTGCAGTTCTCGCAGGAGCTCAAGGCGGAGGCCATGGCC
CGGGCGCGGCAGTTCTCGCAGGACCTGACCAAGCGGTTCGGCCGCAGCCACAGCCGCAGCGAAGCGCAGGCGCCGTCGGGCCTCGAGTCCGCGCTCGCCGCCCGCGCCGCGCGGCGGCAG
CGCGCGCAGCTCGACCGCACACGCTCCGGCGCCCACAAGGCGCTCCGCGGCCTCCGCTTCATCAGCAGCAACAAGGCCAACAACGCCTGGATGGAGGTGCAGGCCAACTTCGACCGCCTC
GCCCGCGACGGCTACCTCTCCCGCTCCGACTTCGCCGAATGCATCG
GTATCCCTACCCACCGATCGCCCACCACCACCATTTTTCCCCCCACCGAATTGCTTTCTCACGCAGCATCCGCG
ACATTGTCGTCGTGCAGGGATGACGGAATCGAAGGAGTTCGCGCTCGAGCTGTTCGACACGCTGAGCCGGCGACGACAGATGAAGGTGGACACGATTAACAAGGATGAACTCCGCGAGAT
CTGGCAGCAGATCACCGATAACAGCTTCGACTCCCGTCTCCAAATCTTCTTCGAAAT
GTAATTAGCTACCCAATCCACTATCTCTGCAATTTTGCCATTATTACCAGTACTACTAGATAA
ACAGAGTATCAACTCTGCTAAATTTTGTGGCGATTTTCGTCTGCATTTTTACCAGGGTGGATAAGAACGCGGACGGCCGGATTACGGAGGCGGAGGTGAAAGAGGTGAGCAAAACATAAT
CCACGCCCATGTCTATGCTGTTCCTACGCTTGGTGGTCCAGCAGTACGAGTTCTTCTGTGCTTTTTTTCTCCATTCTTTTTAAATTTGCTATTTCAGGATATCAAATCGAATAATTTAGA
CCGTTTTGACAACCGTAGTTGTATATTTGGTCGATTGAGCTGTCCTCGCCTTGCTTGGGCCACACCAATATTTGTTTTCTCCCTCCAAAATATGCACACATCTAAGTCGCGATTCGCAAC
CTTACCGGATAGGATTACTTCTTAATTCTGATTAGAGGGAAGAACAGTTCTTAATTAACACGTAACAATCCGATAAGAGAGGACATTTTAGATCAGAAGCGTACTACGCAGGGAAAGGAG
AGAGGCATGCAGTACAAAGGTACGAGAAAAGAAGAAAAAATGCTTGGCTTCCAATCGGAGTCGGTGAGCGAAACCGGCGGGGAAAGCATCACGGCGACACCAACTCCTACCTGCCAGTTT
TGGGACACTCATTTTCTTTAACTTTTAGGAAAAGCCGAAAAGGGGTACCCTTTCTAGAACGTGTGAGGGCAGTTTCGGTAATCCGGTGGGCTTCGTGGCTTACAGAAGCCCTGTGAAGCG
GCAGTAGGTGAGGGGCATTTCTGTCAAACCCACTAAGGGCAAGTTTTATAGTAGAGGTGGCCACCACATCCAATTTCATGCATGACATATATAATTAAATTAAGAGGTGATATGTATAAT
AGATTACCTCTACTACACAATCCCCAATATCTCTAATACTCTCACATGTTTATTGAAGTTTATCCCCAATATCCCCAATATCCCTTGTATGAGAGGTGACTATTTCTCTCTCATCCTTGT
TCTCTCCTCCACCTCACTATTTAGTCCCATGTGGCATCTTAGGGCTTGTGCTTGGATGCCCATAGTACTTGCCCTAATGCTCTCTGATCAGCTCAAACGATGCGTTGACAAGATGAGTTA
TAAAGTAGCCTTTTAAAAAAAAAACGATTCGCTAATTTTTTGCCTCTCACTGATGTCACTAACAGTGCTGCGGAGCAAATTGAGTTGGTAGGGGTTTTTTTGGCTGCTCTGGGTTGCTTT
