Entry information : OsRboh05 (Os05g052800 / OsNox05 / OsRbohC)
Entry ID 5570
Creation 2007-07-19 (Christophe Dunand)
Last sequence changes 2007-07-19 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-11 (Catherine Mathe)
Peroxidase information: OsRboh05 (Os05g052800 / OsNox05 / OsRbohC)
Name (synonym) OsRboh05 (Os05g052800 / OsNox05 / OsRbohC)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Callus
Flowers
Inflorescences
Leaves
Seeds
Stems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsRboh05
start..stop
S start..stop
SbRboh09 1706 0 19..951 18..957
ZmRboh07 1691 0 19..951 16..948
HvRboh01 1677 0 21..951 17..963
SbRboh03 1657 0 11..951 3..944
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 26038345..26039014 670 N° 2 26038103..26038262 160 N° 3 26037969..26038017 49 N° 4 26037202..26037315 114
N° 5 26035150..26035572 423 N° 6 26033675..26034058 384 N° 7 26033491..26033586 96 N° 8 26033290..26033405 116
N° 9 26032980..26033147 168 N° 10 26032741..26032900 160 N° 11 26032362..26032559 198 N° 12 26032133..26032261 129
N° 13 26031961..26032039 79 N° 14 26031463..26031572 110  
complement(join(26031463..26031572,26031961..26032039,26032133..26032261,2603236 2..26032559,26032741..26032900,26032980..26033147,26033290..26033405,26033491..2 6033586,26033675..26034058,26035150..26035572,26037202..26037315,26037969..26038 017,26038103..26038262,26038345..26039014))


exon

Literature and cross-references OsRboh05 (Os05g052800 / OsNox05 / OsRbohC)
Literature IRGSP(International Rice Genome Sequencing Project). Oryza sativa nipponbare(GA3) genomic DNA, chromosome 5. Submitted (FEB-2005) to the EMBL/GenBank/DDBJ databases.
Protein ref. UniProtKB:   Q65XC8
DNA ref. GenBank:   NC_008398.1 (26039014..26031466)
mRNA ref. GenBank:   AK120905
Cluster/Prediction ref. UniGene:   Os.47765
Protein sequence: OsRboh05 (Os05g052800 / OsNox05 / OsRbohC)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   951
