Entry information : OsRboh07 (Os09g0438000 / OsNox07 / OsRbohG)
Entry ID 5571
Creation 2007-07-19 (Christophe Dunand)
Last sequence changes 2007-07-19 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-11 (Catherine Mathe)
Peroxidase information: OsRboh07 (Os09g0438000 / OsNox07 / OsRbohG)
Name (synonym) OsRboh07 (Os09g0438000 / OsNox07 / OsRbohG)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Callus
Flowers
Inflorescences
Leaves
Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsRboh07
start..stop
S start..stop
SbRboh02 1665 0 1..1007 1..1007
ZmRboh08 1662 0 1..1007 1..1000
OsRboh06 1482 0 1..1007 1..978
VvRboh07 1229 0 36..1007 14..917
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 16131779..16132475 697 N° 2 16132609..16132768 160 N° 3 16132944..16132992 49 N° 4 16133158..16133271 114
N° 5 16133434..16133958 525 N° 6 16135538..16135969 432 N° 7 16139530..16139625 96 N° 8 16140610..16140725 116
N° 9 16140822..16140992 171 N° 10 16141080..16141239 160 N° 11 16141328..16141513 186 N° 12 16141624..16141752 129
N° 13 16141837..16141915 79 N° 14 16142034..16142143 110  
join(16131779..16132475,16132609..16132768,16132944..16132992,16133158..16133271 ,16133434..16133958,16135538..16135969,16139530..16139625,16140610..16140725,161 40822..16140992,16141080..16141239,16141328..16141513,16141624..16141752,1614183 7..16141915,16142034..16142143)


exon

Literature and cross-references OsRboh07 (Os09g0438000 / OsNox07 / OsRbohG)
Literature IRGSP(International Rice Genome Sequencing Project). Oryza sativa nipponbare(GA3) genomic DNA, chromosome 9. Unpublished.
Protein ref. UniProtKB:   Q69LJ6   Q69LJ7 UniProtKB_Uniparc:   A3BZ74
DNA ref. GenBank:   NC_008402.1 (16131779..16142140)
Cluster/Prediction ref. UniGene:   Os.39734
Protein sequence: OsRboh07 (Os09g0438000 / OsNox07 / OsRbohG)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1007
PWM (Da):   %s   111916.29 Transmb domain:   %s   o433-452i563-585o629-651i809-826o
PI (pH):   %s   9.78