CTTGAGGTTTGGAAGATGTTGGATCATGTTGACTCAGCTCGTGTTTCTCCTTTCACCTACGCGCAGATTATTATGTTGAGCGCGTCTGCCAATAAACTGTCGAGGCTTAAGGAGCAAGCA
GAAGAGTACGCCGCTTTGATCATGGAGGAGCTTGATCCTGAAGGGCTCGGCTACATTGAG
GTAAGCTCGATGTTCTTAAGCAGTTAAGCTGGTGTAAACCCTCATAATGCGCTTATATCT
GTAATAGTTGTACTCATGCACTGTAAACCCACACTATTTACTTCCACCAAACCTTTAGGAATAGTTGACTGAAGCTGTCTGTTTTGGGATGGTAGTGCTGTAGTGGGGTAGTACCAGTAG
AGCCTAATTGATGACTTCGTGCAGTTCTATTTTATCTGTCACATTGCTCCGGTGATGGGTGTCCCCCAACCGGCCAAGCGCGCTTGTTATGATAATTAAACAAAAATTTGTCCGTCACAG
CGTCAAGGCCAACTACTTGCAAAGGGACGCATCATTCATAACAAAAAGATGATGCTGGTACCCCACAAACTTCTTGCCCACCCATCATCATTTATATCGAAGTTGTTGAGCAGACGTAGA
CCAGTGTAGCTGTGTAGCATCCATTTCAGTTTGGGAACAGTTTCGCTTCGCTCCCCTGCCTAATTCAATGCCATCCTTGCTGCCCACAGCTTGTTGCCGCACCATTTACAAAGGAATCAT
TTACAATGCCAGAAATGTTCCATCACGGTTCCATGGCTCTTGGTCGTGCATTGCTCTGCCTTGCCCGGGTGCAAGGGTAGGGAAGCTGATGTAGTAACTAATAAGCAGGGTAGCAAGTAC
TAGGGATTTAGGAACCAGGATTAACCCATGCGCTCATGTACTAGTAGGAATGTCGATCAAGGGTGTTTATCTGGACCATGCAGCCAGTGGCTTTGGTGATTGCCATCCATGATCCATGTT
AGGCCTCATTTGTTATGGTTTTAGTTCACCAGGTGATTCAAGTCCCACCTTTTCTAGCAGTGGGATAGCTACAACTTCAGTTTGGTGGGGATTCATATTTTTGTGCAACCGTACCAATTA
GATCGCCGTGTAGTGTTAACTTGTCTCGTACTTTTTTTACCCTCATAGTATTTGAAGTAAATTAACTTTACATGTTCGATAAGTTGACGCTTCTTTTTCAAAAGATAGCAAGAGATAACT
AGTTGACACAATTGTTTCATTTGAGTCAACACTGATTTAATATTTGTTTGTCCAAAATGGTTAGTTAAGCTTGAGAAAGTTCATGTACATATTTCATAGGGTAATTTCAGGACACATTTG
CCAATATTAGTAAAGCAGCAAACTGTAAATTCGAGTTTCTCTTAAATAAATTATTGAACTATGAATTATATACATCTGAAGAAAATGTTTGATATCTTCTTGATGAGAAGCGTTGCATCT
ATTCACAAATCACAAGTACCATGTACTGCATCTGGTATGACTGCACAACTTTTTACATGAAAGTCCTTTCATATATAAAAAAGGAGGTGTTTTACAATGATCTCTACTAGTAGTGCAACA
TTTTATTTTTTGCCATTGCAGCATAATTCTGTTGTTATATAATCTTGATATTATTATGTATTGGATGGTGAAAATTGATGTGCTGTTGTTGACATGCTCATGTGTTTCTTGCAAACAATT
TGTTGAGCTAATGGAAGTGTGAGGACGTCCCAAAGCCTAGGTGGTGCAACGCTCCGAGGCATGTCAGCGCGAAATATCTGGATGGATGGGTTCTCAAATAAAGCCCAAATAAATACGGTA