PWM (Da):   %s   106956.47 Transmb domain:   %s   o390-409i528-550o570-592i749-766o
PI (pH):   %s   9.69
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRAGIGSGSGGGTTPVRPRWGSGVTTPRSLSTGSSPRGSDRSSDDGEELVEVTLDLQEDDTIVLRSVEPAAGGAAVASSSGASPSAVAPPRRAEPPGGVASRSRSPAMRRTSSHRLLQFSQELKAEAMARARQFSQDLTKRFTRTQSTTTAPPGIESALAARAERRQRAQLDRTKSGAQRAIRGLRFISGPNKASNAWIEVQANFDRLARDGYLSRDDFPQCIGMTESKEFAMELFDTLSRRRQMQVDKINKEELREIWQQITDNSFDSRLQIFFDMVDKNADGHITEAEVKIIMLSASANKLSRLKEQAEEYAALIMEELDPEQLGYIELWQLETLLLQKDTYVNYSQALSYTSQALSQNLAGLRKRSPIRKISTKLSYYLEDNWKRLWVLALWIGIMAGLFIWKFIQYRHRYVFNVMGYCVTTAKGAAETLKLNMAIILLPVCRNTITWLRNTRAARALPFDDNINFHKTIAAAIVVGVILHGGLHLVCDFPRLIGSSEEKYAPLGKYFGETKPTYLTLVKGVEGITGVIMLVCMIIAFTLATRWFRRSLVKLPKPFDKLTGFNAFWYSHHLFIIVYISLVIHGEWLYLIRIWYKRTTWMYLAVPVCLYVGERTLRFFRSGSYSVRLLKVAIYPGNVLTLQMSKPPTFRYKSGQYMFVQCPAVSPFEWHPFSITSAPGDDYLSIHVRQLGDWTRELKRVFSAACEPPVGGKSGLLRADETTKKALPKLLIDGPYGSPAQDYSKYDVLLLVGLGIGATPFISILKDLINSIIKMEEEEASGDLYPPIGRNKAHVDLDTLMRITSKPKRVLKTTNAYFYWVTREQGSFDWFKGVMNEIAELDQRNIIEMHNYLTSVYEEGDARSALITMLQALNHAKNGVDIVSGTKVRTHFARPNFKKVLSKIASKHPYAKIGVFYCGAPVLAQELSDLCHDFNGRCTSKFEFHKEHF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 13 introns), 2 mRNA and 39 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGGCGGGAATCGGCAGCGGCAGCGGCGGCGGCACTACGCCGGTGCGGCCGCGATGGGGGTCTGGTGTGACGACGCCGCGGTCGCTGAGCACGGGGTCGTCGCCGCGCGGGTCGGAC
CGGAGCTCCGACGACGGGGAGGAGCTGGTCGAGGTGACGCTCGACCTGCAGGAGGACGACACCATTGTGCTGAGGAGCGTCGAGCCGGCGGCGGGGGGAGCGGCCGTGGCGTCGTCGTCG
GGTGCGTCGCCGTCAGCGGTGGCGCCGCCGAGGCGGGCGGAGCCGCCTGGCGGGGTGGCGTCGCGGTCGAGGTCGCCGGCGATGCGGCGGACGTCGTCGCACCGGCTGCTGCAGTTCTCG
CAGGAGCTCAAGGCCGAGGCCATGGCCCGCGCGCGCCAGTTCTCGCAGGACCTCACCAAGCGCTTCACGCGCACCCAGAGCACCACCACCGCCCCGCCGGGCATCGAGTCCGCCCTCGCG
GCCCGCGCGGAGCGCCGGCAGCGCGCGCAGCTCGACCGCACCAAGTCCGGCGCGCAGCGGGCGATCCGCGGCCTCCGCTTCATCAGCGGCCCCAACAAGGCCAGCAACGCGTGGATCGAA
GTCCAGGCCAACTTCGACCGCCTCGCCCGCGACGGCTACCTCTCCCGCGACGATTTCCCGCAATGCATAG
GTCAATCTCTTCCCCAATCGCCCCCATCCCCTTCCCAAACATTCCAGTCT