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MWTPSRGSNAARRSGHRRIADYLADDQTTNTDTSDNESYTTAYGDEFFAAAAAAAGSGGGGMLPAFLADQGDLVEVMLELDEESMVVRSVTPTSATLYGGGGGQMPQPLPPPLRTPEGGGGARSLSRCSSTSSRIRKKFAWLRSPSPSPSPRPPTPAELQREAAMAARERRRIQARLNRSSTGAKRALKGLRFISRTTGTVQAAELWRRVEDRFNALARDGLLSRDDFGECIGMVDSKEFAVGIFDALARRRRQNLERITREELYDFWLQISDQSFDARLQIFFDMVDTNVDGRITREEVQLIVLSASANKLAKLKEQAEEYASLIMEELDPENLGYIELWQLEALLLQRDSYMNYSRPLSTASGAQWSQNLGGAAVAAGAAAATGGGAHAAVAARGGQQQQQQQEGRRGGWGVRKAAARVRVAAEENWRRAWVVALWFAAMASLFVWKFVQYRRTPAFRVMGYCLPTAKGAAETLKLNMALVLLPVCRNTLTWLRSSWARFFVPFDDNITFHKMIATAIVVGITLHAGNHLACDFPRLIASGPEEYRLVADAFGPEKPTYVGLLSGVEGITGVAMVVLMTVSFTLATHPFRKGEKGGSGGGAAATVLPTVARLPSPFNRLAGFNAFWYSHHLLGIVYALLIAHGYFLFLVRRWYLKTTWMYISVPLMLYVGERMLRALRSNAYAVKILKVCLLPGNVLTITMSKPYGFRYRSGQYIFLQCPTISPFEWHPFSITSAPGDDYLSVHIRTNGDWTQELKRIFVENYFSPHLNRRASFSELGATEPRSLPRLLVDGPYGAPAQDFRNYDVLLLVGLGIGATPFISILRDLLNNIKLAEELDLAMETSRSEDSANSFSVSTASSNKKRAYRTSRAHFYWVTREPLSFEWFKGVMNEVAEMDKKGVIELHNYLTSVYEERDARTTLLSMVQALNHAKHGVDIVSGTRVRTHFARPNWKEVFTRIASKHPNSTVGVFYCGAPTLAKELKTLSHEMSHRTGTRFHFHKEYF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 9, 13 introns), 3 mRNA and 15 ESTs. Q69LJ7, A3BZ74 (uncorrect prediction, extra sequence not confirmed from ESTs), Q69LJ6 (uncorrect 3'end prediction).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGACGCCGTCGCGCGGGAGCAACGCCGCGCGGCGGAGTGGCCATAGGCGCATCGCGGACTACCTCGCCGACGACCAGACCACCAACACCGACACCTCCGACAACGAGTCATACACC
ACCGCCTATGGCGATGAGTTCTTCGCCGCGGCGGCGGCGGCGGCCGGGAGTGGAGGGGGTGGTATGCTGCCGGCATTCCTCGCCGACCAGGGGGACCTCGTCGAGGTCATGCTGGAGCTC
GACGAGGAGTCCATGGTCGTGCGCAGCGTCACTCCCACCAGCGCCACTCTCTACGGCGGCGGCGGCGGGCAGATGCCACAGCCGCTGCCGCCGCCGCTGCGCACGCCGGAGGGGGGCGGG
GGAGCGCGGAGCCTGAGCCGGTGCTCGTCGACGTCGTCGCGGATACGGAAGAAGTTCGCGTGGCTGCGCTCGCCGTCCCCCTCGCCGTCGCCGCGCCCGCCGACGCCCGCGGAGCTGCAG
CGCGAGGCGGCCATGGCGGCGCGCGAGCGCCGCCGCATCCAGGCCCGCCTCAACCGCTCCAGCACCGGCGCCAAGCGCGCCCTCAAGGGCCTCCGCTTCATCAGCCGCACCACCGGCACC
GTCCAGGCCGCCGAGCTCTGGCGCCGCGTCGAGGACCGCTTCAACGCCCTCGCCCGCGACGGCCTCCTCTCCCGCGACGACTTCGGCGAATGCATCG
GTATCAAACACCAAACACACACA
ATTCCACCAATTCCATTCACCACCACCATGATCCTATCCACCATTATCGCGACGTTTATTGGCCTCGCATGCCCATCTCAATCAATTGAAACCCATTATCAAACCCGCAGGAATGGTGGA
CTCCAAGGAGTTCGCCGTCGGCATCTTCGACGCGCTGGCGCGGCGGCGGCGACAGAATCTGGAGCGGATCACCAGAGAGGAGCTCTACGACTTCTGGCTCCAGATCTCCGACCAGAGCTT