ACCATCCAACCTCATCGCAGACCCCGACATGTCTTGAAGAGTGCACTACATAGGCTCTAAGCCATCGGATATGAAATAGAAGACACAACTGTTGGAATAGCCACACCAGTCATCTACGTC
ATATGCCCGTCAACCACTCGATGGTGGCGACAAAAAACATACCCCAGAGACTCGATCTCAACAGAGGCATATTCCCCGGTTATCTCAACCATTTCAAACCCATCCTCATGTGGGACTAGT
CGCCCAGGAATGCAACATAGTCTCACATAAATCATCTCAAGCATGATATCCAAATAATAATTGGTTCTAAGCAATAAGCATAAATAGTCTTAATAAGGTTCTAAGTAGTACTTGGCGACA
AGCCATAAATATTGGTTCATGCGGTAAGCGTGCTACCCAAAAGCCCATAGGCAAACCGACTAGGGTAAATCCCTAGTTAGAACCATCCTGGAAATCTGCAACATCACAAGCTGCATCAAA
CTCCTCATCCAAACAGTCATTACCTGCAGCGCGGTCTGAGCATAAACAAGTAAAAAAAAGCAAGAAATCAGTACATTAATCAAATTAATGTATTGGCAAGTCGGAAACAATCCTAGCATA
CTACATGTTGGCCATATTCAAGGATAAGCTGTGTATAGGTTAATTTGCATAAATGCCAATTTTAGTTCACAACATGTTTCGCAACGGAATTTTATAACAATAGTATAGAGTAAGTAAAAC
TTGTAATGTGAATGAATAAATAATACACATCTACCCCTCAAGTCATCACATACCACATATCATTAATCAATTTCATCATATCACGAACCATAGGAAGTTCCGATAAGTTACCAAAACCCG
GTAACCCATACCCTTCGGCCTACCAAGATGCAAGGCTAAACTCTAAACAACTTAATAGGTTGAGGCCAGCCCATACTTAGCACATGTGGTTTGTACTGTTTTCATTAGTTGGTGACATAG
AGTGGGGTCCTTAATCGACCCGGGCGAACGCTCCCCCTATCGGTGTACAACTACCACCCTATGTACACTCGCCGCCCAAGTCTAAAAACAAGTTATTTCCATTTTCAGTTCACAATACTC
ACACACTTAAATTTCTGTCCAGCAACATCAAAATAACCATTTTCACATATAACATTTATCAAAACGAGTAATTTGCAAGGCGGTAACCAAATATAAGCATATAGCAGCAATATAAGCATA
GTATAATCCCAAAGAACACAATAATTGTATTCAAAAGCACTCTATGGTTACAACCAGCAAGGGTTCAATATTTCAAGGTGGATTATGCAGCAATTAGGTCATATCTACCATTCCCACATT
TATATAATATTTTTTTTACCAAAATTAATACTAGCTAACGTATGCATGTTTGCAATAGAATCATTTAGCCCAATAGAACATAGGATCAATGTGGTCAAAGGAGGGGCAAACTTTCCTTCG
TCTGCAAACTCCTGAGCCTGGTCGTCAACAAACTCACCCTCTTCTTCTTCGACGTATTCTTCCTCTATACAAAATACGTGTATACGATAAATACAAAAATGCATAAAAACCAAAATGCAT
GAAAATGCATGAAATTTATGCAGTGAGTGTGTGCTGGTCTCAGGTGGTCTCTGGTGAAGGAATTTTTATTTTGTCACTTTTTATTTACAGAGATATGCATTTTACAATTAAAAAGGTTTA
AAAGGGCTAAGTTTTATTAAGCAACATTTTTGTACAGAAGTGAACAAAATTCCTTTTACAAAGTTATAGAGCATGATTTTAGAAAGTTAACAGAAGTGGTTTCACAATTTTTAGAGCTAT