CCTTACTTTCCCCAGCTGCATTTGAGATGCAGGGATGACGGAGTCGAAGGAGTTCGCCATGGAGCTGTTCGACACCTTGAGCCGGCGGCGGCAGATGCAGGTGGACAAGATCAACAAGGA
AGAACTGCGCGAGATCTGGCAGCAGATCACCGACAACAGCTTCGACTCGCGCCTCCAGATCTTCTTCGATAT
GTAACTACCGTGCCGTACCAATTTGTGGACTGATTATTGATTTGTTCC
GTTAATGTGACTCCGTTTTGGTATGCGATTTATTCAGGGTGGATAAGAACGCAGATGGCCATATTACGGAGGCTGAGGTGAAAGAGGTAATAATAGTCCAATGCTGAGGTTGCTTTTTTT
TTTTTTACTTCCTGTATTACTCCATATTTTCCTGTCTTTTGGGGATATATTTTTTCGAACTGTTTTCCTGGGATATTTTGGTTTATGGAGTATTTGGATGATTGTGCTGTCCATTTCCCC
AGCTCTGTAGGTGTGTGTACTTGTTTTTTGTTGTCTGCAAGTTTATGTTCCTGAATTTACGCATAAGAATTATGGAACGCGTAGCTTGGAAAAAAGAATTCCTGACTAATGGAGGCCCCC
TTGGCCGAACTGGCCGGAAAGCACCCGCACTGGCTGTCTGCACACACTAGTTTTTTCTATACATTGAGGTACCTTGTTCTAGAACATGGGAGGGGTGTGTTGTAAATTTACTCCTACTAT
GGATGGAGATGGAAGTTTGAAGATTAATACAGTATAGTTGGTGGGGGCATTTCTGTCATGCTGCGTAATTATTATAATCTGTTCAAATGATGCGTGGAAAGAGGCAACTTTTGGATTAGA
GCTTAATTTATTCATTTCGCTGAGGTCATTGTGTAAAGGGCCGAGACAGGTTGTTTTTTTTTATCTTTTCTTGCTCGATATGTGAGGATGGTTTGTGATCAATAAATTAATAGTGGGGTT
TGGCTTTTTTCTTTTCCAGATTATTATGTTAAGTGCTTCTGCTAATAAACTGTCAAGACTCAAGGAGCAAGCAGAGGAATATGCGGCCTTGATCATGGAGGAACTTGATCCCGAACAGCT
TGGCTACATTGAG
GTAAACTAGCATGTTTCTTCTGCCATCTGTGTCTGAGCACTGATAGAAAGAATTACACAATGGTTGGTTCCATGATTTCCTCTGACAATCTACAACTATCCACTGAT
GTTTCCTTTTCTCTTTTCTTTTTTAAACATACTGCTACAGTGCTACTGATGTTAATAGGTTGGTTTAGGAGAAACATTCAAACAGATAAATCCGTTACTTACTGTTTTGTAAAAATGCGA
GAGATTGCATGTATGGTGCTTTTCACTCTATATATTCCAGCATGTGCACTCATACACTTTACCCTGCAGCGCTACATTAACTTGTTTCTCTAAAGCCCTGAAATGTTGTCTTCTCAACCT
AGAAAAACTACTGGCATGAAAAGAAATAAGGCCATCCAATTTAGGAACTGTTTATACGCTAAGAATTAATGGTTAGAATCTTAAGGAAGGTTAACTAGCCAAATCCTTCCACCGATTTAT
TTTTCTTTCTCCCTTTTGTCCCTCCAAAATCTATTTAAGATCCAAAATGCTGTGGCAACTGGTGATAACCATATGAAATAAATACATAATGCAATATTATCTTTTGAACAAGTAATTGCT
GCTATGATTTTGTGCAATATTCTCACATGCAAAAGATTACATGTCCAACAGACCAACACTGTCTTGATATATTGGGGTGGCAATTCACTCTTTCAATAAGATGTCAATTGCTGCTTATGT
ATTTTAGTATAGAAATACAATGTCTTTAACACCAAATACTACAGCATGCACTAATTCTTTGATATTCAGTAGTAGTAGTTGCATTTCACAAGTTCCATTTTATTTTGTTTTATTATGCAC