CGACGCGCGCCTCCAGATCTTCTTCGACAT
GTATGTACTCAACCCGAATTCTACCCCCTTCCCCCCATCAAAATTTACATTTTCTTTTTCACCGGATCGCACGTAACGGATCAATCGATC
CATCCGTCCCGAATCCCGATGCCCATTGTGGTAGTCACAGATTCTTGATAATGCTTCTTGTTGCGTTCTTGGCCCCAAAATTCAGGGTGGACACCAACGTGGATGGGAGGATAACGAGGG
AGGAAGTACAGGAG
GTGACTTTGTTTAAACACGTTTTAAACTTTCTTTTTCTCTTTTACCTTCTCTCTCACTAATCATCAGAAGCTTCTTCCTGTGGGCACCCAGTTGCCTAAATTTCTA
ATCCGATCACTAACCAATTCTCCATTTTTTTTACTGCGGTAATTAACTGTCACTCGCAGCTGATCGTCCTGAGCGCGTCGGCGAACAAGCTGGCGAAGCTGAAGGAGCAAGCGGAGGAGT
ACGCGTCGCTCATCATGGAGGAGCTCGACCCGGAGAACCTCGGCTACATTGAG
GTGCGTGCACTGATGCGTATTTATTTTTTTTCTTTTTTTCTCTATCTCTTGGCCGTATACGTATATA
CGTATAGTGTACGTATATGTTTAGAGCTTTGTCTTTTTGGTGGGCTCCGGCGTGATGACACGTGTCTCGTCGTCTTCCTCGTTTGTGTCCGCCAGCTGTGGCAGCTGGAGGCGCTGCTGC
TCCAGCGCGACAGCTACATGAATTACAGCCGGCCGCTGAGCACGGCGAGCGGCGCCCAGTGGAGCCAGAACCTCGGCGGCGCCGCCGTGGCGGCGGGGGCGGCAGCAGCAACAGGCGGAG
GAGCGCACGCGGCGGTGGCGGCGAGAGGGGGGCAGCAGCAGCAGCAGCAGCAGGAGGGGAGGAGGGGAGGGTGGGGGGTGAGGAAGGCGGCGGCGAGGGTGAGGGTGGCGGCGGAGGAGA
ACTGGCGGCGGGCGTGGGTGGTGGCGCTGTGGTTCGCCGCCATGGCGTCGCTGTTCGTGTGGAAGTTCGTGCAGTACCGGCGCACGCCGGCGTTCCGGGTGATGGGGTACTGCCTCCCGA
CGGCGAAGGGCGCCGCCGAGACGCTCAAGCTCAACATGGCGCTCGTCCTCCTCCCCGTCTGCCGCAACACGCTGACGTGGCTCCGCTCCTCCTGGGCCCGCTTCTTCGTCCCCTTCGACG
ACAACATCACCTTCCACAAG
GTAAATTCAATTAAATCCCCTCCCGCCTAAATAACACTCTCCGTCTCCTTTTAAATACAGTCGTATGTCCCATTTTAAATACAGTCAGAATTTGTATATT
TAAATTTTAACTATCTATCTTATATTTAAAAAAAATATTAAATAGGTTAAAAATAAGATATTTAAATTTTAATCGTCTATCTAATTTAAAAAGTTTATTAAATATTTTAAAAATAGGTCA
AAAAAATTTCAAGTAAGATATACCGTCAATATGTTCAGATTCGTTATACTCCCTCTGTTTTTTAATAGATGACGCCGTTGACTTTTTCTCACATGTTTGACCATTCGTCTTATTCAAAAA
ATTTTATACAAATGTATAAGATATAAATCACACTTAAAGTACTATGAGTGATAAAACAACTCATAACAAAATAAATTATAATTACGTAAATTTTTTGAATAAGACGAATGGTCAAACATG
TGAGAAAAAGTCAACGGCGTCATCTATTAAAAAATAGAGGTAGTACTATAAAATATCTCATCCAGTCCTAGTTACTATATTATGGGATGGATGGAGTACATAAATTTATAACTGCATTTA
AAATGGGATGGAGAGTAAGTGTGTAACGTGTCATGCGGTTAAACTCTCTTCACTTGTTCTTTTTTTCTTTTTTTTTACTATGTATGGTAAGTATATACTTTACGTTTTGACTTTGGTTAA
AATTATCTATAAACTTAATTAAACTTAAAACAGTTTGAAAACTTACATGAAACGGATAGAGTAGAAGCTACTGTTTGGTAAGTATATATTCTCTTTATAAAACATTTTAATTTTAGTTAA