ATTCAATTCGTTATGGATTTAACAAGTTCTAGGCAACATTATGGCAAAACAAAAATAAAGGAAAAGTTTGTACAGAAAGTACCCATTTTTATATTTTTGTAAAATATTTCACAGCTTTAT
GGATCTAACAAAACTGGTTTCACAATTTTTGAAGTTAAAATGAATTTTCTACAAATTTTAGAAGTTCTGCTCATTCTCTGCTTTAAACCAAAATAGAAATCAAAATTTGAAATTGCATTC
CAGCCGGGTCCACAGGTCAGTGAAAGAAGATTTGCAGAGAGGCCCTCGGAAGTTGGGGGAATCATCCCGCACTTCTTCTGCCACCTGGACAGCAAACTTTATTAAGAGTCTCTATTCTTT
TGTTTATTTCCATCAAGGTCCTGCTATAGTAATATGAGTCATGGCAGTTTTCAGATTGGACCCTAGAGTCGATCAAATTCAAGAAATGAAGTCCCCAGCTATCTCACATCGGGAGCAGCC
ATGGCTGAGCTCGGTCTACGGCTCACCGGCGGCGATCAGTGGATCGAATCGGTTCGAGCACAAAAGAGAAAATGTAGAGAACGTTCTTGCGCATCCGTGAGTGGTGCTGGTGAGGGAAAT
GGTGGTCTGTAGCCCATAGAACATGAGCTACAGCGGTGGTGTGTCTCGGTATGCCCATGTATGTGCATGCAGAGGCTTGGTTAGTGCAAAGGGTTAGTGCATGTGCTCTCATATGGTACC
AGGGTGCTCACCAAGCAGAGAAACGGAGGCAGCGAGGTCCAGGGAGCGGCGGAGACGGTGGTTGATGGCCAACGGCGGCAAAACTCCGGCGTCGACGTCGCCGGGTCGACTCAAGGCGCG
AACTGTAACTTCGAGAGTACGGGGGTGTTAGAGATGAGCCACAGAGGGTGCATGCGCGAGGAATCCGGCGGAAACTCACCGGAGCTTGGTGTTGCTTCGGTGGTGAGGAACGGCGGCCGG
AGCGGCGTCGGCGGTTCGGGTGGCCGGCGGCGAGGACGGTGACGCCCACCACGTGCTCGACAGATTGGTCCTAGGGCAAAAGGGGTACGGGTGAGCTCGGCGTGATGCGTAGGTCACGTT
CCATAGGAGGAAAGAGAGAGGGACTCACCGGGGATGCACGGCGACGACGGCTAAGTCGCCGGAGCCGGGGAAGATGGCCGAGCTCTGGGCATTCTGTGCGTGGGGTGTGTTTTCTTGGAC
TTGGAACGCGATGTGGGGAGCGAGCTGTTGCTTCTGGTGCTTTGGCTTGGGAAATAAGGAAGAGTGGAGTGGGGGAGTGAGAGAGAGAGAGGTGGCTGGTGCACTCATTGTGTTCCTTGG
GCATTTATTGGGCATGAGGAACGGTGGATGCTGTGAGGGGAGAGTGGGAGGCTGTCATGTGGGTCCCGGGGGTTGTGGGGCCCACTGTCAGTGAAAGAAATTCGAAAATAGCCTTGGAGG
CTAAGTCAATGAGGGTTACCTGCCAAGGATCTTTGGAGGGGATTCAAGGTGGATTTTGAGCAGCAAGAAATCTGGCTAGATATCCTCTTGGTCAGGGGTGATGTGGAGAGTAAATGTGCT
GAAGTGGGTTGGGTTAGAAGTCTCTGGTTTAGGTTTGATGGAGTGATGAACATGTGTTGACAGTGTTGGTTAGCAGCAGTTGACAGTGCAGTTAGCAGCTGATTGGATTTTTGGAGGGAG
AGAAGAAAGGGTTAGAGAGTGATCCAGGGTATGCCACTCCTCAGGGTGTTAGAAGAAAGTTAGTAGAAGACTTTGGCTGAAACCAAACTTCAAAAAGAGGTTTTGAAATAAATTTTACAG