TTGCGTGTCTTTGTTAGACTTCTACGTTTTTTTGGAGATCATAAGAGACAAGTGCTGCATGTAAAAGATTCAGGAGGATATTCAAAGATTCAAATCTGTGTCCCTCTTTTTAAGGATGAA
ATAATTGCAAGCATGTTCTACAAGATTTTAGCATGTATGGTGCACTCATGTGGGAACCATGTGTGCCACCAGATGCAATTAAAATCTTGTGGGGACCTTCTGCATTTTAGTGAGTCATTT
GACTTTGGGGCCTTGGATTGATGTGTACCGTTTGCCTGCCTTGTATTTTCTGAGTGCAAGAAGTGTAATTAATGTTCTTGTATGTTGGTTGTGTCTATGACCTGCAGTTTCTGAGATGAT
ACCATGACATATTTTAATTAATTCAACGAGAATTAGCTTATTGTCTGATGATATTATGGTAGTTATGAAAAAAAATATATTAATGTGTTCTTCTGTATCATTGAAAACAAGACAATCACA
AGCATTGAAGCGATATGCAAGTAAAACGCCTAACATATTCATAAACTAAGAAGAATTCTAAACTTTAAATTTCAGTAGTAAGTTAATAATTTTGGTAACATTCTAAATGTTCAGAAATTC
TTTTTGGTTCATGGATTGTAGAAGAACCCACTTGTCAGCAACAGAAAATATCTTTGAAAAGTCTCTGTGTTATTTTAGGCATATTGTTTTTTCAGTTTGACCTGCTTACTGGTTACTGAG
ACAGTAAACTACATTTATGTGACACCCCTTTTCTCGCCGAGAATTATGTGATCCTTAAAAACACTACTTGTTGACATGACAGCTCTGGCAATTGGAGACATTGCTATTGCAAAAAGATAC
CTATGTGAACTATAGCCAAGCATTGAGCTACACAAGCCAGGCACTAAGCCAGAACCTTGCTGGTCTAAGGAAAAGGAGTCCAATCCGGAAAATAAGCACCAAATTAAGCTACTATCTGGA
GGACAACTGGAAGCGCCTGTGGGTACTTGCACTGTGGATTGGGATAATGGCTGGGTTGTTCATTTGGAAATTCATACAATACCGCCACCGATATGTCTTTAACGTGATGGGCTACTGTGT
AACAACTGCAAAAGGGGCTGCTGAGACTCTTAAGCTGAATATGGCTATTATCCTCCTGCCAGTATGCCGCAACACCATCACTTGGTTGAGGAATACAAGGGCTGCACGGGCATTGCCGTT
CGATGACAACATCAACTTCCACAAG
GTTAGCGACTAGACTATCTTTGTTCCTTTGTTGTCCTTTAAAACATGGAGAAAACACAGAGTAGATTCAAGATTTATCAATTGATTTGGTTGGAA
AAAAATATGACAGCACACAGCATATACTTTGGTTAAGGACATGATACCATGCATGATGCATGTTTGTACCTGTGGGGTTTATTTGTCATTTATGTCCATCACTATGAAGGGGACAATACA
ACTTTTATTGATAGGCTGCTCATCCATACTCTTTGCATTAATGCTCCTACCATCAGGACAAATAGTTTGGGCCATGGTCTACTGGACTCTCATTTACATCATGGTCGATGCATGTTAAAA
GATGGGTTATGATTTATGAATAGCCACAAAACATGGTCAGATAAGGTGTTTCTATTTTGATATATATAATTTTACTGGCTTGGCTTATCCTAGATGAATTAAGCCTATTATAAATAGTCA
TTTTCATTAGTTCTCCACAGCCAGGAGCCTAAACAAGCTCGTGATTGTTCATCTTTGAAGTTTGCCATTTGCATTAGAGAGCATTATTTTCTTGATTGAATCATAGTCATGCAAGTTCAT
TCCTGTCAGCTAACAGCATGCCTGTATGTGATATGCTTCTGAATCACCAGTTTACATTCCAAAATATGTATATTATTGCATGGACTAACTAACTTAAAGGAGGCACAAGAGAATATAAAG
TCATTTGGTTGGTATCATGCAGAGGGCACATAAGCCATGATTGGACCATATCAATCAGCAGATGGTATAGTTGATGTCACTTAAGACAGTTCATGCCAAATATCTCTTCCTATGGGATAT