AGTTATCTATAAATTTAATTAAACTTAAAACTTTAATTAAAACAGTTTGACTCTCGTAACCTGAAACTTACCTGAAACGGATGGAGTAGAAGCTACTGTCGCCGGGATACAGCGGCGACG
CGGCGGTTGGTTGAGCGGTCGCCGTCGTCGGCGGTGCGTCATGTTTGGAGGGGTAACGTGGCGGGCAATGATTGGCCGGCCACGTGGAGCCCACCGGCTCTCTCTCTCCGGGATCCCGTG
TGAAATTGGCCTCCGCGCTTTGCCTCCCATGTGGTAGCTCGAGACTTTTTATCCCTGGAGAGTGGAGAGAGGAGTAGAATGGCTTAGCGTACTGTATACTTCGGCTGTCTGGGTCCCATG
TCGCACTGGTCAGCTACCCCCTCCCATGTTACATGCTGCCCGCCCTATCATTTTGCTCTACTACTACTTGCTGCCAAAATCCACGGTCGCCGCAGAAGATCCCTTGCCCCCACACATGGT
ACGACTACGGTGTTCTACTTGTACTGTTCAGTAATCGCCAAAAGTCAAGGGTCAAAATTAGTCCAGAGACCGACAAGCTACCTCTTGCGAAGTGGACACCCAGTCACCCACCCATGTCCC
CGTGTTAGAAACTTCTGGTAACTAAACACACTCAAATCGAAGAATTACAAGTTTCTTGAGGATGACATGTAGAACTATGAACAAAACAATATTATTGTTTTATTTGTAAATGGTGAAAAA
TGTAAAGATAATAGTAACAAATAATTTTTTTTGTTGCAGATGATTGCGACGGCGATCGTGGTGGGGATCACGCTGCACGCGGGGAACCATCTGGCGTGCGATTTCCCGAGGCTGATCGCG
TCGGGGCCGGAGGAGTACCGGCTGGTGGCGGACGCGTTCGGGCCGGAGAAGCCGACCTACGTGGGGCTCCTCTCGGGCGTGGAGGGCATCACGGGGGTCGCCATGGTGGTGCTCATGACC
GTCTCCTTCACGCTGGCCACCCACCCGTTCCGCAAGGGCGAGAAGGGTGGCAGCGGCGGTGGCGCAGCCGCCACCGTCCTCCCCACGGTAGCGCGGCTCCCCTCGCCGTTCAACCGCCTC
GCGGGGTTCAACGCCTTCTGGTACTCCCACCACCTCCTCGGCATCGTCTACGCTCTTCTTATCGCCCATGGGTACTTCCTCTTCCTCGTCCGTCGCTGGTATTTGAAAACG
GTATGTGCC
ATCACAAACATCCTTAAAAATATCCAATTATTTTATATTTTTTCCTTTTTTTTGCTTGAATCCGTTACGGATTTTTTGGGTTTTTTTTTTAAAACGGTGAGGGTGACGGTTTTCTGTTTG
GTCCGGGCGGCGCGTGCAAAAGCATTTGGGGTCCACCCGGTGGGCTCGCTTTCGTTTGGGAAGGGGCGTTTTCAGGGTGTTTTTCCTCTGCTGCTTTATGTTGCCATCCCCTCTAGAAGC
GTTCGTTACCTCTCGTTGCAGTGAGTGACAACATGACTCGTGACAGCAACGGTGCCCAAAAAGAAAAGAGAGGAATGTTTTTGAGACTTGAGAGAGTGAGTCGAGACAAAGTCAAACCGA
GAAAAAAAATCTTTTTTTGCCTTAAAAGAGCTCTATTTATTTTTTGTAAGTACGAAAAGAAAATAGTCAGATTATTTAGGTGACCTGTGCAGTGCAGAGTCGCCGTGGTTGCTAGCCAGC
CGGGCACCAGATCGACCTACTGTGCTGTCCTGTGTCTTGCTCGTGATGGTCAAGGATGGCGTAGTTGTGTGATTGTGTCCCTGATCATAAATAGGCCGTGTCGAGGTAGGCAGCGGCGTA
GGGGGGGCAGGTCGAGACCGGTCCACAGCTGTGTACTCCAGTGTTGAAGTTGCTGTGAGTTGTCACGGTGGAGTACATGTGTTGGCGGAGTACGAGTCGAGTCGTCCAGACTCTAGAGCC
TCTTCCCCTGACGTGTGTATAAATGTAAGTTTGCCGGTGGTCTCCAAGGTCGCCAGGTGGCCGTGCTGTTTCTGCGGCCCCTTGTACCTACCCGTTCCAGGCCGCCATGTAGCCATGTCA