AGAGAGCAAGTTTGAATCTGCTAAGCAGTTTTTTTTTTCAGGATTTTGGAGAGATTAAAGTAGATCAACAAGTTAGCAAACCTTACTGAAAAACTCTGAAAATTTGTGGGTTGATTTCTG
ACATATCAAGGTATTTTTGAGAATTTTTGTGGAATTTTTGGATGCATATAATTACCAGATTAATTGTTTTTGTGACTCTAGGCCTATCAAGATGCATGTGATGATGAGATGATTAAGATC
CAAAAACAATTAAAATCACTCCACAACCACATGATGCATTTAAATTAAATTTAGTTCTCAGGTTTATAGGCTTGGGTATGTTACAGGAAGGGACCAACTTTCATTTTTAATAGGGAGTAT
CTAAAAAACTGCCGCAAGTTTTTTTGAGTGAAAAACTTTCACATGTAACTATAGTATAATCGAAGTGTAACTACATTGTAACTATACTATAACTGCATTGTAACTATACTGTAACTATGA
TATAACTTATATAAAACTTGTATTTAACTATGGTTTGATTGGTTAGCACCGGAATATTACACGTGACATGTGCGCAAATTTCTTTCTAGCAATTTTTTCCCTTCATGCACAAATCTCGAG
GCAATCCGATGGCTACAAATCCGAAAGTTTTGGAGGCAAAAGAACTTGTGGAAGTTTTCTAGCAATTCCATTTTAATATCACAGAACACTATATATATTAATTTAGGCGGTCTTGTGCTA
TGTATTCAGTATCCTCCATGTGTAGTACATGTATAGTGGCCCAGTGGTTGAGCTTATGGACCTTCATAGTACAATTTCTTTCTTTAGGAACCAGTTTTGAGAGAGTAGCTTATGTTTTGT
TCATAGAATATTATCCTCAAATCAACTAAATGTGCTTATAGTTTTGCATCAATGAAATGTGAATGACATGACTTCTGAAAAATACACTGTTTTTTTTTTTGTTTGTGTTACAGCTATGGC
AATTGGAGACACTTCTGTTGCAGAAAGATACCTATATGAACTATAGTCAGGCCCTTAGTTACACAAGCCAAGCACTGAGCCAGAATCTTGCAGGGCTAAGGAAGAAGAGTTCAATCCGCA
AAATAAGCACCTCTTTAAGCTACTATTTCGAGGACAACTGGAAACGTTTATGGGTGCTTGCATTGTGGATTGGGATAATGGCTGGACTGTTCACCTGGAAATTCATGCAGTATCGTAACC
GATATGTCTTTGATGTGATGGGCTACTGTGTCACAACAGCAAAAGGAGCTGCTGAAACCCTAAAGCTGAATATGGCAATTATCCTCCTGCCAGTATGCCGTAACACCATTACTTGGTTGC
GAAGTACAAGGGCTGCACGGGCACTACCTTTTGATGACAACATCAACTTCCACAAG
GTTAGCAAATAGTCTGTCATTGCCTCTGTTATCCCCTTGATACAATCTAGCACAGTGATCTGTA
TTGAAATCAATGAATTTAGACCTTGACCCAGTACTCTAGAATGTAGATGCTGCATTTGAGATACAAGCACAAGTAATAGGGTCATGACACAACTGAAAAATTTATAATATAAGTAGATAT
ATTGAACATTCTTCTGCTGACAAACTCGAAAAAGAAACTAACAACTTGTGTTTTTGTTGTAACGGCAGACTATTGCAGCAGCAATTGTGGTTGGTATAATCCTCCATGCAGGGAACCACC
TTGTATGCGATTTTCCACGGTTAATAAAATCATCAGATGAGAAGTATGCTCCTTTGGGCCAGTATTTTGGGGAAATAAAGCCAACATATTTTACATTGGTCAAAGGAGTGGAGGGCATCA