AGCAGTCTGTGAAGTAGAAGAAGCATGAGGTTCAGTTTAGTCTTATTTTCACTAGAATGCACGAGATGCATTTAATTTTACTAAGCAAAAAAATAAACCATGATTATAATATGCTTTTTA
ATGGCACTGATAATGCCTTTGTGTCATCCTTAAACAAACAGACGCATTAAAATACATATGGTAGCATGGCCAATTCGGACATTTGTGTGACATGTTGACAATGACCCAGAGCAAGAATAC
AGCTAAGGGTGAATGTTTTGCTTCTTGTAATGGCAGACTATTGCAGCAGCAATTGTGGTTGGTGTTATCCTTCATGGAGGGCTCCATCTTGTATGTGATTTTCCACGGCTCATAGGTTCA
TCGGAGGAGAAGTATGCTCCACTAGGGAAGTATTTTGGTGAAACTAAGCCAACATATTTGACCCTGGTCAAAGGAGTGGAGGGCATAACTGGGGTAATCATGCTTGTGTGCATGATTATC
GCTTTTACTCTTGCAACCAGGTGGTTCCGCCGTAGCCTGGTGAAGCTTCCAAAGCCATTTGACAAATTAACTGGCTTCAACGCTTTCTGGTATTCTCACCATCTATTCATCATTGTGTAC
ATATCACTTGTAATTCATGGAGAGTGGCTATACCTTATCCGCATATGGTACAAAAGGACG
GTGAGATAATTATTTTTCATTTCTCCTTTTCTCTGTACCTGTGTACCAGAACAGTTTCAT
AAGCTTCTAATATAATTCTTTCCTACAGACATGGATGTATCTTGCAGTGCCCGTTTGTTTGTATGTAGGGGAGAGGACACTGAGGTTCTTCAGGTCTGGCAGTTATTCTGTCCGTCTGTT
GAAG
GTGGCACACATGCATCACAAAATTGTATTACACTATTTACATACTGATTTTGTGTACGGTCTTCTGACACACTATTTATTTGCAGGTGGCCATCTATCCTGGTAATGTTTTAACAC
TGCAGATGTCTAAGCCTCCCACATTCCGTTATAAGAGTGGGCAGTATATGTTTGTTCAATGTCCAGCTGTTTCACCCTTTGAATG
GTATATGCTCTTATTTCCTAATATGCTTCGCCTGG
AGTTTCTATTTATAAGATTGCAAATGTCATGTTTATGAACACCTTATTTGTAGAGTAGGTAGATCAGTATAGCTGCTTAGATGTTTAATGATTCTTTCCCCTTTCAGGCATCCCTTCTCA
ATAACTTCGGCACCTGGGGATGACTATCTCAGCATTCATGTTCGGCAACTTGGTGACTGGACAAGAGAGCTCAAGAGGGTGTTCTCAGCGGCTTGTGAGCCACCAGTGGGTGGGAAAAGT
GGTCTCCTTAGAGCAGATGAGACTACCAAGAAAGC
GTACGCTTATGCTCTATGTTTAGCAATAATTATATGCTTGTGCAGTTGGGGATTTTCATGACATTGTTTTGGAATGCAGCTTACC
CAAATTGTTGATTGATGGTCCATATGGCTCTCCTGCGCAAGACTACAGCAAGTATGATGTTTTACTGCTGGTTGGATTAGGAATTGGCGCAACGCCTTTTATCAGCATATTGAAAGACCT
TATCAACAGCATCATCAAAATGGAGGAAGAGGAA
GTAAGTGATCTTTATCGTATTTTCAGTTGCATCTTCCTGATGCCTAACTACAGTAATAGATATAATTGGTTGTAATTCTCATTTCT
CTGTGATCTATGTATGCATTTATATAATATCGTCTGTGAAGACCATGAGAGACAGGACAGGACAAACTGATTAAGTTCTTCACCTTTCTTTGCAGGAAGCTTCAGGTGATCTTTACCCGC
CAATCGGACGCAATAAAGCACATGTTGATCTTGACACCCTTATGAGGATTACCTCAAAACCAAAGAGGGTTTTGAAGACAACAAATGCTTATTTTTATTGGGTGACACGTGAACAAGGCT