AGACAGAAATGACAGAAATAATACCGTTGTTTCAACGTGGTGTTCTTTTTCTCATGAAGATAAATATAAATGTTAAGTTTTTTACGTAATATGAGATGATATTAATGAATGATTGATTGA
GTTTTAATTATTATAAACTTGAAAAATAGATTAATATGATATTTTAGAGCAACTTTCATATAGAAGGTTTCGCACGAAACGTATCGTTTAGCAGTTTGAAAAGCGAGTTACGAAAATCTT
AATCTTCATCCAACTTTTGTTGCAAGCTCGTGTGTTGCAACATCTTCTTTTATTCAGTTTAGCAGAAGGATTTAGACAGAGTGGGTAGATTAGTTTTTACATTGTTTTTTTTTAGAAATT
AGTTTTTACGGGAGGGAATTGGTTTTGAGTACGAAGTGGGAGAAAGGGGTGGAAAGAAGATGACCTTCTTTTTTAATTAGTAGAGAAATGTGTTTGCTGGCGTGGTGATATGTATGTGTG
GTTTTAACCACAAGGTACTTTATAAGAAAAAAAATCTATTGTTCTAATGCTTTTAAACCAGAATTTTAAAGTTACGGATAGTTAAAATTATAAAAGTTTGATATCAATATTTTTCAAAAC
ATAAAAAATATGGAATGTTTTACTAATTATTTTACAAGTAATATTTGTGTCTTTTAAGTACCTACAAGCCTACAACTTGATTGATAAAAAATAGTACTAATTAGAGTTTGATAGTAAAGT
CAGGGTGTCTATGACGATAATATATTCGCGTAGTGTTACGATGGAAACTTACTACGCACTTGCTGAGAGGTGGCGTCAGTTCTGCGTAAGCTTAATCCAACACTGGACGTAGTAGACGAT
GATGAAACACTTTTACTAACGGATTTTTATTGATCATGGTCCTACATTTGTTGGTGGATCTAGTTGCCACTGCTTTACAGGGCATTTTCATTTGGATTTGGGTGTTGATAAAATAGGTGG
GGATCGCTAAGACTAATCAATATAATCATCATAGACAGGCTAGATCTATTAAATGCCATGAATGGCTGTGAATGCTTCCTGCTTTACAGAATGGAGCACCGATGTTAGTCATCCATCTCT
GAAATCTGAACAATATTGTTTCACTGAATGTCTGAATAATTAATGGATAGTAGTAGTATCATCCAAAGCTCAAAAGCCAGCAAACTTTACCCCACATTTACATGAGGTAGGCGGTTACAA
TGATTTTTACCACTAGGTCACATCATGATCTTTCGTCAGGAGACAGCCCAAATCTGCAAGCGACGAGCTTTCAGTTCTTGCCTTAACCATGAAGGTTACAATGATGGATTCAGCATGAAA
CTTCTCCTGTTTGGTTGCTTGCTTGATTGTTTCTACTCTAACAGTATACTACTGCTGGTGCTAGTAGTACTACTACCTTTCTTTGCCACTGTGCTTTGAGTCTTTGACCCTTAATCACAT
GCCCCCCACGATTAGTATAATCCAGCTCACCTACTGCAACCGGCCTAATGCAGCTAGCTTTCTCACATTTTGCCACGAACTCGTCACCTCCATTGCTACTACTCTCCTGGCTGCTTCTAC
ATGTGGATGCATGCCATGCCTCGAAGACTTTTTATCTATCTATCATGGCCACTAAATTTTATGGCCGGCCTAGCTTGGTGCCCATTGCCATCTCACCAAACTCCCTGAGTTAATTAAGCA
GCATTAGCAGCAGCAGCAGTAGTAGTGTTACTTAGCTTTCTTGATCAGTGACCACCACTTAACAACGACTAAAAATGTGAAGCTTAATGCGTTCGTGTCCCTTGTCACATGTGGTGATGA
GACGTACGAGACGGCGAGAATTATTGCCGTGCTATGTTGATCTAGGAGGGGCCAAGAGGCTCTTAGTTGTAAAGGAGATCATGGGGTGGTGGCAGTGGCATCTATAGGGGATCGGATCCG
ATTAAAGAGGCTGTCTAGCTAGTGAAAGGCGAAAGAGTGACCTGCACTGGTCGCCATCTCATCTCTGCCCCTAGAATTTGACAGTGAAACTTCCCGTGCAGTTCATGGCAGCTTGTGGCA
TGAACTTTTTTTTTTTTTTTGAGTTCTTTTATGAAACTTTTCTTTTTGTTGGATGGGAGGAGGACCACCTGGCATTCAAGAGGAATGGGCGTTTTATGGTGCGTTTTTCATGGTTCCAAT