CTGGGGTAATCATGGTTGTATGCATGATAATTGCTTTTACTCTAGCAACCCGGTGGTTCCGCCGTAGCTTGGTTAAGCTTCCAAGGCCATTTGACAAACTGACTGGCTTCAATGCCTTTT
GGTATTCTCATCATCTGTTCATCATTGTGTATATCGCGCTCATTGTTCATGGAGAGTGTCTATACCTTATTCATGTCTGGTACAGAAGAACG
GTAAGATATTTTTGAATTTATCTTCATT
CATTGGTCTAAGATAATTCGAATTTCTAATGTCCTCATGCTTTTATTTCAATGCAGACATGGATGTATCTTTCAGTGCCTGTTTGCTTGTATGTAGGGGAGAGGATTCTAAGGTTCTTCA
GGTCTGGCAGTTATTCTGTCCGGCTATTGAAG
GTCAATCCAAAGACATTACAAAATTGAGCATTGATACTTTGTGCCTTGTACTAATTCAGTAACTTTCTTAGCAGGTGGCCATATATCC
AGGTAATGTTTTGACACTGCAAATGTCCAAGCCTCCCACGTTCCGTTACAAGAGTGGACAATATATGTTTGTTCAATGTCCAGCAGTGTCTCCCTTTGAATG
GTACTTGGTGCTTTTCAG
CTGAAATTTAATTGAATTATGTACACTGGATAACATTGCTAAGATAGATTACTTCTAATTTTCATGTGTAGTGCATATGTACGAAAGGCAAACTCAGGGCAATTAATCTAACATTAACAT
TTATTGTCTCTTGTAGGCATCCCTTCTCAATTACTTCAGCACCTGGGGATGACTACCTCAGCATTCATGTTCGACAACTTGGTGATTGGACACGAGAACTCAAGAGAGTATTTGCTGCAG
CTTGTGAGCCCCCAGCGGGTGGTAAAAGCGGCCTTCTTAGGGCAGATGAGACAACTAAGAAAAT
GTATGAACACTCCCTATGTTTACCACAACAAAATTTTGTACTTTGTGTGCACTAAC
ATTTATAATTTTGTCCTTTTGGCTATGCAGCTTACCCAAGCTTCTGATTGATGGACCGTATGGTTCTCCTGCTCAGGATTACAGCAAGTATGATGTTTTATTACTTGTTGGATTAGGAAT
TGGTGCGACACCCTTTATTAGCATATTAAAAGATCTTCTGAATAACATCATCAAAATGGAGGAAGAGGAG
GTATGTTTTCTGCAGTTGTCTTCCTAGTATTGCAAGTAAATAAAATATTA
CTCTTTTCCTTATCATGCTTATCTTCTTTGTGTAGTATAGTAACCATTTACGTTTTTAGCTGTGCCTTATGTTTTCGGTGTCCTCTGTTTCTCCGTATTTGCAGGATGCTTCTACTGATC
TTTATCCACCAATGGGTCGGAATAAGCCACATGTTGATCTGGGCACACTTATGACGATTACCTCAAGACCAAAGAAGATCTTGAAGACCACAAATGCTTACTTTTACTGGGTGACACGTG
AGCAAGGCTCTTTTGATTGGTTCAAAGGAGTCATGAATGAAATTGCTGACTTGGATCAAAGG
GTAAATAGACCAATTGTTTTTTTTCCAGTGCAGTTTGTTTGTCTTCAGAAATTTGCCA
TGCATTTCCTTGTGAACTTGTAGTTACGGTTGCCTTTGATTCATGCTAGAATATCATTGAGATGCACAACTACCTAACAAGCGTCTATGAGGAGGGGGATGCCAGGTCAGCACTCATCAC
CATGCTCCAAGCTCTGAACCATGCCAAGAATGGAGTTGATATTGTCTCTGGGACAAAA