CTTTTGATTGGTTTAAAGGAGTCATGAATGAGATTGCTGAACTAGATCAAAGG
GTAAGTGGGTAACTTATGTGAGCTAAGCCATATATTTTAAGTAATGTAATGTTCTATTTTGCATCTT
TTTCTTACAACCTTTCTTCTTGATTTATACCAGAATATTATTGAGATGCACAACTACCTCACAAGTGTTTACGAGGAAGGGGATGCTCGGTCAGCACTCATTACTATGCTGCAAGCTCTA
AACCATGCCAAGAATGGTGTTGATATAGTATCTGGAACTAAA
GTAAGTCACGTCTCACCACTTGACCTCATGCTGTACTCCTATAATTTGCATCATTGTTATTTGAACTTAACTATTCTA
TTACTTTTTTTGCAGGTCCGTACACATTTTGCAAGGCCAAATTTTAAGAAGGTTCTTTCTAAGATAGCCTCCAAACATCCTTATGCTAAAATAGGTAAGTTATCATATTGCGATATAATT
AAAGAAGCTATCCTTTTTTTAATCTATTTAGCTGTGATATACTCATCAGGATGTGAACTTTCTGGATCAACAAAACTGGGACTAGCATGTGCATATGACTGCAACATTTGTAATTCTCTT
GACATGTAACAATGCATATACCAGAAAATAGGAGGGGAGGTGGTGTACGAAATTGAGTAGCCGTGATCTGTTGAAGTACTTGAAACTTAAGTCTGTCATTTTGGTATTTAAGTAATAGCA
AGACGTAAAGCAAAATGAGGGGCTCTCAAGTTCAAGTACTTGTGTTCTTCTGATTAATTTTTGTATCAATTCTATCATCTTTTATCACTGTAATGAAGGTAATTGTGTTTGTTTGTGTAT
AGGAGTATTCTACTGTGGGGCTCCAGTTCTGGCTCAGGAATTAAGCGATCTTTGCCATGATTTTAATGGCAGATGCACGTCAAAATTTGAGTTTCACAAGGAGCATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGGCGGGAATCGGCAGCGGCAGCGGCGGCGGCACTACGCCGGTGCGGCCGCGATGGGGGTCTGGTGTGACGACGCCGCGGTCGCTGAGCACGGGGTCGTCGCCGCGCGGGTCGGAC
CGGAGCTCCGACGACGGGGAGGAGCTGGTCGAGGTGACGCTCGACCTGCAGGAGGACGACACCATTGTGCTGAGGAGCGTCGAGCCGGCGGCGGGGGGAGCGGCCGTGGCGTCGTCGTCG
GGTGCGTCGCCGTCAGCGGTGGCGCCGCCGAGGCGGGCGGAGCCGCCTGGCGGGGTGGCGTCGCGGTCGAGGTCGCCGGCGATGCGGCGGACGTCGTCGCACCGGCTGCTGCAGTTCTCG
CAGGAGCTCAAGGCCGAGGCCATGGCCCGCGCGCGCCAGTTCTCGCAGGACCTCACCAAGCGCTTCACGCGCACCCAGAGCACCACCACCGCCCCGCCGGGCATCGAGTCCGCCCTCGCG
GCCCGCGCGGAGCGCCGGCAGCGCGCGCAGCTCGACCGCACCAAGTCCGGCGCGCAGCGGGCGATCCGCGGCCTCCGCTTCATCAGCGGCCCCAACAAGGCCAGCAACGCGTGGATCGAA
GTCCAGGCCAACTTCGACCGCCTCGCCCGCGACGGCTACCTCTCCCGCGACGATTTCCCGCAATGCATAG
GGATGACGGAGTCGAAGGAGTTCGCCATGGAGCTGTTCGACACCTTGAGC
CGGCGGCGGCAGATGCAGGTGGACAAGATCAACAAGGAAGAACTGCGCGAGATCTGGCAGCAGATCACCGACAACAGCTTCGACTCGCGCCTCCAGATCTTCTTCGATAT
GGTGGATAAG
AACGCAGATGGCCATATTACGGAGGCTGAGGTGAAAGAG
ATTATTATGTTAAGTGCTTCTGCTAATAAACTGTCAAGACTCAAGGAGCAAGCAGAGGAATATGCGGCCTTGATCATGGAG