TTGTCTCTTTTTTTTTGTGATGGTTGCTGAATTGAGGTGTCATATATATATGCAGTTATCCATGAGGAAAGGCTGTTCGAAATCCTCTTGATTAGGTGCATTCTCGAATTTTTAAAATTG
TTTTGCTAGTATAGTCAAGAGCCAGCTTGGCCTATTTGACAAACATGTATGTTCTGCTGTAGATTAACAGAATGCCTAGTACTATTTGCACAATACAGAAGGTTCATTTGTCAGAAAGTA
CACACTGGTCTCCAGAACGCACATGGTAGTCGGTCCACATGTTTATCAGTATAATTTTATATATTATATTCGATGTAAACACATTTTATTGTGCAATTCTCGAAGCACCAAAGAATCTGA
CAGCTGCCAAGTGCCAAAACGAGTGGTTCAATTTGTTATTTTAATGCAGCTTATCTTTCTCTTATCTCTTTTGGAATGATATCATGTGGGAAAATTTTCTTTTCAAACAATTTTGTGTAA
TAAAAGGCGAAGTTCAGGTTAGGAACAACGCAGAGCTTTAACATTGAGGAATCTTGTTGCATTTTTTTCAGACATGGATGTACATTTCTGTTCCATTGATGCTGTATGTCGGTGAAAGGA
TGCTACGAGCCTTGCGGTCAAATGCTTATGCTGTCAAAATCTTGAAG
GTAATTTGGTAACTGTAAATGGCATAAACTTTTTGTAGTTTCTAATACTAATTGATTGACTTTTCTGCACCTC
TAAAAAGTTTTATGCTATTTCATTAGTGCTGATTGATCTACTTTACTGCCTAGTACATGATTAATCGACCAGTGTAAATATTAAAATAGAAAAAGGAGCTGTCATAGACAACTTGCACAG
ATCCTAATTAGAGATCCATTACGAGTTCCAAAGTCTTGGATCCATCATTGTAATAACATGGAGTGGAGAGTGCAGGTTTGGTGATAGCAGTAGAATGGTTTTTTGTTTGTTGAAAGTAAA
GGAGAAATGGAGAATGTTGTGCCATTGTGGGATACAAGTCATATTGCCACTACTAGTTCACCAACAATAAAAATAGACCTTACTTGAACATTTCGGTCCTTCAGAAAATGCATGTCGCTC
TCTAAAGACTTTCATGTCTTTGAGGTCCACGGTTTTGCTTAATTGTCGATTAGTCTATTCTGTCTTCAGTGCTCCCATGTATAGGAACATAGTAGCAACTTTTTGTTAGGCTCTGTTCTA
CGGAGATTCTGGTCACAAAGGGTTGTGTTACATACCCAATCCCCAACACATGATTTTACTACTGATCCTATTTTAATGCTTTTCTTAAACCTAGGGTAAGCTATAATATTAATTTCAAGA
CAAATATTAACATGTCATTTTCCTATGTCACATATAAATATTTAGAATAATAATATAGGCAGCTAAACTTTTGAAATTTTGACCCAAGGTATCCTAAAACGTTGTGTTGCAAGAAACATT
TCTCGAGAGTGCTACAATCATTTTAGTAATGTAAAATAAAGGAATATTTAAGCATATTAACCTTATAATTGAAAGTTATCACGATTAAAGAGAAAATACTGTGCACAGTATTTTTTTTTT
CATTTACCATAATGTTTACTACATGAAACCAATCTAAAGACATATTTTCTTATGTAAATTGATTCGCTCAGGTCTGCCTTCTACCTGGAAATGTATTGACCATAACAATGTCAAAGCCCT
ACGGATTTCGATATAGAAGTGGACAGTACATATTTCTTCAGTGTCCCACAATTTCTCCCTTCGAATG
GTTTGTACAACTCTCCATTAATTCACCGGTTCTCATCGAGTTACTCACAGCTT
ATAGTATAGTAATTCAAGTGCTGATTCACTGTGTTTGTTTCAGGCATCCCTTCTCCATCACTTCAGCTCCTGGAGATGACTACCTCAGTGTTCACATCCGAACAAACGGAGACTGGACAC
AGGAGCTGAAGCGCATATTCGTCGAGAACTACTTCTCGCCACACCTTAACAGAAGAGCTTCATTCAGCGAGCTAGGCGCCACAGAACCAAGAAG
GTCAGCCCATCACCATTTCCATGACA