GTAAGTATTGGCAGGACGTTTAACATCTCCACACGGATGCTGTAAAGCTGTTTTGTTTGATA
TTAAGTTTTTCACCTCACTGGTTATTATCGTAAAGAACTCAAAGTTAATAGAAATCACATTTGCCTTGTCCATTTAATTGTCACTGCACTTGTTTTTCAGGTCCGGACACATTTTGCACG
ACCAAATTGGAGAAAGGTCCTTTCTAAAATTTCCTCCAAGCATCCATATGCCAAAATAG
GTTAGTTTACATGCTTCAAGTCTAACTAATCTTTATCTTGATTTCCTTTGGTCATTCATGC
CTACTACCTAACTCTGCATATATAACTTATTAGATGTACTGAGTACTACATAAAAGAAACGCAAAACTTCCAATGATATATAATAAAAAATGGGAAAGGGGAAAACTTGAAATTCCACGC
CTTCTACACTTTCAGCTCTGTTGTAAATGAGCAGATCTGTAAACAAGTTACCACCTCGGGCTGAGTTACTCATCAACATTTGATCTATATAGTTAATATAGTGATATCGTAGACACATTA
TATATGGTTTGAGTACTTATTTGTGTTGCATACAGGTGTATTCTACTGTGGAGCTCCAGTCCTGGCACAAGAACTAAGCAAACTTTGCCATGAATTCAACGGGAAATGCACAACGAAGTT
CGAATTCCATAAGGAGCATTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGGGCGGCGCCTCCTCGGGACCCCAGCGATGGGGCTCGGCGGGGACGACACCGCGGTCGCTGAGCACGGGCTCGTCGCCGCGCGGGTCCGACGACCGGAGCTCCGACGACGGGGAG
GAGCTGGTCGAGGTCACGCTCGACCTGCAGGACGACGACACCATTGTGCTTCGGAGCGTCGAGCCCGCGGCGGCGGCGGCGGCGGGGGTGGGGGCGGGGGCGGGGGCGGCGTCGGCGCGG
GGGGAGCTCACGGGTGGCCCGTCGTCGTCGTCGTCGCGGTCGAGGTCGCCGTCGATCCGGAGGAGCTCGTCGCACCGGCTGCTGCAGTTCTCGCAGGAGCTCAAGGCGGAGGCCATGGCC
CGGGCGCGGCAGTTCTCGCAGGACCTGACCAAGCGGTTCGGCCGCAGCCACAGCCGCAGCGAAGCGCAGGCGCCGTCGGGCCTCGAGTCCGCGCTCGCCGCCCGCGCCGCGCGGCGGCAG
CGCGCGCAGCTCGACCGCACACGCTCCGGCGCCCACAAGGCGCTCCGCGGCCTCCGCTTCATCAGCAGCAACAAGGCCAACAACGCCTGGATGGAGGTGCAGGCCAACTTCGACCGCCTC
GCCCGCGACGGCTACCTCTCCCGCTCCGACTTCGCCGAATGCATCG
GGATGACGGAATCGAAGGAGTTCGCGCTCGAGCTGTTCGACACGCTGAGCCGGCGACGACAGATGAAGGTGGAC
ACGATTAACAAGGATGAACTCCGCGAGATCTGGCAGCAGATCACCGATAACAGCTTCGACTCCCGTCTCCAAATCTTCTTCGAAAT
GGTGGATAAGAACGCGGACGGCCGGATTACGGAG
GCGGAGGTGAAAGAG
ATTATTATGTTGAGCGCGTCTGCCAATAAACTGTCGAGGCTTAAGGAGCAAGCAGAAGAGTACGCCGCTTTGATCATGGAGGAGCTTGATCCTGAAGGGCTCGGC
TACATTGAG
CTATGGCAATTGGAGACACTTCTGTTGCAGAAAGATACCTATATGAACTATAGTCAGGCCCTTAGTTACACAAGCCAAGCACTGAGCCAGAATCTTGCAGGGCTAAGGAAG