GAACTTGATCCCGAACAGCTTGGCTACATTGAG
CTCTGGCAATTGGAGACATTGCTATTGCAAAAAGATACCTATGTGAACTATAGCCAAGCATTGAGCTACACAAGCCAGGCACTAAGC
CAGAACCTTGCTGGTCTAAGGAAAAGGAGTCCAATCCGGAAAATAAGCACCAAATTAAGCTACTATCTGGAGGACAACTGGAAGCGCCTGTGGGTACTTGCACTGTGGATTGGGATAATG
GCTGGGTTGTTCATTTGGAAATTCATACAATACCGCCACCGATATGTCTTTAACGTGATGGGCTACTGTGTAACAACTGCAAAAGGGGCTGCTGAGACTCTTAAGCTGAATATGGCTATT
ATCCTCCTGCCAGTATGCCGCAACACCATCACTTGGTTGAGGAATACAAGGGCTGCACGGGCATTGCCGTTCGATGACAACATCAACTTCCACAAG
ACTATTGCAGCAGCAATTGTGGTT
GGTGTTATCCTTCATGGAGGGCTCCATCTTGTATGTGATTTTCCACGGCTCATAGGTTCATCGGAGGAGAAGTATGCTCCACTAGGGAAGTATTTTGGTGAAACTAAGCCAACATATTTG
ACCCTGGTCAAAGGAGTGGAGGGCATAACTGGGGTAATCATGCTTGTGTGCATGATTATCGCTTTTACTCTTGCAACCAGGTGGTTCCGCCGTAGCCTGGTGAAGCTTCCAAAGCCATTT
GACAAATTAACTGGCTTCAACGCTTTCTGGTATTCTCACCATCTATTCATCATTGTGTACATATCACTTGTAATTCATGGAGAGTGGCTATACCTTATCCGCATATGGTACAAAAGGACG
ACATGGATGTATCTTGCAGTGCCCGTTTGTTTGTATGTAGGGGAGAGGACACTGAGGTTCTTCAGGTCTGGCAGTTATTCTGTCCGTCTGTTGAAGGTGGCCATCTATCCTGGTAATGTT
TTAACACTGCAGATGTCTAAGCCTCCCACATTCCGTTATAAGAGTGGGCAGTATATGTTTGTTCAATGTCCAGCTGTTTCACCCTTTGAATG
GCATCCCTTCTCAATAACTTCGGCACCT
GGGGATGACTATCTCAGCATTCATGTTCGGCAACTTGGTGACTGGACAAGAGAGCTCAAGAGGGTGTTCTCAGCGGCTTGTGAGCCACCAGTGGGTGGGAAAAGTGGTCTCCTTAGAGCA
GATGAGACTACCAAGAAAGC
CTTACCCAAATTGTTGATTGATGGTCCATATGGCTCTCCTGCGCAAGACTACAGCAAGTATGATGTTTTACTGCTGGTTGGATTAGGAATTGGCGCAACG
CCTTTTATCAGCATATTGAAAGACCTTATCAACAGCATCATCAAAATGGAGGAAGAGGAA
GAAGCTTCAGGTGATCTTTACCCGCCAATCGGACGCAATAAAGCACATGTTGATCTTGAC
ACCCTTATGAGGATTACCTCAAAACCAAAGAGGGTTTTGAAGACAACAAATGCTTATTTTTATTGGGTGACACGTGAACAAGGCTCTTTTGATTGGTTTAAAGGAGTCATGAATGAGATT
GCTGAACTAGATCAAAGG
AATATTATTGAGATGCACAACTACCTCACAAGTGTTTACGAGGAAGGGGATGCTCGGTCAGCACTCATTACTATGCTGCAAGCTCTAAACCATGCCAAGAAT
GGTGTTGATATAGTATCTGGAACTAAA
GTCCGTACACATTTTGCAAGGCCAAATTTTAAGAAGGTTCTTTCTAAGATAGCCTCCAAACATCCTTATGCTAAAATAGGAGTATTCTACTGT
GGGGCTCCAGTTCTGGCTCAGGAATTAAGCGATCTTTGCCATGATTTTAATGGCAGATGCACGTCAAAATTTGAGTTTCACAAGGAGCATTTCTAA

Retrieve as FASTA