TCTTCCTTATATTCCTGAAAGACAATAAACTGAAAATTGTTTTTGGTTCTATATATCACAGCTTACCAAGATTGCTCGTCGACGGTCCCTATGGCGCCCCTGCACAGGATTTCAGAAACT
ACGACGTGCTGCTTCTTGTCGGCCTCGGGATCGGGGCGACACCATTCATCAGCATCCTGAGGGACCTACTTAACAATATTAAGCTAGCTGAAGAGCTGATG
GTATTACTCCATCCTATGC
TGTTGCCATTTCTACCACTAACATGCTTCTGCTTCATACCAGCTCACATTGTTTTTGCACAACTATTAGGACTTGGCAATGGAGACCAGTAGATCTGAGGACAGTGCCAACAGCTTCAGT
GTGTCAACAGCAAGTAGCAACAAGAAGAGGGCATACAGAACAAGCCGCGCACATTTTTACTGGGTTACCCGGGAGCCATTGTCATTTGAGTGGTTCAAAGGAGTGATGAATGAGGTTGCT
GAAATGGACAAGAAG
GTAGGAAATGCAGGGAGAAATACTGCTATCAATCCGTATTTTCAGACTACTGATAGGCCAGCAGTATATTGACAGTGTTCATGATCAACTCGTTATTCAATTTGA
ACCAGGGTGTGATAGAGCTGCACAATTATCTGACGAGCGTTTACGAGGAGCGCGATGCGCGGACAACTCTGCTGTCCATGGTGCAAGCTCTGAACCATGCCAAGCATGGTGTTGACATCG
TCTCAGGCACAAGG
GTAAAGATCTAAAGGAGAAGTAGATACAGAGTCTCCTCTTACAAGTAGATTCTGTTAACTGAACATCCACTCTGTACTCAACAGGTGAGGACACATTTTGCAAGAC
CAAACTGGAAAGAAGTCTTCACCAGGATTGCCTCCAAGCACCCCAATTCAACAGTTG
GTAAATCTCTCTCCCAGTAAACCTATCCAATTGCATCAATTGCTGGCATGATCAATATGCATG
TGTTCCTCGAAAATTCTCTGACACGAATGGTTTGGTTTTCTGACGAAAAACGCAGGAGTTTTCTACTGCGGCGCGCCGACGCTAGCCAAGGAGCTGAAGACCCTGTCCCACGAGATGAGC
CACAGGACGGGGACTCGCTTCCATTTCCACAAGGAGTACTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGACGCCGTCGCGCGGGAGCAACGCCGCGCGGCGGAGTGGCCATAGGCGCATCGCGGACTACCTCGCCGACGACCAGACCACCAACACCGACACCTCCGACAACGAGTCATACACC
ACCGCCTATGGCGATGAGTTCTTCGCCGCGGCGGCGGCGGCGGCCGGGAGTGGAGGGGGTGGTATGCTGCCGGCATTCCTCGCCGACCAGGGGGACCTCGTCGAGGTCATGCTGGAGCTC
GACGAGGAGTCCATGGTCGTGCGCAGCGTCACTCCCACCAGCGCCACTCTCTACGGCGGCGGCGGCGGGCAGATGCCACAGCCGCTGCCGCCGCCGCTGCGCACGCCGGAGGGGGGCGGG
GGAGCGCGGAGCCTGAGCCGGTGCTCGTCGACGTCGTCGCGGATACGGAAGAAGTTCGCGTGGCTGCGCTCGCCGTCCCCCTCGCCGTCGCCGCGCCCGCCGACGCCCGCGGAGCTGCAG
CGCGAGGCGGCCATGGCGGCGCGCGAGCGCCGCCGCATCCAGGCCCGCCTCAACCGCTCCAGCACCGGCGCCAAGCGCGCCCTCAAGGGCCTCCGCTTCATCAGCCGCACCACCGGCACC
GTCCAGGCCGCCGAGCTCTGGCGCCGCGTCGAGGACCGCTTCAACGCCCTCGCCCGCGACGGCCTCCTCTCCCGCGACGACTTCGGCGAATGCATCG
GAATGGTGGACTCCAAGGAGTTC
GCCGTCGGCATCTTCGACGCGCTGGCGCGGCGGCGGCGACAGAATCTGGAGCGGATCACCAGAGAGGAGCTCTACGACTTCTGGCTCCAGATCTCCGACCAGAGCTTCGACGCGCGCCTC
CAGATCTTCTTCGACAT
GGTGGACACCAACGTGGATGGGAGGATAACGAGGGAGGAAGTACAGGAGCTGATCGTCCTGAGCGCGTCGGCGAACAAGCTGGCGAAGCTGAAGGAGCAAGCG