AAGAGTTCAATCCGCAAAATAAGCACCTCTTTAAGCTACTATTTCGAGGACAACTGGAAACGTTTATGGGTGCTTGCATTGTGGATTGGGATAATGGCTGGACTGTTCACCTGGAAATTC
ATGCAGTATCGTAACCGATATGTCTTTGATGTGATGGGCTACTGTGTCACAACAGCAAAAGGAGCTGCTGAAACCCTAAAGCTGAATATGGCAATTATCCTCCTGCCAGTATGCCGTAAC
ACCATTACTTGGTTGCGAAGTACAAGGGCTGCACGGGCACTACCTTTTGATGACAACATCAACTTCCACAAG
ACTATTGCAGCAGCAATTGTGGTTGGTATAATCCTCCATGCAGGGAAC
CACCTTGTATGCGATTTTCCACGGTTAATAAAATCATCAGATGAGAAGTATGCTCCTTTGGGCCAGTATTTTGGGGAAATAAAGCCAACATATTTTACATTGGTCAAAGGAGTGGAGGGC
ATCACTGGGGTAATCATGGTTGTATGCATGATAATTGCTTTTACTCTAGCAACCCGGTGGTTCCGCCGTAGCTTGGTTAAGCTTCCAAGGCCATTTGACAAACTGACTGGCTTCAATGCC
TTTTGGTATTCTCATCATCTGTTCATCATTGTGTATATCGCGCTCATTGTTCATGGAGAGTGTCTATACCTTATTCATGTCTGGTACAGAAGAACG
ACATGGATGTATCTTTCAGTGCCT
GTTTGCTTGTATGTAGGGGAGAGGATTCTAAGGTTCTTCAGGTCTGGCAGTTATTCTGTCCGGCTATTGAAG
GTGGCCATATATCCAGGTAATGTTTTGACACTGCAAATGTCCAAGCCT
CCCACGTTCCGTTACAAGAGTGGACAATATATGTTTGTTCAATGTCCAGCAGTGTCTCCCTTTGAATG
GCATCCCTTCTCAATTACTTCAGCACCTGGGGATGACTACCTCAGCATTCAT
GTTCGACAACTTGGTGATTGGACACGAGAACTCAAGAGAGTATTTGCTGCAGCTTGTGAGCCCCCAGCGGGTGGTAAAAGCGGCCTTCTTAGGGCAGATGAGACAACTAAGAAAAT
CTTA
CCCAAGCTTCTGATTGATGGACCGTATGGTTCTCCTGCTCAGGATTACAGCAAGTATGATGTTTTATTACTTGTTGGATTAGGAATTGGTGCGACACCCTTTATTAGCATATTAAAAGAT
CTTCTGAATAACATCATCAAAATGGAGGAAGAGGAG
GATGCTTCTACTGATCTTTATCCACCAATGGGTCGGAATAAGCCACATGTTGATCTGGGCACACTTATGACGATTACCTCAAGA
CCAAAGAAGATCTTGAAGACCACAAATGCTTACTTTTACTGGGTGACACGTGAGCAAGGCTCTTTTGATTGGTTCAAAGGAGTCATGAATGAAATTGCTGACTTGGATCAAAGG
AATATC
ATTGAGATGCACAACTACCTAACAAGCGTCTATGAGGAGGGGGATGCCAGGTCAGCACTCATCACCATGCTCCAAGCTCTGAACCATGCCAAGAATGGAGTTGATATTGTCTCTGGGACA
AAA
GTCCGGACACATTTTGCACGACCAAATTGGAGAAAGGTCCTTTCTAAAATTTCCTCCAAGCATCCATATGCCAAAATAGGTGTATTCTACTGTGGAGCTCCAGTCCTGGCACAAGAA
CTAAGCAAACTTTGCCATGAATTCAACGGGAAATGCACAACGAAGTTCGAATTCCATAAGGAGCATTTCTGA

Retrieve as FASTA