GAGGAGTACGCGTCGCTCATCATGGAGGAGCTCGACCCGGAGAACCTCGGCTACATTGAG
CTGTGGCAGCTGGAGGCGCTGCTGCTCCAGCGCGACAGCTACATGAATTACAGCCGGCCG
CTGAGCACGGCGAGCGGCGCCCAGTGGAGCCAGAACCTCGGCGGCGCCGCCGTGGCGGCGGGGGCGGCAGCAGCAACAGGCGGAGGAGCGCACGCGGCGGTGGCGGCGAGAGGGGGGCAG
CAGCAGCAGCAGCAGCAGGAGGGGAGGAGGGGAGGGTGGGGGGTGAGGAAGGCGGCGGCGAGGGTGAGGGTGGCGGCGGAGGAGAACTGGCGGCGGGCGTGGGTGGTGGCGCTGTGGTTC
GCCGCCATGGCGTCGCTGTTCGTGTGGAAGTTCGTGCAGTACCGGCGCACGCCGGCGTTCCGGGTGATGGGGTACTGCCTCCCGACGGCGAAGGGCGCCGCCGAGACGCTCAAGCTCAAC
ATGGCGCTCGTCCTCCTCCCCGTCTGCCGCAACACGCTGACGTGGCTCCGCTCCTCCTGGGCCCGCTTCTTCGTCCCCTTCGACGACAACATCACCTTCCACAAG
ATGATTGCGACGGCG
ATCGTGGTGGGGATCACGCTGCACGCGGGGAACCATCTGGCGTGCGATTTCCCGAGGCTGATCGCGTCGGGGCCGGAGGAGTACCGGCTGGTGGCGGACGCGTTCGGGCCGGAGAAGCCG
ACCTACGTGGGGCTCCTCTCGGGCGTGGAGGGCATCACGGGGGTCGCCATGGTGGTGCTCATGACCGTCTCCTTCACGCTGGCCACCCACCCGTTCCGCAAGGGCGAGAAGGGTGGCAGC
GGCGGTGGCGCAGCCGCCACCGTCCTCCCCACGGTAGCGCGGCTCCCCTCGCCGTTCAACCGCCTCGCGGGGTTCAACGCCTTCTGGTACTCCCACCACCTCCTCGGCATCGTCTACGCT
CTTCTTATCGCCCATGGGTACTTCCTCTTCCTCGTCCGTCGCTGGTATTTGAAAACG
ACATGGATGTACATTTCTGTTCCATTGATGCTGTATGTCGGTGAAAGGATGCTACGAGCCTTG
CGGTCAAATGCTTATGCTGTCAAAATCTTGAAG
GTCTGCCTTCTACCTGGAAATGTATTGACCATAACAATGTCAAAGCCCTACGGATTTCGATATAGAAGTGGACAGTACATATTTCTT
CAGTGTCCCACAATTTCTCCCTTCGAATG
GCATCCCTTCTCCATCACTTCAGCTCCTGGAGATGACTACCTCAGTGTTCACATCCGAACAAACGGAGACTGGACACAGGAGCTGAAGCGC
ATATTCGTCGAGAACTACTTCTCGCCACACCTTAACAGAAGAGCTTCATTCAGCGAGCTAGGCGCCACAGAACCAAGAAG
CTTACCAAGATTGCTCGTCGACGGTCCCTATGGCGCCCCT
GCACAGGATTTCAGAAACTACGACGTGCTGCTTCTTGTCGGCCTCGGGATCGGGGCGACACCATTCATCAGCATCCTGAGGGACCTACTTAACAATATTAAGCTAGCTGAAGAGCTGATG
GACTTGGCAATGGAGACCAGTAGATCTGAGGACAGTGCCAACAGCTTCAGTGTGTCAACAGCAAGTAGCAACAAGAAGAGGGCATACAGAACAAGCCGCGCACATTTTTACTGGGTTACC
CGGGAGCCATTGTCATTTGAGTGGTTCAAAGGAGTGATGAATGAGGTTGCTGAAATGGACAAGAAG
GGTGTGATAGAGCTGCACAATTATCTGACGAGCGTTTACGAGGAGCGCGATGCG
CGGACAACTCTGCTGTCCATGGTGCAAGCTCTGAACCATGCCAAGCATGGTGTTGACATCGTCTCAGGCACAAGG
GTGAGGACACATTTTGCAAGACCAAACTGGAAAGAAGTCTTCACC
AGGATTGCCTCCAAGCACCCCAATTCAACAGTTG
GAGTTTTCTACTGCGGCGCGCCGACGCTAGCCAAGGAGCTGAAGACCCTGTCCCACGAGATGAGCCACAGGACGGGGACTCGCTTC
CATTTCCACAAGGAGTACTTCTGA

Retrieve as FASTA